Nucleic acid encoding kreotoxin and preparation method of kreotoxin

Abstract

The invention relates to the technical field of gene engineering, in particular to nucleic acid for encoding kreotoxin and a preparation method of the kreotoxin. The invention provides nucleic acid for encoding the botulinum toxin, the nucleic acid is subjected to codon optimization, and the scheme is proved to be superior to other optimized sequences. Through verification, the sequence has a relatively high expression quantity in escherichia coli and is in soluble expression, and the prepared kreotoxin has good activity.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a nucleic acid encoding botulinum toxin and a method for preparing botulinum toxin. Background Art

[0002] Clostridium botulinum, also known as Clostridium botulinum, is a bacterium widely distributed in nature. It can produce botulinum toxin under anaerobic conditions, which is a protein neurotoxin. The molecular weight of botulinum toxin is 900kDa, and it is composed of three parts: hemagglutinin protein (HA), non-toxin non-hemagglutinin protein (NTNH) and neurotoxin protein. Among them, the molecular weight of neurotoxin protein is 150kDa, which is the main toxic component of botulinum toxin.

[0003] Botulinum toxin, referred to as Botox, has a very complex molecular structure, consisting of two parts: a light chain and a heavy chain. The light chain is close to the N-terminus and is the catalytic domain, and the heavy chain is close to the C-terminus and is the receptor binding domain. The two are connected by a disulfide bond to form a toxic botulinum toxin. Botulinum toxin mainly acts on the junction of nerves and muscles, inhibiting the release of acetylcholine from the presynaptic membrane at the end of cholinergic nerve fibers, making it impossible for nerve impulses to be transmitted to muscles, thereby causing muscle atrophy or cessation of movement.

[0004] The existing method for preparing botulinum toxin is mainly to express proteins through anaerobic fermentation of Clostridium botulinum: first, Clostridium botulinum will express the required protein through anaerobic fermentation; then, through a multi-stage purification process, the botulinum toxin is purified from the fermentation broth. This process is mainly achieved through dialysis and a series of acid precipitations. Dialysis can help remove small molecule impurities in the fermentation broth, while acid precipitation can separate botulinum toxin from other proteins by utilizing the solubility differences of different proteins at different pH values. This step requires precise control of pH value and precipitation conditions to ensure the purity and activity of the toxin. Through the above method, a 900kDa botulinum toxin complex can be obtained. However, this complex also contains some non-toxin components, so further treatment is required. Through the ion exchange method, a part of the lectin protein in the complex can be removed, thereby obtaining a toxin complex with a molecular weight of about 450kDa. This step can effectively reduce the non-toxic components of the complex and improve the purity of the toxin. Finally, by changing the pH value, other non-toxin proteins can be further removed, and finally a botulinum toxin with a molecular weight of 150kDa is obtained. This step is the final stage of toxin extraction and is also the most critical step. By precisely controlling the changes in pH value, the stability and activity of the toxin can be ensured, thereby obtaining a high-quality botulinum toxin product.

[0005] Heterologous expression of botulinum toxin is another important preparation method, and currently the main method is heterologous expression in Escherichia coli. Existing recombinant expression methods are mainly divided into two types: single-chain expression and double-chain expression. The double-chain expression strategy is designed based on a known protein structure (such as Protein Data Bank ID: 3V0C), and there is a clear interaction site between the heavy chain and the light chain. Through co-expression technology, we can obtain the light and heavy chain complex of botulinum toxin. Since the carboxyl terminus of the light chain and the amino terminus of the heavy chain both contain cysteine ​​residues, these two parts can form a disulfide bond and then construct a protein complex with biological activity. On the other hand, there are also methods for recombinantly expressing single-chain botulinum toxin. However, since Escherichia coli itself lacks enzymes that can digest full-length single-chain proteins, it is necessary to artificially introduce exogenous protease cleavage sites between the light chain and the heavy chain. In this way, the protein can be activated by specific enzyme cleavage in vitro. After such an activation process, the resulting protein is comparable to commercial botulinum toxin products in terms of activity.

[0006] The single-chain heterologous expression method has higher efficiency, but there is often the possibility of non-specific enzyme cleavage during the enzyme cleavage process, and the misfolding of E. coli can also lead to the production of inclusion bodies. Therefore, the E. coli expression scheme of botulinum toxin still needs to be further optimized. Summary of the invention

[0007] In view of this, the technical problem to be solved by the present invention is to provide a codon-optimized nucleic acid encoding botulinum toxin and a method for preparing botulinum toxin.

[0008] The nucleic acid encoding botulinum toxin provided by the present invention is any one of the following I) to III):

[0009] 1), a nucleic acid having a sequence as shown in SEQ ID NO: 1;

[0010] II), a nucleic acid encoding botulinum toxin in which one or more bases are substituted, deleted, added and / or replaced in the sequence of the nucleic acid described in I);

[0011] III), a nucleic acid that has at least 80% identity to the nucleic acid sequence described in I) or II) and encodes a botulinum toxin.

[0012] As mentioned above, at least 80% identity means that the identity is not less than 80%, preferably not less than 90%, more preferably not less than 95%, for example, the identity is 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%.

[0013] The nucleic acid provided by the present invention encodes the light chain and heavy chain of botulinum toxin, which are connected by IEGR. IEGR can be cleaved by Factor Xa enzyme, thereby separating the heavy chain and the light chain. In addition, a His tag is added to the N-terminus of the protein to facilitate the purification and separation of the protein. The tag is connected to the protein by IEGR and is removed during the enzyme cleavage process. Therefore, the prepared protein contains only the sequence of botulinum toxin, thereby having more accurate activity. The results show that compared with other nucleic acid sequences, the expression of botulinum toxin using the sequence described in the present invention can obtain a higher expression amount and higher activity. Preferably, the sequence of the nucleic acid encoding botulinum toxin described in the present invention is as shown in SEQ ID NO:1.

[0014] The expression unit provided by the present invention comprises a promoter and the nucleic acid as described above.

[0015] In some embodiments, the expression unit includes, from the 5' end to the 3' end, a T7 promoter, a nucleic acid as shown in SEQ ID NO: 1, and a T7 terminator.

[0016] Furthermore, the expression unit also includes an enhancer, a signal peptide sequence, a tailing signal, a Kozak element, a restriction site and / or an intron. Further, the expression unit also includes a tag, which is a His tag or a Strep-tagII tag.

[0017] The plasmid vector provided by the present invention comprises the nucleic acid as described above, or comprises at least one of the expression units as described above.

[0018] In the embodiment of the present invention, the backbone of the plasmid vector is a pET series plasmid vector. As a feasible case, the pET series plasmid vector is selected from: pET-23c(+), pET-23(+), pET-12b(+), pET-12c(+), pET-12a(+), pET-11b(+), pET-11a(+), pET-11c(+), pET-50b(+), pET-49b(+), pET-48b(+), pET-47b(+), pET-26b(+), pET-32a(+), pET-21b(+), pET-22b(+), pET-14b, pET-16b, pET -15b, pET-19b, pET-20b(+), pET-21d(+), pET-21c(+), pET-21b(+), pET-21a(+), pET-24a(+), pET-24d(+), pET-25b(+), pET-2 7b(+), pET-28a(+), pET-30a(+), pET-42a(+), pET-43.1c(+), pET-43.1b(+), pET-43.1a(+), pET-44a(+), pET-44c(+), pET-46p ET-37b(+), pET303 / CT-His, pET302 / NT-His, pET300 / NT-DEST, pET301 / CT-DEST, pET-5b(+), pET-17b, pET102 / D-TOPO, pET-5a (+), pET-31b(+), pET-3b(+), pET-43.1, pET-41, pET-41a(+), pET-28b(+), pET-42b(+), pET-3a(+), pET-23d(+), pET-41b(+), p pET-44b(+), pET-42c(+), pET-41c(+), pET-45b(+), pET-33b(+), pET-39b(+), pET-32, pET-40b(+), pET-32c(+), pET-32b(+), pET-30, pET-32, pET-30c(+), pET-29c(+), pET-29b(+), pET-30, pET-24c(+), pET-24b(+), pET-24(+), pET-29a(+) or pET-11d(+). Preferably pET28a.

[0019] Furthermore, the present invention also provides a host, wherein the nucleic acid is integrated into its genome, or the expression unit is integrated into its genome, or the plasmid vector is transformed or transfected therewith.

[0020] In the present invention, the host is used for the storage, amplification or expression of the encoding nucleic acid fragment or the fusion protein of the plasmid vector as described above. In the present invention, the host is a eukaryotic host or a prokaryotic host, and the eukaryotic host includes but is not limited to yeast, insect cells, and kidney epithelial cells, and the prokaryotic host includes but is not limited to Escherichia coli. In an embodiment of the present invention, the host is BL21 (DE3), BL21 (DE3) pLysS, DH5α, JM109, JM110, TOP10, HB101, and Xl1-Blue of Escherichia coli. In some specific implementations, the host is Escherichia coli DH5α or Escherichia coli BL21 (DE3).

[0021] The present invention also provides a method for preparing botulinum toxin, which comprises culturing the host as described above to obtain a culture product containing botulinum toxin.

[0022] In some embodiments, the culturing includes the steps of vegetative growth and protein induction, wherein the vegetative growth step uses LB medium, and in the protein induction step, the medium is 2YT medium, the inducer is IPTG, and the final concentration of the inducer is 1 mM IPTG.

[0023] In the present invention, the culture further includes purification and Factor Xa enzymatic hydrolysis steps.

[0024] The purification described in the described embodiments includes Ni column purification.

[0025] The present invention also provides a botulinum toxin prepared by the above-mentioned preparation method.

[0026] The present invention provides a nucleic acid encoding botulinum toxin, which is codon-optimized and verified to be superior to other optimized sequences. It has been verified that the sequence has a high expression level in Escherichia coli and is expressed in a soluble form, and the prepared botulinum toxin has good activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The SDS-PAGE electrophoresis results of the protein obtained by expression in Example 1 after concentration and enzyme digestion;

[0028] Figure 2 The SDS-PAGE electrophoresis results of different batches of proteins expressed by the method described in Comparative Example 1 before and after HRV 3C enzyme digestion;

[0029] Figure 3 The SDS-PAGE electrophoresis results of the protein obtained by expression in Comparative Example 2 after Lys-C digestion (as a control);

[0030] Figure 4The results of SDS-PAGE electrophoresis after a large amount of induced expression of the strain involved in Comparative Example 3;

[0031] Figure 5 The SDS-PAGE electrophoresis results of the strain involved in comparative example 3 after small amount of induced expression;

[0032] Figure 6 The SDS-PAGE electrophoresis results of the purified product after the strain was induced to express in large quantities in Comparative Example 4;

[0033] Figure 7 The results of SDS-PAGE electrophoresis after a small amount of induced expression of the strain involved in Comparative Example 5;

[0034] Figure 8 The SDS-PAGE electrophoresis results of the purified products after strain expression in Comparative Example 5;

[0035] Fig. 9 The SDS-PAGE electrophoresis results of the purified product after expression of the strain (His tag) in Comparative Example 6;

[0036] Fig.10 This is the SDS-PAGE electrophoresis result of the purified product after expression of the strain (Strep Tag II tag) in Comparative Example 6. DETAILED DESCRIPTION

[0037] The present invention provides a nucleic acid encoding a botulinum toxin and a method for preparing a botulinum toxin. A person skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. It should be particularly noted that all similar substitutions and modifications are obvious to a person skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0038] The protein sequence encoded by the optimized sequence in Example 1:

[0039] MGSSHHHHHHGSGGGGSIEGRMPFVNKQFNYKDPVNGVDIAYIKIPNAGQMQPVKAFKIHNKIWVIPERDTFTNPEEGDLNPPPEAKQVPVSYYDSTYLSTDNEKDNYLKGVTKLFERIYSTDLGRMLLTSIVRGIPFWGGSTIDTELKVIDTNCINVIQPDGSYRSEELNLVIIGPSADIIQFECKSFGHEVLNLTRNGYGSTQYIRFSPDFTFGFEESLEVDTNPLLGAGKFATDPAVTLAHELIHAGHRLYGIAINPNRVFKVNTNAYYEMSGLEVSFEELRTFGGHDAKFIDSLQENEFRLYYYNKFKDIASTLNKAKSIVGTTASLQYMKNVFKEKYLLSEDTSGKFSVDKLKFDKLYKMLTEIYTEDNFVKFFKVLNRKTYLNFDKAVFKINIVPKVNYTIYDGFNLRNTNLAANFNGQNTEINNMNFTKLKNFTGLFEFYKLLCVRGIITSKTKSLDKGYNKIEGRALNDLCIKVNNWDLFFSPSEDNFTNDLNKGEEITSDTNIEAAEENISLDLIQQYYLTFNFDNEPENISIENLSSDIIGQLELMPNIERFPNGKKYELDKYTMFHYLRAQEFEHGKSRIALTNSVNEALLNPSRVYTFFSSDYVKKVNKATEAAMFLGWVEQLVYDFTDETSEVSTTDKIADITIIIPYIGPALNIGNMLYKDDFVGALIFSGAVILLEFIPEIAIPVLGTFALVSYIANKVLTVQTIDNALSKRNEKWDEVYKYIVTNWLAKVNTQIDLIRKKMKEALENQAEATKAIINYQYNQYTEEEKNNINFNIDDLSSKLNESINKAMININKFLNQCSVSYLMNSMIPYGVKRLEDFDASLKDALLKYIYDNRGTLIGQVDRLKDKVNNTLSTDIPFQLSKYVDNQRLLSTFTEYIKNIINTSILNLRYESNHLIDLSRYASKINIGSKVNFDPIDKNQIQLFNLESSKIEVILKNAIVYNSMYENFSTSFWIRIPKYFNSISLNNEYTIINCMENNSGWKVSLNYGEIIWTLQDTQEIKQRVVFKYSQMINISDYINRWIFVTITNNRLNNSKIYINGRLIDQKPISNLGNIHASNNIMFKLDGCRDTHRYIWIKYFNLFDKELNEKEIKDLYDNQSNSGILKDFWGDYLQYDKPYYMLNLYDPNKYVDVNNVGIRGYMYLKGPRGSVMTTNIYLNSSLYRGTKFIIKKYASGNKDNIVRNNDRVYINVVVKNKEYRLATNASQAGVEKILSALEIPDVGNLSQVVVMKSKNDQGITNKCKMNLQDNNGNDIGFIGFHQFNNIAKLVASNWYNRQIERSSRTLGCSWEFIPVDDGWGERPL*(SEQ ID NO:2)

[0040] Optimized nucleic acid sequence in Example 1:

[0041]

[0042] The optimized sequence in Comparative Example 3 or 4:

[0043]

[0044] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0045] Table 1

[0046]

[0047]

[0048] The present invention will be further described below in conjunction with embodiments:

[0049] Example 1 Preparation of botulinum toxin full chain recombinant protein

[0050] After codon optimization of the whole chain of botulinum toxin (referred to as LCTD, SEQ ID NO: 1), pET28a was used as a vector, His tag and IEGR site were added, and BL21 (DE3) was used as a vector for expression. As a result, a large amount of induced protein was obtained. The process is as follows:

[0051] 1. Codon Optimization

[0052] A site for Factor Xa enzyme: IEGR is inserted between the light chain and the heavy chain in the full-chain amino acid sequence of botulinum toxin, and a His tag and IEGR site are inserted at the N-terminus.

[0053] 2. Obtaining the recombinant protein expression vector

[0054] (1) The PCR method was used to amplify the gene fragment of the whole chain of botulinum toxin, using the DNA sequence of LC-HC as a template. The primer sequence information is shown in the following table:

[0055] Table 2

[0056] Forward primer GTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATC Reverse primer TGTCGACGGAGCTCGAATTACAGCGGGCGTTCACCCCAGC

[0057] PCR reaction conditions included heat denaturation at 95°C for 5 min, 30 cycles of reaction at 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min, and a final amplification at 72°C for 8 min;

[0058] (2) The gene fragment of the vector was amplified by PCR, with the DNA sequence of pET28a as the template. The primer sequence information is shown in the following table:

[0059] Table 3

[0060] Forward primer TAATTCGAGCTCCGTCGACAAG Reverse primer CCCATGGTATATCTCCTTCTTAAAGTTAAAC

[0061] PCR reaction conditions included heat denaturation at 95°C for 5 min, 30 cycles of reaction at 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min, and a final amplification at 72°C for 8 min;

[0062] (3) After the reaction, electrophoresis was performed using 1% agarose gel to confirm the amplified product, and then the amplified recombinant fragment was collected from the agarose gel and extracted and purified using a gel extraction kit. The PCR product was treated with a homologous recombinase at 37° C. for 1 hour;

[0063] (4) The expression plasmid was transformed into DH5α competent cells, and positive clones were screened with kanamycin for sequencing to obtain the recombinant protein expression vector;

[0064] (5) The recombinant plasmid identified as correct by sequencing was extracted and transformed into competent Escherichia coli BL21 (DE3) cells and stored in glycerol culture medium.

[0065] 2. Glycerol Culture to Obtain Crude Recombinant Protein

[0066] (1) Striking a line of glycerol bacteria on LB solid medium and culturing at 37° C. overnight. The LB solid medium includes kanamycin at a final concentration of 50 μg / mL;

[0067] (2) Randomly pick three single clones and place them in 3 mL of LB liquid medium, add kanamycin solution with a final concentration of 50 μg / mL, shake the culture at 220 rpm at 37°C, and culture overnight to obtain bacterial culture solution;

[0068] (3) Transfer the overnight cultured bacterial solution into 10 mL LB liquid medium at a ratio of 1:50 and culture in a shaking incubator at 37°C until the bacterial solution OD 600 When the value was 0.6-0.8, add 1 mM IPTG at a final concentration, shake the bacteria at 200 rpm at 20°C, induce for 24 hours, collect the bacteria, lyse the bacteria with a cell disruptor, and verify by SDS-PAGE gel running;

[0069] (4) Inoculate the bacterial solution with high protein expression level into 2YT liquid culture medium at a ratio of 1:50, add kanamycin solution with a final concentration of 50 μg / mL; shake the culture at 220 rpm at 37°C, and the OD 600 When the value was 0.6-0.8, IPTG was added at a final concentration of 1 mM, and the induction was carried out at 20°C and 200 rpm overnight;

[0070] (5) Collect the bacterial solution induced overnight, centrifuge at 10,000 rpm for 10 min, collect the bacteria, resuspend the cells with PBS and lyse the cells by ultrasonic treatment. Select rod 2, power 30%, ultrasonic for 5 s, interval 5 s, and a total of 30 min of ultrasonic treatment. The whole process is carried out on ice. When the bacteria are completely resuspended and no cells sink to the bottom of the tube, centrifuge at 4°C and 10,000 rpm for 30 min, collect the supernatant, remove bacterial fragments and obtain recombinant protein.

[0071] 3. Recombinant protein purification

[0072] The resin used for the first time needs to be washed with 5 mL of equilibration binding buffer. If the resin is reused, the 20% ethanol needs to be drained out, and then it needs to be washed with 10 mL of ddH2O and then washed with 10 mL of equilibration binding buffer before it can be used.

[0073] (1) Sample loading: Add the crude recombinant protein to the equilibrated Ni column and allow it to bind for 2 h at room temperature. Open the outlet at the bottom of the column and collect the flow-through. Repeated sample loading can be performed to improve column binding efficiency.

[0074] (2) Equilibrate the Ni column after loading: Equilibrate the Ni column again with 10 column volumes of Binding Buffer (pH 8.0) to remove unbound proteins;

[0075] (3) The Ni column was eluted with a gradient mixture of Elution Buffer / Binding Buffer (pH 8.0). First, 20 mM imidazole and 50 mM imidazole were added to Binding Buffer for gradient elution to remove impurities and the elution solution was collected. Then, the target protein was eluted from the column with Elution Buffer. The eluate was collected after each elution and detected by SDS-PAGE to determine the target protein and obtain the purified recombinant protein.

[0076] 4. Recombinant protease cleavage

[0077] After protein concentration using ultrafiltration tube at 4°C, 8000 rpm, 20 min (e.g. Figure 1 The enzyme digestion was performed at room temperature using Factor Xa enzyme at a volume ratio of 1:20. The results of the digestion for 24 hours are shown in FIG. Figure 1 As shown in lane 2. The results showed that the fragments after enzyme cleavage showed 50kDa and 100kDa proteins, and 150kDa was absent, which was consistent with the molecular weight of botulinum toxin and had sufficient concentration.

[0078] Comparative Example 1

[0079] The experimental steps are different from those in Example 1 only in that, in Example 1, the Factor Xa enzyme IEGR in the amino acid sequence is replaced with the HRV 3C enzyme LEVLFQ↓GP. After concentration, the enzyme is digested with the HRV 3C enzyme. The results of the 24-hour digestion are shown in FIG. Figure 2 As shown. Among them, Figure 2 Lane 2 and Lane 1 are the results of concentrated sample 1 before and after digestion, respectively; Lane 4 and Lane 3 are the results of concentrated sample 2 before and after digestion, respectively; Lane 6 and Lane 5 are the results of concentrated sample 3 before and after digestion, respectively; Lane 8 and Lane 7 are the results of concentrated sample 4 before and after digestion, respectively.

[0080] The results after enzymatic digestion with HRV 3C enzyme showed that a large number of 150kDa bands were retained after enzymatic digestion with HRV 3C enzyme, indicating that the enzymatic digestion efficiency of the substrate using HRV 3C enzyme was low, and the enzymatic digestion and activation of the substrate could not be completed efficiently to obtain botulinum toxin with high purity. In addition to the 100kDa and 50kDa bands, there were also mixed bands between 40kDa and 50kDa.

[0081] Comparative Example 2

[0082] The experimental steps are different from those in Example 1 only in that, in Comparative Example 2, LysC enzyme was used for enzyme digestion after concentration. The results of enzyme digestion for 3 days are as follows: Figure 3 As shown. Among them, Figure 3 Lane 2 in the middle is the result of the concentrated sample without enzyme digestion, and lane 1 is the result of the concentrated sample after enzyme digestion.

[0083] The results of enzymatic digestion with Lys-C showed that there were no bands of target sizes (100 kDa and 50 kDa) after enzymatic digestion with Lys-C, indicating that Lys-C digestion is non-specific and the heavy and light chains of botulinum toxin protein cannot be completely obtained after digestion.

[0084] Comparative Example 3

[0085] The experimental steps were the same as those in Example 1. First, the codon of the whole chain of botulinum toxin was optimized (denoted as LCTDRBD, SEQ ID NO: 3), and a His tag was added. pET28a was used as a vector and BL21 was used as a host for expression. As a result, no protein band was found at the target position regardless of whether a large amount of induced expression and purification or a small amount of induced expression was performed ( Figure 4 and Figure 5 ).

[0086] Comparative Example 4

[0087] The experimental steps were the same as in Example 1. After the codon optimization of the whole chain of botulinum toxin (SEQ ID NO: 3), pET28a was used as a vector, Strep tag II was added, and BL21 was used as a host for expression. No 100 kDa and 50 kDa protein bands were found at the target position (see Figure 6 ).

[0088] Comparative Example 5

[0089] The experimental steps were the same as those in Example 1. After the codons of the whole chain of botulinum toxin were optimized (SEQ ID NO: 1), pET28a was used as a vector, Strep tag II was added, and Escherichia coli BLR was used as a host for expression. As a result, no target size band was found at 150 kDa, but obvious thick bands were found at 120-150 kDa. After purification, no 150 kDa band was found in all eluates, indicating that the previous 120-150 kDa band may be a foreign protein, not the target protein band ( Figure 7 and Figure 8 ).

[0090] Comparative Example 6

[0091] The experimental steps were the same as in Example 1. The codons of the whole chain of botulinum toxin were optimized (SEQ ID NO: 1), pET28a was used as a vector, a His tag was added, and lactic acid bacteria NZ9000 was used as a host for expression. As a result, no 150 kDa protein band was found at the target position (see Fig. 9 and Fig.10 ). Animal Experiments:

[0092] 40 female Kunming mice (SPF grade) aged 26-30 days were prepared, with a weight of 20±2g, and randomly divided into 4 groups, with 10 mice in each group. The first group used the botulinum toxin of Example 1 at a dose of 256ng / mouse and intraperitoneally injected 0.5mL; the second group used the botulinum toxin of Example 1 at a dose of 128ng / mouse and intraperitoneally injected 0.5mL; the third group was used as the control group, and a mixture of sterile saline and Factor Xa enzyme was injected, wherein the concentration of Factor Xa enzyme was 0.01mg / mL, and each mouse was intraperitoneally injected with 0.5mL; the fourth group was used as a blank group, and no reagent was injected. After injection, the mice were observed for 4 consecutive days and the death results of the mice were recorded. The results are shown in Table 1.

[0093] Table 1. Number of mice killed in animal experiments

[0094] Number of deaths / Number of undead animals Group 1 10 0 Group 2 7 3 Group 3 0 10 Group 4 0 10

[0095] It can be seen from the results in Table 1 that when the injection dose of botulinum toxin in Example 1 of the present application is 128 ng / mouse, the mortality rate of mice is 70%, and when the injection dose of botulinum toxin is 256 ng / mouse, the mortality rate of mice is 100%, indicating that the botulinum toxin prepared in the present application has in vivo toxicity (activity).

[0096] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid encoding a botulinum toxin, characterized in that It is any one of the following I) to III): 1), a nucleic acid having a sequence as shown in SEQ ID NO: 1; II), a nucleic acid encoding botulinum toxin in which one or more bases are substituted, deleted, added and / or replaced in the sequence of the nucleic acid described in I); III), a nucleic acid that has at least 80% identity to the nucleic acid sequence described in I) or II) and encodes a botulinum toxin.

2. An expression unit, characterized in that It comprises a promoter and the nucleic acid according to claim 1.

3. The expression unit according to claim 2, characterized in that The 5' end to the 3' end sequentially include: a T7 promoter, a nucleic acid shown in SEQ ID NO: 1, and a T7 terminator.

4. A plasmid vector, characterized in that Comprising the nucleic acid of claim 1, or comprising the expression unit of claim 2 or 3.

5. The plasmid vector according to claim 4, characterized in that Its skeleton is a pET series plasmid vector.

6. A host, characterized in that The nucleic acid according to claim 1 is integrated into its genome, or the expression unit according to any one of claims 2 to 3 is integrated into its genome, or the plasmid vector according to claim 4 or 5 is transformed or transfected.

7. The host according to claim 6, characterized in that It is Escherichia coli.

8. A method for preparing botulinum toxin, comprising culturing the host according to claim 6 or 7 to obtain a culture product containing botulinum toxin.

9. The preparation method according to claim 8, characterized in that: The method further comprises the steps of purification and Factor Xa enzymatic hydrolysis after the culture.

10. The botulinum toxin prepared by the preparation method according to claim 8 or 9.

Images