Application of cucumber CsNPF1 gene in regulating parthenocarpy and bitter taste of fruits

Abstract

The invention provides application of a cucumber CsNPF1 gene in regulation and control of parthenocarpy and bitter taste of fruits, research finds that the content of auxin in cucumber fruits with CsNPF1 gene knockout mutants is obviously lower than that of auxin in wild type cucumber fruits, and further proves that CsNPF1 is directly combined with a CsYUC4 promoter sequence and activates expression of the CsYUC4 promoter sequence; further, synthesis of auxin in ovules and formation of parthenocarpic fruits are promoted; meanwhile, the content of the bitter element CuC in the mutant cucumber fruit is obviously higher than that of the corresponding wild type, and the expression of a key gene Bitterfruit (Bt) for controlling the content of the CuC in the cucumber fruit is obviously up-regulated, so that the CsNPF1 is directly combined with a Bt promoter sequence and inhibits the expression of the Bt promoter sequence, thereby reducing the bitter taste of the fruit and improving the quality of the fruit. The method is beneficial to promoting development of novel cucumber varieties with high yield and low bitter taste of fruits, provides a new direction and important theoretical basis and practical guidance for molecular breeding of cucumbers, and has good agricultural application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of cucumber CsNPF1 gene in regulating parthenocarpy and fruit bitterness. Background Art

[0002] Flowering and fruiting of plants usually depend on pollination and fertilization. However, under natural conditions, some plants can produce fruit without pollination and fertilization, or unfertilized ovaries can form fruit under certain stimuli (such as auxin). This phenomenon is called parthenocarpy. Parthenocarpy does not require pollination and can produce seedless fruit, which significantly improves the edible rate and quality of the fruit, and has become an important agronomic trait in crop breeding.

[0003] Parthenocarpy can be divided into natural parthenocarpy and induced parthenocarpy, depending on whether external stimulation is required. Natural parthenocarpy can be further divided into two forms: obligate parthenocarpy and facultative parthenocarpy. Obligate parthenocarpy means that this characteristic is determined only by genetic genes and will not be affected by environmental factors, and seedless fruits are always produced; while facultative parthenocarpy is affected by both genetics and the environment, and only produces seedless fruits when pollination and fertilization are hindered (such as cucumbers). In recent years, due to natural and human factors such as climate change and habitat destruction, the number of insects that serve as pollinators in nature has decreased significantly, resulting in a serious decline in crop yields. Therefore, the development of varieties with excellent parthenocarpy ability can significantly increase yields and ensure fruit quality. Strong parthenocarpy varieties can not only effectively prevent the phenomenon of flower and fruit drop caused by adverse environmental conditions, but also significantly increase fruit set rate and yield, but the current exploration and application of genes related to parthenocarpy is still relatively limited. Therefore, using molecular biological methods to explore the key genes that regulate parthenocarpy, deeply analyze their mechanism of action in regulating parthenocarpy, and improve the parthenocarpy rate of germplasm resources has become the core approach of breeding.

[0004] Bitterness is usually regarded as an unwelcome taste that affects consumers' acceptance of food. For some crops (such as cucumbers) whose fruits are economic organs, bitterness accumulates in the fruits due to genetic factors or poor cultivation management, which seriously affects economic benefits. Therefore, exploring the key genes for the synthesis of cucumber bitter substances is of great significance for regulating fruit bitterness and improving fruit quality. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide an application of cucumber CsNPF1 gene in regulating parthenocarpy and fruit bitterness in view of the deficiencies of the above-mentioned prior art. The CsNPF1 gene can not only promote cucumber parthenocarpy, but also inhibit fruit bitterness.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0007] A cucumber CsNPF1 gene, whose nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the CsNPF1 gene is shown as SEQ ID NO.2.

[0008] The present invention also provides an application of the CsNPF1 gene in regulating cucumber parthenocarpy and fruit bitterness.

[0009] The present invention has significant technical effects due to the adoption of the above technical solution:

[0010] 1. The present invention provides a cucumber gene CsNPF1. Studies have found that the auxin content in the fruits of CsNPF1 gene knockout mutant cucumbers is significantly lower than that in the wild type, and further proves that CsNPF1 directly binds to the CsYUC4 promoter sequence and activates its expression, thereby promoting auxin synthesis in ovules and the formation of parthenocarpic fruits; at the same time, the bitter substance CuC content in the mutant cucumber fruits is significantly higher than that in the corresponding wild type, and the expression of Bitterfruit (Bt), a key gene controlling the CuC content in cucumber fruits, is significantly upregulated, indicating that CsNPF1 directly binds to the Bt promoter sequence and inhibits its expression, thereby reducing the bitterness of the fruit and improving the fruit quality.

[0011] 2. The present invention is conducive to promoting the development of new cucumber varieties with high yield and low bitterness of fruits, provides a new direction and important theoretical basis and practical guidance for cucumber molecular breeding, and has good agricultural application prospects.

[0012] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The phenotypic comparison between the wild type 10Y and the mutant npf1 and the expression level determination results of the gene CsNPF1 in the fruits of the wild type 10Y and the mutant npf1 in Example 1;

[0014] Figure 2 is the result of the phylogenetic tree analysis of the cucumber CsNPF1 gene in Example 1;

[0015] Figure 3 The gene knockout plant npf1 in Example 2 CR1and npf1 CR2 Fruit phenotyping analysis;

[0016] Figure 4 The gene knockout plant npf1 in Example 2 CR1 and npf1 CR2 Ovule phenotyping analysis;

[0017] Figure 5 The analysis of the effect of CsNPF1 on auxin content in Example 3;

[0018] Figure 6 In Example 3, CsNPF1 directly binds to the promoter of the auxin synthesis gene CsYUC4 to regulate auxin synthesis;

[0019] Figure 7 In Example 4, CsNPF1 directly binds to the promoter of the fruit bitterness-related gene Bt to regulate the synthesis of bitter substances. DETAILED DESCRIPTION

[0020] Example 1

[0021] This example is about the acquisition and identification of cucumber CsNPF1.

[0022] A spontaneous mutant with natural non-parthenocarpic fruiting was screened from the high-generation inbred line 10Y of cucumber. Because it does not have the ability to produce parthenocarpic fruit, it was named non-parthenocarpic fruit 1 (npf1). In order to identify the genetic factors that control the phenotypic variation of the mutant npf1, a segregating population was constructed by hybridizing the mutant npf1 with the wild type 1-5 (which is distantly related to 10Y). The phenotypic investigation showed that F 1 The plants showed parthenocarpy and female fertility, F 2 Of the 116 individual plants, 86 plants were consistent with the wild type and showed parthenocarpy, while the remaining 30 plants showed non-parthenocarpy. Genomic DNA of the mutant cucumber was extracted, and a candidate gene was obtained through genome resequencing and KASP localization analysis.

[0023] Total RNA of the mutant cucumber was extracted and reverse transcribed into cDNA. Sequencing primers of candidate genes were designed based on the information of the Cucurbitaceae genome database, and cDNA was amplified by PCR.

[0024] The forward primer (F) sequence is: ATGGGGTGCGACGCTTTC,

[0025] The reverse primer (R) sequence was: TCAAGAGGGTCTCATAAGACAATGA;

[0026] The amplification reaction system is 20 μL: 10 μL 2× PrimeSTAR, 2 μL cDNA, 1 μL F, 1 μL R, 6 μL H 2 O; the reaction conditions were: 95°C pre-denaturation for 3 min, 95°C denaturation for 30 sec, 58°C annealing for 30 sec, 72°C extension for 2 min, and 30 cycles.

[0027] The amplified candidate gene was sequenced and analyzed, and it was found that its open reading frame (ORF) was 1614 bp in length, consisting of 10 exons and 9 introns. The candidate gene was named CsNPF1, the nucleotide sequence of the CsNPF1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0028] The expression of CsNPF1 gene in wild type 10Y and mutant npf1 was analyzed by fluorescence quantitative analysis (qPCR). The forward primer (F) sequence was: GAACGATTGGCCTGATGTAA, the reverse primer (R) sequence was ACTTCGGCTTCCTCTTCT, and the amplification reaction system was 10 μL: 5 μL 2×ChamQ Universal SYBR qPCR Master Mix, 1 μL cDNA, 0.2 μL F, 0.2 μL R, 3.6 μL H 2 O, reaction conditions were: 95°C pre-denaturation for 30 sec, 95°C denaturation for 5 sec, 60°C extension for 30 sec, and 40 cycles. Figure 1 a is the phenotypic comparison between the wild type 10Y and the mutant npf1. Figure 1 b is the expression level of gene CsNPF1 in wild type 10Y and mutant npf1 (-2DAA represents 2 days before flowering, 3DAA represents 3 days after flowering), indicating that the expression of CsNPF1 is severely inhibited in the non-parthenocarpic mutant.

[0029] The conserved domain analysis using the NCBI database Conserved Domain database (CCD) revealed that the protein encoded by the CsNPF1 gene belongs to the AP2 subfamily and contains two plant-specific AP2 / ERF conserved domains ( Figure 2 ). The amino acid sequence of CsNPF1 protein was analyzed by BLASTP comparison, and the amino acid sequence with high sequence similarity and containing two AP2 functional domains was selected to construct the evolutionary tree. The results showed that the nucleotide sequence of CsNPF1 protein was highly similar to that of Arabidopsis thaliana APETALA2 (AP2) protein. In summary, it can be inferred that the CsNPF1 gene encodes a transcription factor with two AP2 functional domains.

[0030] Example 2

[0031] This example is a verification of the genetic transformation of the CsNPF1 gene.

[0032] In order to verify the biological function of CsNPF1 gene in regulating parthenocarpy, the variety Cu2 with high transgenic transformation efficiency and parthenocarpy was selected for transgenic function verification. The method is as follows:

[0033] 1. Construction of CsNPF1 gene editing CRISPR / Cas9 vector

[0034] The CsNPF1 gene sequence was analyzed for target sites using the CRISPR-GE website (http: / / skl.scau.edu.cn / ) and two targets (SgRNA1: CGCCTTCCCTCGGGCTCACT and SgRNA2: AGAAAGTGACGCCGCGGTAC) were selected. The sgRNA expression cassette fragment was amplified using target primers (CsNPF1 DT1BsF: ATATATGGTCTCGATTGGCCTTCCCTCGGGCTCACTGTT, CsNPF1DT2 BsR: ATTATTGGTCTCGAAACGTACCGCGGCGTCACTTTCCAA, CsNPF1 DT1 F0: TG GCCTTCCCTCGGGCTCACTGTTTTAGAGCTAGAAATAGC, CsNPF1DT2 R0: AACGTACCGCGGCGTCACTTTCCAATCTCTTAGTCGACTCTAC) using the pCBC-DT1T2 vector as a template. The sgRNA expression cassette was assembled into the CRISPR / Cas9 vector pKSE402 using enzyme digestion-ligation reaction to obtain the gene editing vector CsNPF1-pKSE402.

[0035] 2. Agrobacterium competent transformation

[0036] (1) Take Agrobacterium competent cells EHA105 stored at -80°C, thaw on ice, add 2 μg of CsNPF1-pKSE402 plasmid, gently pipette to mix, incubate on ice for 30 min, and quickly freeze in liquid nitrogen for 2 min.

[0037] (2) Heat shock at 37°C for 5 min and place on ice for 5 min.

[0038] (3) Add 600 μL LB liquid (without antibiotics) and culture at 200 rpm in a shaker at 28°C for 3 h.

[0039] (4) Centrifuge at 6000 rpm for 5 min, remove part of the supernatant, retain about 100 μL, resuspend and evenly spread on LB solid medium (containing 50 mg / mL kanamycin sulfate and 50 mg / mL rifampicin), and culture inverted in a 28°C incubator for 2 to 3 days.

[0040] (5) Pick a single clone and place it in LB liquid culture medium containing 1 mL of the corresponding antibiotic. Cultivate it overnight on a shaker at 28°C and 200 rpm until the bacterial solution becomes turbid.

[0041] 3. Agrobacterium-mediated infection of cucumber cotyledons

[0042] (1) Take plump wild-type cucumber Cu2 seeds and soak them in water for a period of time, then peel off the skin with tweezers. Disinfect the peeled seeds with 75% alcohol for 30 seconds in a clean bench, then disinfect with 3% sodium hypochlorite solution for 10 minutes, and finally wash them with sterile water 5 to 6 times, dry them on filter paper, sow them on MS solid culture medium, and culture them at 28°C in the dark for 1 day;

[0043] (2) When the hypocotyl grows to about 1 cm, use tweezers and a knife to cut off the hypocotyl and the lower half of the cotyledon on sterilized filter paper, and immediately put the remaining upper half of the cotyledon with a U-shaped opening into a suspension (MS liquid medium containing 200 μM AS, 1.25 mM MES, 2 mg / mL 6-BA and 1 mg / mL ABA). Collect the Agrobacterium cells containing the target vector that were cultured overnight with shaking the day before, resuspend the cells with the suspension, and adjust the OD 600 Adjust to 0.2-0.3 as infection solution;

[0044] (3) Place the cut cotyledons in the invading dye solution, use a 20 mL sterile syringe to evacuate the 10 mL bacterial solution containing the cotyledons for 90 seconds, repeat once, and dry on filter paper. Then place the dried cotyledons on a co-culture medium (MS solid medium containing 200 μM AS, 1.25 mM MES, 2 mg / mL 6-BA and 1 mg / mL ABA) with a layer of filter paper on the surface, and culture at 28°C in the dark for 4 days;

[0045] (4) Transfer the cotyledons cultured in the previous step to the resistance differentiation medium (MS solid medium containing 2 mg / mL 6-BA, 1 mg / mL ABA and 200 mg / L timentin) and culture them in the tissue culture room for about 4 weeks. The cotyledons differentiate into resistance buds, and the buds are cut off and placed in the rooting medium to continue to culture until roots form. The conditions in the tissue culture room are: 25°C, 12 h light / 12 h dark;

[0046] (5) Take out the cucumber seedlings with well-developed root systems from the culture medium and transfer them to a small pot filled with nutrient soil and vermiculite. Cover the small pot with a ziplock bag to prevent the cucumber seedlings from losing water and wilting. Acclimate them under weak light for one week. After they have recovered, remove the ziplock bag and plant them in a solar greenhouse after growing for 2 to 3 weeks.

[0047] 4. Identification of transgenic plants

[0048] Transgenic T 0 The plants of the first generation were self-pollinated or crossed with wild-type Cu2 plants to obtain T 1 The T 1 Check whether the ratio of GFP fluorescent seeds to non-fluorescent seeds in the next generation is 3:1 (self-pollination) or 1:1 (self-pollination). Select non-fluorescent seeds for germination and sowing, cut leaves to extract genomic DNA, use primers on both wings of SgRNA to amplify the target fragment, and perform PCR product sequencing to analyze whether there is a mutation. If it is a heterozygous mutation, the single plant can be self-pollinated to obtain T 2 Generation, in T 2 Homozygous mutants were screened in the next generation. Two stable gene knockout strains (npf1 CR1 and npf1 CR2 ).

[0049] Figure 3 The knockout plant npf1 CR1 and npf1 CR2 Fruit phenotype analysis of npf1 CR1 and npf1 CR2 Two types of mutations, the purple underline indicates the protospacer adjacent motif (PAM) sequence, the purple box indicates the SgRNA sequence, '+' indicates nucleotide insertion, and '-' indicates nucleotide deletion; b is npf1 CR1 and npf1 CR2 Genotype identification, the red box indicates the AP2 domain, the asterisk indicates the position of the stop codon, and the numbers indicate the position of the amino acid; c and d are wild-type Cu2, npf1 CR1 and npf1 CR2 Phenotypic diagram, white arrows indicate parthenocarpic fruits, DAA indicates days after flowering, and the scale is 5 cm; e is the wild type Cu2, npf1 CR1 and npf1 CR2 The parthenocarpy rate of wild type Cu2 and npf1 CR1 and npf1 CR2 The length, width and weight of parthenocarpic fruits of npf1 were measured (values ​​are mean ± standard deviation, two-tailed t-test). CR1The strains had 14 bp and 33 bp deletions at the first and second target sites, respectively, while npf1 CR2 The strain had a 1 bp insertion and a 129 bp deletion between the two target sites ( Figure 3 a). Both mutation types result in the translation of the CsNPF1 gene into truncated proteins lacking two AP2 domains (149 and 177 amino acids, respectively) ( Figure 3 b). npf1 CR1 and npf1 CR2 The plants are morphologically similar to wild-type Cu2 ( Figure 3 c), but showed obvious differences in parthenocarpy ( Figure 3 In the absence of pollination, the length, width and weight of wild-type Cu2 fruits increased significantly from 2 days before anthesis (-2DAA) to 9 days after anthesis (9DAA). In contrast, the length, width and weight of the fruit of the gene knockout mutant npf1 increased significantly from 2 days before anthesis (-2DAA) to 9 days after anthesis (9DAA). CR1 and npf1 CR2 The fruit growth stagnates after reaching 0DAA, resulting in melon rot ( Figure 3 fh).

[0050] Figure 4 The npf1 knockout plant CR1 and npf1 CR2 Ovule phenotype analysis, where a is the wild type Cu2, npf1 CR1 and npf1 CR2 Freehand sections (upper) and paraffin sections (lower) of fruit cross sections on the day of flowering. The blue dotted line indicates the ovule, DAA indicates the number of days after flowering, ov indicates the ovule, in indicates the integument, nu indicates the nucellus, fu indicates the funiculus, dov indicates the abnormal ovule, and the scale is 1 mm; b and c are TTC staining detection of wild-type Cu2 and npf1 CR1 and npf1 CR2 Pollen viability and pollen tube elongation ability, the scale is 100 μm, red in b represents strong pollen viability, light red represents relatively strong pollen viability, and colorless represents no pollen viability; d is the wild type Cu2 and npf1 CR1 Fruits after mutual hybridization or self-pollination, the scale is 5 cm; e is the longitudinal section of the fruit 40 days after pollination, the red dotted line represents the seeds, the scale is 5 cm. The results showed that similar to the mutant npf1, the gene knockout mutant npf1 CR1 and npf1 CR2 Abnormal ovule development ( Figure 4 a), but pollen viability and pollen tube elongation were normal ( Figure 4 b,c). In addition, npf1 CR1 The fruits of the plant showed some enlargement and growth after artificial pollination, but no seeds were formed ( Figure 4d,e). Therefore, the knockout mutant npf1 CR1 and npf1 CR2 All phenotypes (non-parthenocarpy and female sterility) were completely consistent with the mutant npf1, indicating that CsNPF1 is the target gene that causes the phenotypes of the mutant npf1.

[0051] Example 3

[0052] This example is an application of the CsNPF1 gene in regulating parthenocarpy in cucumber.

[0053] In order to further explore the molecular network of CsNPF1 gene regulating parthenocarpy, the whole genome expression profiles of wild-type 10Y and mutant npf1 fruits were analyzed by RNA-seq technology, and a total of 214 differentially expressed genes were detected, including 140 up-regulated genes and 74 down-regulated genes (fold change ≥ 2, FDR < 0.05). Further KEGG analysis of these differentially expressed genes showed that the plant hormone pathway was highly enriched, which also means that the CsNPF1 gene may regulate parthenocarpy through the plant hormone pathway. Ultra-high performance liquid chromatography tandem mass spectrometry was used to analyze the expression of wild-type 10Y, mutant npf1, wild-type Cu2 and gene knockout mutant npf1 CR1 The auxin content of the fruit is determined by:

[0054] (1) The fruits of wild-type and mutant plants two days after flowering were ground into powder in liquid nitrogen and placed in a 2 mL centrifuge tube. The sample weight was approximately 50 mg and the specific value was recorded;

[0055] (2) Add 50 μL of internal standard working solution and 500 μL of extraction solution (isopropanol: water: hydrochloric acid = 2:1:0.002) to each sample, vortex rapidly for 10 s, and shake at 9000 rpm for 30 min at 4°C;

[0056] (3) Add 1 mL of chloroform, vortex for 10 s, and shake at 9000 rpm for 30 min at 4 °C;

[0057] (4) Centrifugation at 14,000 rpm for 5 min at 4°C to allow two phases to form;

[0058] (5) Transfer 1.2 mL of the lower layer of liquid to a new 1.5 mL centrifuge tube and blow dry with nitrogen gas at room temperature;

[0059] (6) Add 100 μL of methanol to reconstitute, shake at 9000 rpm for 10 min at 4°C, and then centrifuge at 14000 rpm for 5 min;

[0060] (7) Use a 1 mL syringe to aspirate the supernatant and carefully filter it through a 0.22 μm filter membrane into a sample injection bottle for testing.

[0061] Figure 5 is the analysis of the effect of CsNPF1 on auxin content, where a is the KEGG pathway enrichment analysis of differentially expressed genes in the transcriptome of wild-type 10Y and mutant npf1 fruit; b is the KEGG pathway enrichment analysis of wild-type 10Y, mutant npf1, wild-type Cu2 and gene knockout mutant npf1 CR1 Auxin content of the fruit; c is the stigma of the fruit of the mutant npf1 on the day of flowering sprayed with 200μM naphthaleneacetic acid, once every 3 days, 3 times, water as the control, the scale is 1cm; d is the statistical analysis of the length and width of the mutant npf1 fruit after NAA treatment (the values ​​are shown as mean ± standard deviation, two-tailed t test). The results showed that the auxin content in the mutants was significantly lower than that in the wild type ( Figure 5 b). In addition, spraying the stigma of the mutant npf1 fruit with 200 μM auxin (naphthaleneacetic acid, NAA) can cause the fruit to swell ( Figure 5 c and d). These results suggest that CsNPF1 is likely to regulate parthenocarpy by affecting auxin content.

[0062] Considering that CsNPF1 is a typical transcription factor, it may affect auxin content and parthenocarpy by directly regulating auxin-related target genes. Therefore, DNA affinity purification sequencing (DAP-seq) technology was used to screen target genes that may be related to auxin. The CDS sequence of CsNPF1 was amplified by PCR technology, and the SP6 promoter and Kozak sequence were added to its 5' end. Subsequently, the sequence was connected to the expression vector with 3×FLAG tag by restriction ligation method, and the CsNPF1-FLAG plasmid was successfully constructed. Using this plasmid, CsNPF1-3×FLAG protein was produced according to the TNT SP6 high-yield wheat germ protein expression system (Promega L3260). 6μg of plasmid was used in each reaction, the reaction volume was 50μL, and incubation was carried out at 25℃ for 2h. Then, 20μL anti-FLAG magnetic beads (M8823, Merck Millipore) were added to the reaction system, and then incubated for 1h for specific binding. The anti-FLAG magnetic beads were collected and washed three times to remove non-specific binders. The genomic DNA of wild-type cucumber 10Y fruit was ultrasonically treated and a DNA library was established using the VAHTS Universal DNA Library Prep Kit for IlluminaV3 (ND607, Vazyme). The anti-FLAG magnetic beads containing CsNPF1-FLAG protein were incubated with 50 ng of the DNA library, and after incubation, the DNA bound to the magnetic beads was extracted by affinity purification and phenol-chloroform method. Finally, the extracted DNA fragments were PCR amplified, purified and quantified, and sequenced and analyzed on a DNBSEQ-T7 sequencer. Figure 6 a is the distribution of CsNPF1 binding regions in the cucumber genome determined by DAP-seq analysis, and TSS is the transcription start site. DAP-seq data analysis showed that the CsNPF1 binding motif is TTTGTT, which is very similar to the binding sites of AP2 transcription factors in Arabidopsis thaliana and Antirrhinum majus reported by previous researchers ( Figure 6 b).

[0063] Then, the Illumina Hiseq2500 sequencing platform (Biomark, Beijing) was used to perform double-end sequencing of the fruit RNA from the growing point and 2 days after flowering of the wild-type 10Y and mutant npf1, and 3 biological replicates were set for each material. Subsequently, the raw data were compared with the cucumber reference genome Chinese long v2 using the Biomark cloud platform to obtain the FPKM values ​​of all genes, and then the differentially expressed genes between the mutant npf1 and the wild type were screened and identified based on the two parameters of fold change (fold change ≥ 2) and false detection rate (FDR < 0.05). Finally, GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) were used to perform functional enrichment analysis of the differentially expressed genes. Figure 6 c is the enrichment peak diagram of the CsNPF1 core binding motif in the CsYUC4 promoter, and the black box represents the CsNPF1 core binding motif. Combining DAP-seq and RNA-seq data, it was found that there was a CsNPF1 binding peak in the promoter region of the differentially expressed gene auxin biosynthesis gene CsYUCCA4 (CsYUC4).

[0064] Electron migration assay (EMSA): Using the probe synthesized from the cis-acting element on the MBP-CsNPF1 fusion expression protein and the CsYUC4 promoter, we verified whether the CsNPF1 protein directly interacted with the CsYUC4 promoter in vitro. The method is:

[0065] (1) Protein expression

[0066] 1) The target plasmid MBP-CsNPF1 was transferred to the prokaryotic expression strain BL21, and a single clone was picked into a 2 mL centrifuge tube. 1 mL of LB liquid (containing 50 μg / mL Amp) was added, and the culture was shaken at 37°C until the bacterial solution became turbid. The target fragment was amplified by PCR to identify whether it was successfully transferred, and the positive bacterial solution was saved;

[0067] 2) Add the above bacterial solution to a flask containing 20 mL of LB liquid (containing 50 μg / mL Amp) at a ratio of 1:100, and shake at 37°C overnight;

[0068] 3) Add the bacterial solution to a flask containing 200 mL of LB liquid (containing 50 μg / mL Amp) at a ratio of 2.5:100 and shake at 37°C until the bacterial solution OD reaches 600 When the concentration was 0.4-0.6, 0.4 mM IPTG was added and the induction was carried out for 18 h at 16 °C and 200 rpm in a shaker;

[0069] 4) Centrifuge at 4°C, 12000 rpm for 10 min, discard the supernatant, and collect the cells;

[0070] 5) Resuspend the cells in pre-cooled MBP resuspension solution (20 mM Tirs 7.4, 200 mM NaCl, 1 mM EDTA, 1 mM DTT) and disrupt by ultrasound on ice: power 200 W, 3 s on, 3 s off, 15 min;

[0071] 6) Centrifuge at 10,000 rpm for 30 min at 4°C and retain the supernatant for direct protein purification.

[0072] (2) Protein purification

[0073] 1) Add 20% alcohol to the purification column to clean the gasket, and then add 200 μL MBP filler (100 μL filler / 100 mL bacterial liquid);

[0074] 2) Add 20% alcohol to the column to clean the filler, repeat once;

[0075] 3) Add MBP resuspension solution to the column to wash the filler, repeat once;

[0076] 4) Resuspend the filler with the above supernatant and pour into a clean 100 mL Erlenmeyer flask, place in an ice box, shake on a shaker at 60 rpm for 2 hours;

[0077] 5) Collect the filler, add MBP resuspension solution to the column to wash the filler to remove foreign proteins, and repeat once;

[0078] 6) Add MBP eluent (MBP resuspension containing 50 mM maltose) in batches. Add 1 mL of MBP eluent for the first time, combine for 15 minutes, and collect the eluent in a centrifuge tube; add 1 mL of MBP eluent for the second time, combine for 10 minutes, and collect the eluent in a centrifuge tube; add 1 mL of MBP eluent for the third time, combine for 5 minutes, and collect the eluent in a centrifuge tube.

[0079] 7) Run gel to detect protein concentration and store in aliquots at -80℃ for later use.

[0080] (3) EMSA binding assay

[0081] The method was based on the LightShift Chemiluminescent EMSA Kit (Thermo Fisher) with slight modifications.

[0082] 1) Preparation of DNA probes: The primers with biotin tags at the 5' end (pCsYUC4-P_Bio forward primer: [Bio]AAGTTGGCTTGGTTATTTATCTTATTTTAAACAAAT, pCsYUC4-P_Bio reverse primer: ATTTGTTTAAAATAAGATAAATAACCAAGCCAACTT) and without biotin tags (pCsYUC4-P_Cold forward primer: AAGTTGGCTTGGTTATTTATCTTATTTTAAACAAAT, pCsYUC4-P_Cold reverse primer: ATTTGTTTAAAATAAGATAAATAACCAAGCCAACTT) were synthesized by ddH 2 0 to 100 μM. Take 5 μL of each and mix well, then add 15 μL of ddHO 2 O was diluted to a primer concentration of 20 μM, boiled in boiling water for denaturation for 10 min, and naturally cooled to room temperature to obtain biotin-labeled probes and unlabeled probes;

[0083] 2) Binding reaction: Add 2μL 10×binding buffer, 20μM probe, and 2μg protein to a 200μL centrifuge tube, add water to 20μL, mix gently (to prevent the probe from falling off), and place on ice for 30 minutes. For the competitive reaction, add the unlabeled probe and protein first, and then add the biotin-labeled probe after binding on ice for 30 minutes, and then bind on ice for another 30 minutes.

[0084] 3) Electrophoresis: Prepare a 6.5% non-denaturing gel and pre-electrophoresis in 0.5×TBE solution for 30 min at 140 V. Replace with a new 0.5×TBE solution, apply the sample, and perform electrophoresis on ice for 60-80 min at 140 V. Stop electrophoresis when the bromophenol blue indicator runs to 2 / 3 of the gel;

[0085] 4) Transfer: Soak the black filter screen and filter paper in 0.5×TBE solution in advance, and cut a nylon membrane of 8cm×6cm and soak it in 0.5×TBE solution for 10min. Place it in order (from bottom to top: black side of the clip - filter screen - filter paper - EMSA glue - nylon membrane - filter paper - filter screen - white side of the clip). Place the clip in the transfer tank in the order of black to black and red to red. Fill it with 0.5×TBE solution, place the transfer tank on ice, and transfer the membrane at a constant current of 380mA for 45min.

[0086] 5) UV crosslinking: Place the nylon membrane on clean filter paper and put it into a UV crosslinker, set to 1.245 J / cm 2 Crosslink the front and back sides for 2 min each;

[0087] 6) Blocking: Place the nylon membrane with the front side facing up into a 50 mL centrifuge tube, add 5 mL Blocking Buffer, and block on a rotator for 20 min at 25 rpm;

[0088] 7) Streptavidin-HRP labeling: add 5 mL of Blocking Buffer containing 16.7 μL of Streptavidin-HRP and incubate on a rotator for 20 min at 25 rpm;

[0089] 8) Washing: Pour off the blocking solution and wash the membrane 4 times with 5 mL 1× Washing Buffer, with the first rapid rinse and subsequent washes for 10 min each at 80 rpm;

[0090] 9) Equilibration: Pour off the rinse solution, add 5 mL of Substrate Equilibration Solution and equilibrate for 5 min at 80 rpm;

[0091] 10) Development: Take out the membrane from the centrifuge tube and evenly apply 1 mL of Luminol Solution / Stable Peroxide Solution developer mixed at a ratio of 1:1 on the membrane using a pipette. Allow to react for 2 minutes in the dark and then expose to light for detection.

[0092] Electron migration assay (EMSA) confirmed that CsNPF1 can directly bind to the CsYUC4 promoter containing the TTTGTT binding motif ( Figure 6 d).

[0093] Dual luciferase reporter assay: Using CsNPF1 as the effector and the CsYUC4 promoter as the reporter, the effector and reporter were co-transfected into cucumber protoplasts to verify whether CsNPF1 interacts with the cis-acting element on the CsYUC4 promoter in vivo. The method is:

[0094] (1) Construction of dual luciferase vector: First, clone the CsYUC4 promoter, the forward primer is ATACGTTCATGAAGTTGTTGCAAAC, and the reverse primer is GTGATGATCATCTTCTTGGTCTTTGC. Then connect the CsYUC4 promoter fragment into the pGreenII0800 vector to construct the pYUC4:LUC reporter factor vector; connect the full-length CDS of the NPF1 gene into the pGreenII62SK vector to construct the 35S:NPF1 effector factor vector.

[0095] (2) Cucumber protoplast transformation and transcription activity analysis

[0096] 1) 10 μg of each effector and reporter (35S:GFP and pYUC4:LUC; 35S:NPF1 and pYUC4:LUC) in different combinations were co-transformed into cucumber protoplasts by PEG-Ca-mediated transformation as follows:

[0097] ①Select plump cucumber seeds, peel and sterilize them, inoculate them into MS solid medium, and culture them in the dark at 28℃ for 5-7 days. Cut the hypocotyls and cotyledons of the etiolated seedlings into thin strips with a razor blade and gently place them in 20mL of enzymatic solution (2mM MES, 0.4M mannitol, 1.5% [w / v] cellulase R-10, 0.4% [w / v] macerozyme R-10 and 0.1×W5 resuspension solution [2mM MES, 154mM NaCl, 5mM KCl and 125mM CaCl 2 , pH 5.7], pH 5.7) in a conical flask, and enzymolyze on a shaker at room temperature and in the dark for 4 h at a speed of 40 rpm;

[0098] ② Carefully remove the enzymatic solution with the cut tip (try not to touch the tissue), add an equal volume of W5 resuspension solution to resuspend the tissue, and then slowly shake in a light-proof shaker at room temperature for 1 hour to release the protoplasts at a speed of 80 rpm;

[0099] ③ Filter the liquid from the previous step, centrifuge at 1000 rpm (speed up set to 1, speed down set to 0) at room temperature for 10 min, and carefully remove the supernatant with a pipette. Resuspend the protoplasts with 10 mL of W5 solution, centrifuge at 1000 rpm at room temperature for 10 min, and carefully remove the supernatant with a pipette;

[0100] ④ Use appropriate amount of MMG solution (5mM MES, 0.4M mannitol and 20mM CaCl 2 , pH 5.7) to resuspend the protoplasts to a concentration of 2 × 10 5 / mL.

[0101] ⑤ Add 20 μg of plasmid to a 2 mL centrifuge tube (total volume 20 μL, fill up with water if insufficient), add 200 μL of protoplasts to the centrifuge tube with a cut yellow pipette tip, and mix gently;

[0102] ⑥ Add an equal volume of 220 μL PEG / Ca solution (40% PEG4000, 0.4 M mannitol, 100 mM CaCl 2 ) Make the final PEG concentration 20%, mix gently, and incubate at room temperature for 20 min;

[0103] ⑦ Add 1 mL of W5 solution, mix gently, and stop the transfection process;

[0104] ⑧ Centrifuge at 1000 rpm for 5 min and carefully remove 1 mL of supernatant;

[0105] ⑨Add 1 mL of W5 solution, mix gently, and incubate at room temperature with weak light for 24 h to 36 h;

[0106] ⑩ Centrifuge at 1000 rpm for 3 min at room temperature, carefully remove 800 μL of supernatant and mix gently.

[0107] 2) After culturing at room temperature in the dark for 18 hours, centrifuge at 1000 rpm for 5 minutes, carefully remove the supernatant, leaving about 50 μL of liquid, add 100 μL of 1×PLB lysis buffer, and vortex for 10 seconds to fully lyse the cells and release luciferase;

[0108] 3) The reserved liquid was equally divided into three tubes, each containing 40 μL, and the LUC and REN values ​​were determined using the Promega Dual Luciferase Reporter Gene Assay System in the Promega GloMax Luminescence Detector DLR-0-INJ project.

[0109] Figure 6 e is a dual luciferase assay verifying the transcriptional activation effect of CsNPF1 on CsYUC4. The results showed that CsNPF1 promoted the transcription of CsYUC4.

[0110] Fluorescence quantitative (qPCR) analysis of CsYUC4 gene in wild-type Cu2 and gene knockout mutant npf1 CR1 and npf1 CR2 The forward primer (F) sequence was TCTTTCACTTTCCACTTACCCA, and the reverse primer (R) sequence was GCCGTGAACCCATATGCA. The amplification reaction system was 10 μL: 5 μL 2×ChamQ Universal SYBR qPCR MasterMix, 1 μL cDNA, 0.2 μL F, 0.2 μL R, 3.6 μL H 2 O, reaction conditions were: 95°C pre-denaturation for 30 sec, 95°C denaturation for 5 sec, 60°C extension for 30 sec, and 40 cycles. Figure 6 f is the fluorescence quantitative PCR analysis of CsYUC4 gene in wild type Cu2 and gene knockout mutant npf1 CR1 and npf1 CR2 The expression results showed that the expression of CsYUC4 was significantly upregulated in the npf1 knockout mutant. CR1 and npf1 CR2 was significantly lower than that of wild-type Cu2.

[0111] In situ hybridization experiments were performed as follows:

[0112] (1) Probe preparation

[0113] 1) Purification of target fragment: Design PCR amplification primers (CsNPF1_ISH_SP6_F: GATTTAGGTGACACTATAGaatGCTTCAAGCTCTTCCGCTGTG and CsNPF1_ISH_T7-R: tgTAATACGACTCACTATAGGGCCATCTGCTTTAAATCGTC) for the specific region of the target gene cDNA (about 100-500 bp), use cDNA or the plasmid containing the target fragment as a template, use high-fidelity enzyme to perform PCR amplification, and purify and recover the target fragment;

[0114] 2) In vitro transcription: add 2 μL 10×Transcription buffer, 2 μL 10×Transcription buffer, 1 μL RNase inhibitor, 2 μL T7 RNA polymerase, 1 μg target fragment, RNase-free H 2 O to 20 μL. Mix gently and incubate at 95°C for 2 h;

[0115] 3) Probe purification: Add 1 μL DNaseI, 1 μL tRNA, 75 μL RNase-free H 2 O, gently mix and incubate at 37°C for 30 min. After the reaction is complete, add 95 μL of pre-cooled 4 M NH 4 Ac, 190μL pre-cooled anhydrous ethanol, gently invert to mix, and place at -20℃ for precipitation for 3h. Then centrifuge at 4℃ 12000rpm for 10min, and discard the supernatant. Rinse the precipitate with 600μL 70% alcohol, centrifuge at 4℃ 12000rpm for 7min, and discard the supernatant. Then place on ice in a clean bench to dry; after drying, add 100μL RNase-free H 2 O and 100μL 2× carbonate buffer, keep warm at 60℃ for appropriate time for hydrolysis; add 10μL 10% glacial acetic acid, 21μL 3M NaAc (pH5.2) and 420μL anhydrous ethanol in sequence, mix gently, and precipitate at -20℃ for 3h. Centrifuge at 4℃14000rpm for 10min and discard the supernatant. Rinse with 600μL 70% alcohol, centrifuge at 4℃14000rpm for 7min, and discard the supernatant. Place on ice in a clean bench to dry. After the precipitate is dry, add 40μL 50% formamide and store the probe at -80℃ for a long time.

[0116] (2) Sample preparation

[0117] The growing points and fruits of the wild type 10Y and mutant npf1 at different developmental days after anthesis were used as samples and embedded in paraffin sections.

[0118] (3) Pretreatment before hybridization

[0119] 1) Place the cut paraffin sections on a staining rack and treat them in xylene solution twice, 10 minutes each time, to dewax the samples.

[0120] 2) Rehydrate in graded alcohol (100%, 95%, 85%, 70%, 50% and 30%) for 30 seconds each.

[0121] 3) digestion in 0.85% NaCl solution for 2 min, 1× PBS solution for 2 min, 37°C Proteinase K solution for 30 min, 1× PBS solution containing 0.2% glycine for 2 min, 1× PBS solution for 2 min, 1× PBS solution for 2 min, 1× PBS solution for 2 min, 1× PBS solution containing 4% formaldehyde for 10 min, 1× PBS solution for 2 min, 1× PBS solution for 2 min, acetic anhydride solution with gentle stirring for 10 min, 1× PBS solution for 2 min, and 1× PBS solution for 2 min;

[0122] 4) Then use 30%, 50%, 70%, 85% and 95% alcohol in sequence, each for 30 seconds, and anhydrous ethanol twice, each for 1 minute.

[0123] (4) Hybridization and color development

[0124] 1) Hybridization: First, dry the slide and then add the hybridization buffer. Denature the probe at 80℃ for 2 minutes according to the amount of 30μL probe (containing 2μL probe and 28μL 50% formamide) per slide, immediately place it on ice for 2-3 minutes (to prevent renaturation), and centrifuge it instantly. Add 4 times the volume (120μL) of hybridization solution and gently invert it to mix thoroughly. Drop the hybridization buffer on the slide, spread it evenly with a yellow gun tip, then cover it with a coverslip and spread it in a wet box. Finally, seal the wet box and place it in a 50℃ oven for overnight hybridization incubation.

[0125] 2) Color development: The above slides were sequentially placed in 0.2×SSC solution at 55°C for 1 h, 0.2×SSC solution at 55°C for 1 h, 1×NTE solution at 37°C for 5 min, 1×NTE solution at 37°C for 5 min, and 20 μg / mL RNaseA1×NTE solution at 37℃ for 30min, 1×NTE solution at 37℃ for 5min, 1×NTE solution at 37℃ for 5min, 0.2×SSC solution at 55℃ for 1h, 1×TBS solution for 5min, Roche blocking solution with gentle shaking for 1h, 1×TBST solution for 45min; after the slides were dried, they were rinsed twice with 120μL antibody diluent (10μL antibody in every 12.5mL 1×TBST solution), 120μL antibody reaction solution was added to the sections, covered with coverslips and placed in a wet box for incubation at room temperature for 2h; the incubated slides were washed with shaking in 1×TBST solution for 4 times, each time for 15min; after the slides were moistened with the color developing substrate solution twice, 120μL of substrate solution containing NBT / BCIP was added to the slides, and the two slides with the sample side (front) were gently pressed together (try to avoid forming bubbles), and placed vertically in a Coplin cup. After sealing, place in a dark environment at room temperature for 1 to 3 days for color development.

[0126] Figure 6 g is an in situ hybridization experiment to detect the expression of CsYUC4 in fruits at different developmental days, purple represents the signal, DAA represents the days after flowering, in represents the integument, nu represents the nucellus, and fu represents the funiculus (the values ​​are shown as mean ± standard deviation; two-tailed t test). It was found that CsYUC4 was specifically expressed in ovules, and its expression gradually increased with the development of the fruit, which is consistent with the localization results of CsNPF1.

[0127] In summary, CsNPF1 promotes auxin synthesis in ovules and the formation of parthenocarpic fruits by directly binding to the CsYUC4 promoter sequence and activating its expression.

[0128] Example 4

[0129] This example is an application of the CsNPF1 gene in regulating the bitterness of cucumber fruit.

[0130] In order to explore whether the mutant npf1 affects the fruit quality, the fruits of the wild type 10Y and the mutant npf1 were tasted respectively, and it was found that the bitterness of the mutant npf1 fruit was significantly stronger than that of the wild type 10Y, and the triterpenoid compound, cucumber cucurbitacin (CuC), gave the cucumber fruit bitterness. The content of CuC in the wild type and mutant was determined by ultra-high performance liquid chromatography-tandem mass spectrometry. The method was as follows:

[0131] (1) Grind the fruits of wild-type and mutant plants two days after flowering into powder in liquid nitrogen and place them in a 2 mL centrifuge tube. Weigh the sample to about 200 mg and record the specific value.

[0132] (2) Add 400 μL of methanol to each sample, vortex rapidly for 10 seconds, and sonicate for 15 minutes;

[0133] (3) Centrifuge at 14,000 rpm for 5 min at 4°C and transfer the supernatant to a 1.5 mL centrifuge tube;

[0134] (4) Use a 1 mL syringe to aspirate the supernatant and carefully filter it through a 0.22 μm filter membrane into a sample injection bottle for testing.

[0135] The same method as in Example 3 was used to study the CsNPF1 gene and the Bt promoter of the fruit bitterness-related gene. Specifically, it included:

[0136] The expression of Bt gene in wild type Cu2 and gene knockout mutant npf1 was analyzed by quantitative PCR. CR1 and npf1 CR2 For the expression analysis of , the forward primer (F) sequence was GTTGCTGATCACCCTCCATTGATCG, the reverse primer (R) sequence was GCCTTCTTTGGCGTTCAACATCTCT, and the PCR amplification reaction system was 10 μL: 5 μL 2×ChamQ Universal SYBRqPCR Master Mix, 1 μL cDNA, 0.2 μL F, 0.2 μL R, 3.6 μL H 2 O, reaction conditions were: 95°C pre-denaturation for 30 sec, 95°C denaturation for 5 sec, 60°C extension for 30 sec, and 40 cycles.

[0137] The binding of CsNPF1 to Bt promoter was verified by EMSA, in which the probe fragment was TTGGATCCCCAATTTGGTGCTATAAATAAAGGGGTA. The synthetic probe primers were pBt-P_Bio forward primer: [Bio]TTGGATCCCCAATTTGGTGCTATAAATAAAGGGGTA, pBt-P_Bio reverse primer: TACCCCTTTATTTATAGCACCAAATTGGGGATCCAA; pBt-P_Cold forward primer: TTGGATCCCCAATTTGGTGCTATAAATAAAGGGGTA, pBt-P_Cold reverse primer: TACCCCTTTATTTATAGCACCAAATTGGGGATCCAA.

[0138] Through the dual luciferase reporter test: first clone the pBt promoter, the forward primer is: GGTGTAGCTTAATCATTCTCCT, the reverse primer is: GATCAGCAACAGAAAGGTG. Then use CsNPF1 as the effector and the Bt promoter as the reporter, co-transform the effector and the reporter into cucumber protoplasts in different combinations (35S:GFP and pBt:LUC; 35S:NPF1 and pBt:LUC) to verify whether CsNPF1 interacts with the cis-acting element on the Bt promoter in vivo. The construction of the dual luciferase vector is as follows: connect the Bt promoter fragment into the pGreenII0800 vector to construct the pBt:LUC reporter factor vector; connect the full-length CDS of the NPF1 gene into the pGreenII62SK vector to construct the 35S:NPF1 effector factor vector.

[0139] Figure 7 The results show that CsNPF1 directly binds to the promoter of the bitterness-related gene Bt in fruit to regulate the synthesis of bitter substances, where a is the bitter substance content of wild-type 10Y and mutant npf1 fruit; b is the bitter substance content of wild-type Cu2 and gene knockout mutant npf1 CR1 Bitterness content of fruit; c is fluorescence quantitative PCR analysis of Bt gene in wild type Cu2 and gene knockout mutant npf1 CR1 and npf1 CR2 d is the enrichment peak diagram of the CsNPF1 core binding motif in the Bt promoter, and the black box indicates the CsNPF1 core binding motif; e is EMSA verification of the binding of CsNPF1 to the Bt promoter; f is a dual luciferase experiment to verify the transcriptional inhibition of CsNPF1 on Bt (the values ​​are shown as mean ± standard deviation; two-tailed t test). The results show that mutant npf1 and gene knockout mutant npf1 CR1 The CuC content in the fruits of the mutant was significantly higher than that of the corresponding wild type 10Y or Cu2( Figure 7 a,b). Fluorescence quantitative PCR analysis showed that compared with the wild type 10Y, the gene knockout mutant npf1 CR1 and npf1 CR2 In the fruits of the mutant, the expression of Bitterfruit (Bt), a key gene controlling the CuC content in cucumber fruit, was significantly upregulated ( Figure 7 c). At the same time, the DAP-seq data also found that there was a binding peak of CsNPF1 in the Bt promoter region ( Figure 7 d). EMSA and dual luciferase assays also verified the above DAP-seq and fluorescence quantitative PCR analysis results ( Figure 7 e,f). The above results indicate that CsNPF1 can directly bind to the Bt promoter sequence and inhibit its expression, thereby reducing the bitterness of the fruit and improving the fruit quality.

[0140] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A cucumber CsNPF1 gene, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the CsNPF1 gene according to claim 1, characterized in that: The amino acid sequence is shown in SEQ ID NO.

2.

3. Use of the CsNPF1 gene according to claim 1 in regulating cucumber parthenocarpy.

4. Use of the CsNPF1 gene according to claim 1 in regulating the bitterness of cucumber fruit.

Images