Target spot for treating pancreatic cancer and application thereof

Abstract

The invention relates to the field of oncology and diagnosis, in particular to a target spot for treating pancreatic cancer and application of the target spot. Experiments discover that the 176-site lysine lactylation modification (HNRNPC K176la) level of the HNRNPC protein is remarkably increased in pancreatic cancer, existence of site modification is confirmed through a pan-lactylation modification antibody for the first time, and meanwhile, the K176 site is confirmed to be a key site for carrying out lactylation modification on the HNRNPC in the pancreatic cancer. Furthermore, in-vivo and in-vitro functional experiments prove that HNRNPC K176 lactic acid modification can inhibit proliferation of pancreatic cancer cells and increase of tumor volume.

Description

Technical Field

[0001] The present invention relates to the field of oncology and diagnosis, and more particularly to a target for pancreatic cancer treatment and application thereof. Background Art

[0002] Pancreatic cancer is a highly malignant tumor in the digestive system. Its 5-year survival rate is extremely low, usually in the single digit, much lower than other common digestive system tumors such as gastric cancer and colorectal cancer. And its mortality rate is almost the same as its incidence rate. Because of its hidden onset, most patients are already in the late stage when diagnosed and lose the chance of surgical cure. However, traditional surgery, chemotherapy and radiotherapy have many limitations in the treatment of pancreatic cancer. The surgical resection rate is low because pancreatic cancer is prone to local infiltration and distant metastasis in the early stage; chemotherapy drugs are less sensitive to pancreatic cancer and are very easy to develop drug resistance; radiotherapy has not achieved ideal results in controlling tumor progression. At present, there is a lack of highly specific and sensitive molecular markers for early diagnosis of pancreatic cancer in clinical practice. The accuracy of existing markers such as CA199 still needs to be improved, and they are easily affected by many factors. For example, disease states such as jaundice will interfere with the accuracy of their values, resulting in difficulties in early detection of pancreatic cancer. With the advent of the era of targeted therapy, identifying effective therapeutic targets is the key to improving the treatment effect of pancreatic cancer. By conducting in-depth research on the molecular mechanisms of pancreatic cancer occurrence and development and identifying potential diagnostic and therapeutic targets, more targeted drugs can be developed to improve treatment outcomes while reducing damage to normal tissues.

[0003] Protein post-translational modification refers to the covalent connection between molecular groups and amino acid side chains in proteins, which can regulate changes in protein conformation, activity and physicochemical properties, thereby regulating key cellular processes such as cell cycle, transcription, metabolism, immunity and autophagy, and ultimately affecting cell survival, proliferation, migration, differentiation and apoptosis. At present, the research on protein post-translational modification is developing rapidly, with more studies on phosphorylation, acetylation, methylation and ubiquitination. New acylation modifications, such as succinylation, hydroxyisobutyrylation, nitrosylation, lactylation, etc., have also been identified in recent years. Previously, lactic acid was considered a simple cellular energy substance until 2019, when Professor Zhao Yingming's research group at the University of Chicago reported in Nature that a new type of protein post-translational modification mediated by lactic acid, lactylation, was discovered. This discovery breaks the traditional understanding of lactic acid and makes people realize that lactic acid is not only a metabolite, but can also be used as a modification substrate to modify proteins, thereby playing an important regulatory role in biological functions. Lactic acid modification makes proteins diverse and complex, and thus the mechanism of cell biological processes and disease occurrence and development can be further revealed by exploring protein lactic acid modification.

[0004] The research team of the present invention found that the lactic acid modification level of lysine 176 of heterogeneous ribonucleoprotein C (HNRNPC) was significantly upregulated in pancreatic cancer tissues through the analysis of pancreatic cancer lactic acid modification. HNRNPC, as one of the core members of the HNRNP family, is an RNA binding protein that regulates pre-mRNA alternative splicing by inhibiting specific 3 splicing sites of mRNA precursors and participates in biological processes such as pre-mRNA processing, metabolism, and transportation. Studying the biological function and mechanism of lysine 176 lactic acid modification of HNRNPC in pancreatic cancer is expected to provide new targets for the diagnosis and treatment of pancreatic tumors. Summary of the invention

[0005] In order to make up for the deficiencies of the prior art, the present invention provides a target for pancreatic cancer treatment and application thereof.

[0006] The present invention is achieved through the following technical solutions:

[0007] In the first aspect, the present invention provides a target for the treatment of pancreatic cancer, wherein the target is the lactic acid modified lysine 176 of the HNRNPC protein, HNRNPC K176la, and the sequence of HNRNPC K176la is: SGFNSK(la)SGQR. In addition, the K176 site is a key site for lactic acid modification of HNRNPC in pancreatic cancer.

[0008] In a second aspect, the present invention provides the use of lactic acid modification of HNRNPC K176 in the preparation of a product for inhibiting the proliferation of pancreatic cancer cells and the growth of tumor volume.

[0009] Compared with the prior art, the present invention has the following advantages:

[0010] The present invention discloses a target for pancreatic cancer treatment. Through experiments, it is found that the level of lactic acid modification of lysine 176 (HNRNPC K176la) of HNRNPC protein is significantly increased in pancreatic cancer, and the existence of this site modification is confirmed for the first time by pan-lactation modification antibody, and the K176 site is confirmed to be the key site for lactic acid modification of HNRNPC in pancreatic cancer. Further in vivo and in vitro functional experiments confirm that HNRNPC K176 lactic acid modification can inhibit the proliferation of pancreatic cancer cells and the growth of tumor volume. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The present invention will be further described below in conjunction with the accompanying drawings.

[0012] Figure 1Analysis of HNRNPC lactic acid modification for 10 pancreatic cancer lactic acid modification databases. (A) Analysis of HNRNPC lactic acid modification sites based on pancreatic cancer lactic acid modification databases; (B) Volcano plot showing the changes in lactic acid modification levels at each site of HNRNPC in pancreatic cancer.

[0013] Figure 2 Verification of HNRNPC 176 lysine lactylation modification (HNRNPC K176la) in pancreatic cancer cells Hs 766T. (A) Pancreatic cancer cells were treated with 10 mM lactic acid for 24 hours, and the changes in the lactylation modification level of HNRNPC protein in Hs 766T cells were detected; (B) In Hs 766T cells, endogenous HNRNPC was enriched by immunoprecipitation, stained with Coomassie Brilliant Blue, and the target band was cut for mass spectrometry analysis; (C) Representative secondary mass spectrometry of HNRNPC K176 lactylation modification; (D) Western blot verification of the knockdown efficiency of HNRNPC in Hs 766T cell line; (E and F) Wild-type HNRNPC or its mutant K176R was complemented in the HNRNPC knockdown cell line, and the lactylation levels of HNRNPC and its K176 were detected by Western blot experiments; (G) The HNRNPC K176 lactylation modification-deficient cell line constructed above was treated with 10 mM lactic acid for 24 hours, and HNRNPC was enriched by immunoprecipitation experiment, and its lactylation modification level was detected using a pan-lactylation modification antibody.

[0014] Figure 3 The effect of HNRNPC K176 lactylation deletion on pancreatic tumor growth. (A and B) The effect of HNRNPC K176 lactylation deletion on the proliferation ability of pancreatic cancer cell Hs766T was detected by CCK8 and clone formation assays, respectively; (C and D) The effect of HNRNPC K176 lactylation deletion on the migration ability of pancreatic cancer cell Hs766T was detected by Transwell and scratch assays, respectively; (E) Nude mice were subcutaneously injected with HNRNPC K176 lactylation deletion and corresponding control cell lines, and the tumor volume was measured during the growth process. After about one month, the tumor was removed, photographed and the tumor weight was measured. DETAILED DESCRIPTION

[0015] The present invention will be further described below in conjunction with the accompanying drawings.

[0016] Example 1

[0017] Analysis of HNRNPC lactic acid modification using the pancreatic cancer lactic acid modification database (the pancreatic cancer lactic acid modification database was commissioned by Hangzhou Jingjie Biotechnology Co., Ltd. to build)

[0018] Protein extraction: 10 pairs of pancreatic cancer tissues and corresponding adjacent tissue samples were taken out from a -80°C refrigerator, and appropriate amounts of samples were weighed into a mortar pre-cooled with liquid nitrogen, and the samples were fully ground into powder with liquid nitrogen. Four times the volume of lysis buffer (1% sodium dodecyl sulfate (SDS), 1% protease inhibitor, 3 μM trichostatin A (TSA), 50 mM nicotinamide (NAM)) was added to each group of samples, and ultrasonic lysis was performed. Centrifuge at 4°C, 12000g for 10 min, transfer the supernatant to a new centrifuge tube, and use the BCA kit to determine the protein concentration.

[0019] Trypsin hydrolysis: Take an equal amount of each sample protein for enzymatic hydrolysis, and adjust the volume to the same with lysis buffer. Add 1 volume of pre-cooled acetone, vortex to mix, and then add 4 volumes of pre-cooled acetone, precipitate at -20℃ for 2h. Centrifuge at 4500g for 5min, discard the supernatant, and wash the precipitate twice with pre-cooled acetone. After drying the precipitate, add TEAB with a final concentration of 200mM, ultrasonically break up the precipitate, add trypsin at a ratio of 1:50 (protease: protein, m / m), and hydrolyze overnight. Add dithiothreitol (DTT) to a final concentration of 5mM, and reduce at 56℃ for 30min. Then add iodoacetamide (IAA) to a final concentration of 11mM, and incubate at room temperature in the dark for 15min.

[0020] Modification enrichment: The peptides were dissolved in IP buffer solution (100mM NaCl, 1mM EDTA, 50mM Tris-HCl, 0.5% nonylphenol polyoxyethylene ether (NP-40) pH 8.0), and the supernatant was transferred to the pre-washed lactic acid resin (antibody resin product number (PTM-1404), from Hangzhou Jingjie Biotechnology Co., Ltd., PTM Bio), placed on a rotary shaker at 4°C, gently shaken and incubated overnight. After the incubation, the resin was washed 4 times with IP buffer solution and twice with deionized water. Finally, the resin-bound peptides were eluted with 0.1% trifluoroacetic acid eluent, and the eluent was collected and vacuum-freeze-dried. After drying, desalting was carried out according to the C18 ZipTips instructions, and vacuum-freeze-dried for LC-MS analysis.

[0021] Liquid chromatography-mass spectrometry analysis: The peptides were dissolved in liquid chromatography mobile phase A and separated using the NanoElute ultra-high performance liquid phase system. Mobile phase A was an aqueous solution containing 0.1% formic acid and 2% acetonitrile; mobile phase B was a solution containing 0.1% formic acid and 100% acetonitrile. Liquid phase gradient settings: 0-42min, 7% to 24% B; 42-54min, 24% to 32% B; 54-57min, 32% to 80% B; 57-60min, 80% B, and the flow rate was maintained at 450nL / min. After the peptides were separated by the ultra-high performance liquid phase system, they were injected into the Capillary ion source for ionization and then analyzed by the timsTOF Pro mass spectrometer. The ion source voltage was set to 1.6kV, and the peptide parent ions and their secondary fragments were detected and analyzed using high-resolution TOF. The secondary mass spectrometry scan range was set to 100-1700. The data acquisition mode used was parallel accumulation serial fragmentation (PASEF) mode. After one primary mass spectrum was acquired, 10 secondary spectra with parent ion charge numbers in the range of 0-5 were acquired in PASEF mode. The dynamic exclusion time of the tandem mass spectrometry scan was set to 30 seconds to avoid repeated scanning of parent ions.

[0022] Mass spectrometry data search: The acquired MS and MS / MS data were searched against the human SwissProt database (20422 entries) using the MaxQuant search engine (version 1.6.15.0). Search parameters were set to include the proteolytic enzyme trypsin and to allow up to two missed cleavage sites. The precursor ion tolerance was set to 20 ppm, the main search peptide tolerance to 5 ppm, and the mass tolerance for fragment ions to 0.02 Da. Carbamidomethylation on Cys was specified as a fixed modification, and acetylation at the N-terminus of the protein and oxidation on Met were specified as variable modifications. For the analysis of lysine lactylation (Kla) peptide enrichment data, the variable modification settings included lysine lactylation. The false discovery rate (FDR) for peptide spectrum matching, site and protein identification was set to <1%.

[0023] Lactate modification omics analysis: Kla peptide levels were calculated based on the raw spectral intensity. A database containing all lactate modified peptides was constructed and normalized according to their protein abundance to exclude changes in Kla peptide levels caused by protein level dynamics, and the differences between pancreatic cancer and adjacent paracancerous tissues were compared and analyzed. Figure 1 As shown in (A and B), it can be seen from the figure that the present invention found that K176 is the site with the highest abundance of lactic acid modification in HNRNPC, and the lactic acid modification level of HNRNPC K176 is significantly increased in pancreatic cancer.

[0024] Example 2

[0025] Verification of HNRNPC 176-lysine lactylation modification (HNRNPC K176la) in pancreatic cancer cells Hs766T

[0026] Immunoprecipitation experiment to enrich HNRNPC in pancreatic cancer cells Hs 766T: Hs 766T cells were lysed using RIPA strong lysis buffer (Biyuntian, P0013B), total protein was extracted, HNRNPC (Santa, sc-32308) or IgG negative control antibody (Biyuntian, A0216) were added thereto, and incubated overnight at 4°C. On the next day, magnetic beads (MCE, HY-K0202) were added thereto, and gently washed with PBS (pH 7.4) buffer, and proteins were separated by SDS-PAGE (polyacrylamide gel electrophoresis). After the electrophoresis was completed, the gel was stained with Coomassie Brilliant Blue Rapid Stain for 20-30 minutes, decolorized and photographed.

[0027] Mass spectrometry analysis of lactic acid modification of HNRNPC protein in Hs 766T cells: Use a surgical blade to cut off the target band HNRNPC, chop the gel strip, and decolorize the gel block with 50% acetonitrile containing 50mM ammonium bicarbonate (NH4HCO3). Use a dithiothreitol solution with a final concentration of 10mM and incubate at 37°C for 60min. After removing the liquid phase, add iodoacetamide with a final concentration of 55mM and incubate at room temperature in the dark for 45min. Finally, resuspend the gel block with 50mM ammonium bicarbonate containing 10ng / μL trypsin. The enzymatic peptides are extracted from the gel block using 50% acetonitrile / 5% formic acid and 100% acetonitrile in turn, and the peptide solution is freeze-dried and used for standby. The secondary mass spectrometry data are retrieved using Proteome Discoverer 2.4. The search parameters were set as follows: the database was set to the target protein sequence; the restriction method was set to Trypsin / P; the variable modifications were set to methionine oxidation, protein N-terminal acetylation, lysine acetylation, crotonylation, succinylation, ubiquitination, and trihydroxybutyrylation; the peptide ion score was required to be higher than 20, and the identification result peptide confidence was set to High. Figure 2 As shown in (AC), it can be seen from the figure that there is lactylation modification at K176 of HNRNPC in the pancreatic cancer cell line Hs766T, and K176 is the key site for lactylation modification of HNRNPC.

[0028] Construction of HNRNPC knockdown lentiviral plasmid: First, the following two shRNA sequences were designed according to the amino acid sequence of HNRNPC protein, shRNA-4: 5'-GCCTTCGTTCAGTATGTTAAT-3'; shRNA-5: 5'-GCGCTTGTCTAAGATCAAATT-3', the above sequences were annealed and connected to the pLent-U6-RFP vector to construct HNRNPC knockdown plasmids respectively.

[0029] Construction of HNRNPC knockdown pancreatic cancer cell line: HEK293T cells were plated in a 10 cm culture dish, and when the cell confluence reached 70-80%, the target plasmids (pLent-U6-shRNA-4 and pLent-U6-shRNA-5): PSPAX2:PMD2G=12μg:9μg:3μg were dissolved in 1.5 ml opti-mem culture medium; another 72μl PEI reagent was dissolved in 1.5 ml opti-mem culture medium. After standing for 5 minutes, the two were mixed and allowed to stand for 15 minutes, and then added to HEK293T cells. After 48 hours, the viral supernatant was collected, filtered through a 0.22μm filter, and the viral solution was added to Hs 766T cells. Fresh culture medium was replaced after 12-16 hours. After culturing for 48 hours, blasticidin (Biyuntian, ST018) was added to screen stable expression cell lines, and the expression level of HNRNPC protein was detected by Western blot. The results are shown in Figure 2 As shown in (D), it can be seen from the figure that the present invention successfully constructed the HNRNPC knockdown Hs766T cell line.

[0030] Construct the lentiviral overexpression plasmid of wild-type HNRNPC and its K176 site mutation fused with hemagglutinin (HA): forward and reverse amplification primers were designed according to the CDS sequence of HNRNPC (forward primer: ATGGCCAGCAACGTTACCAACAAGA; reverse primer: AGAGTCATCCTCGCCATTGGCG). At the same time, restriction sites BamHI and XhoI were selected and added to the 5' end of the upstream and downstream primers. The HNRNPC expression sequence was obtained by PCR amplification and connected to the pLVX vector to obtain the lentiviral plasmid pLVX-HNRNPC-HA expressing HNRNPC. In addition, point mutation primers (F, 5'-CGCTGTCCACTCCTAGAATTGAAGCCACTTTTGCC'; and R, 5'-GGCAAAAGTGGCTTCAATTCTAGGAGTGGACAGCG') were designed to mutate lysine 176 of HNRNPC to arginine, and construct the plasmid pLVX-HNRNPC K176R-HA lacking the lactylation modification of HNRNPC K176.

[0031] Construction of HNRNPC K176 lactylation modification deletion cell line: HEK293T cells were plated in a 10 cm culture dish, and when the cell confluence reached 70-80%, the target plasmid (pLVX-HNRNPC-HA and pLVX-HNRNPC K176R-HA): PSPAX2: PMD2G = 12μg: 9μg: 3μg were dissolved in 1.5ml opti-mem medium; another 72μl PEI reagent was dissolved in 1.5ml opti-mem medium. After standing for 5 minutes, the two were mixed and stood for 15 minutes, and then added to HEK293T cells. After 48 hours, the virus supernatant was collected and filtered through a 0.22 μm filter. The virus solution was added to the HNRNPC knockdown Hs 766T cells constructed above. After 12-16 hours, fresh culture medium was replaced. After 48 hours of culture, puromycin (Solebol, P8230) was added to select stable expression cell lines. The expression of HNRNPC protein and its K176 site lactylation modification level were detected by immunoprecipitation and Western blot experiments. The results are shown in Figure 2 As shown in (E and F), it can be seen from the figures that the present invention successfully constructed the Hs766T cell line with HNRNPC knockdown and K176 lactylation modification deletion.

[0032] K176 was confirmed to be the key site for lactic acid modification of HNRNPC: HNRNPC K176 lactic acid-deficient and control cells were treated with 10mM lactic acid for 24 hours, the cell lines were lysed with RIPA strong lysis buffer, total protein was extracted, HA antibody (Jingjie Bio, PTM-5177) was used to incubate overnight, Protein A / G magnetic beads were added, incubated for 4 hours, gently washed with PBS buffer, and the changes in the lactic acid modification level of HNRNPC were detected by Western blot experiment. The results are shown in Figure 2 As shown in (G), it can be seen from the figure that lactic acid cannot induce the upregulation of lactylation modification levels in cells with HNRNPC K176 mutation, which means that K176 is the key site for lactylation modification of HNRNPC.

[0033] Example 3

[0034] Effect of loss of HNRNPC K176 lactylation modification on pancreatic cancer tumor growth

[0035] CCK8 and clone formation experiments were used to detect the effect of HNRNPC K176 lactylation modification deficiency on the proliferation of pancreatic cancer cells: HNRNPC K176 lactylation modification deficiency and its control cells were treated with 10mM lactic acid for 24 hours, digested and passaged the cells in the logarithmic growth phase, counted the cells, added to 96-well plates, and placed in a 37°C incubator for normal culture. The following experimental operations were performed at 0 hours, 24 hours, 48 ​​hours and 96 hours: the culture medium was aspirated, washed 3 times with PBS, and the culture medium containing 10% CCK8 was added. The cells were placed in an incubator for 4 hours, and the OD450 value was detected using an enzyme reader and statistically analyzed; at the same time, the above-mentioned lactic acid-treated cell lines were counted and inoculated into 6-well plates, and the 6-well plates were placed in a 37°C incubator for normal culture for 1-2 weeks. When the clones grew to an appropriate size, the culture medium was aspirated, washed 3 times with PBS, fixed at room temperature for 30 minutes, and stained with diluted crystal violet solution for 30 minutes, rinsed with double distilled water, and dried naturally, and the number of clones was statistically analyzed. The results are as follows Figure 3 As shown in (A and B), it can be seen from the figure that HNRNPCK176 lactylation modification can inhibit the proliferation of pancreatic cancer cells.

[0036] Transwell and scratch experiments were used to detect the effect of HNRNPC K176 lactylation deletion on pancreatic cancer cell migration: HNRNPC K176 lactylation deletion and control cells were treated with 10mM lactic acid for 24 hours, and cells in the logarithmic growth phase were digested and passaged. The cells were counted, resuspended with serum-free medium and added to the upper chamber of the transwell, and complete medium was added to the lower chamber. The cells were placed in a 37°C incubator and cultured normally for 20-24 hours. After the cells passed through the transwell hole and stretched out, the medium was aspirated and discarded, washed 3 times with PBS, fixed at room temperature for 30 minutes, and stained with diluted crystal violet solution for 30 minutes. Rinse with double distilled water, let it dry naturally, and take pictures to count the number of cells passing through the aperture for statistical analysis; at the same time, the above-mentioned lactic acid-treated cell lines were inoculated in 6-well plates. When the cells were full, a 200ul gun tip was used to scratch the well plate along a straight line, washed 3 times with PBS, and cultured with medium. Pictures were taken after 0 hours, 24 hours, and 48 hours, and the cell migration area was statistically analyzed. The results are as follows Figure 3 As shown in (C and D), it can be seen from the figure that HNRNPC K176 lactylation modification can inhibit the migration of pancreatic cancer cells.

[0037] Nude mouse tumorigenesis assay to detect the effect of HNRNPC K176 lactylation deletion on pancreatic cancer cell growth: HNRNPC K176 lactylation deletion and control cells were treated with 10 mM lactic acid for 24 hours, and cells in the logarithmic growth phase were digested and passaged. The cells were counted and resuspended in PBS buffer. The cell density was adjusted to 5×10 7 / mL, and then 0.1mL of cell suspension was injected subcutaneously into the armpit of nude mice. The tumor volume was measured every 4 days after the tumor grew. After about a month, the tumor was removed and the weight and volume of the tumor were measured. Figure 3 As shown in (E), it can be seen from the figure that HNRNPC K176 lactylation modification can inhibit the growth of pancreatic cancer tumors in vivo.

Claims

1. A target for pancreatic cancer treatment, characterized in that: The target is the lactic acid modified lysine 176 of the HNRNPC protein, HNRNPC K176la, and the sequence of HNRNPC K176la is: SGFNSK(la)SGQR; in addition, the K176 site is a key site for lactic acid modification of HNRNPC in pancreatic cancer.

2. Application of HNRNPC K176 lactylation modification in the preparation of products that inhibit the proliferation of pancreatic cancer cells and tumor volume growth.

Images