Vector for modifying protease gene and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a protease gene modified vector and application thereof. The method comprises the following steps: designing a protease SBT6.1 instantaneous silencing fragment, constructing a TRV2: SBT6.1 vector by using a homologous recombination technology, and injecting the TRV2: SBT6.1 vector to a two-week-old Bensi tobacco leaf by using agrobacterium to obtain a plant with high expression quantity of foreign protein. After the protease SBT 6.1 is instantaneously silenced, the expression quantity of the exogenous target protein is obviously increased, the aim of improving a nicotiana benthamiana bioreactor is fulfilled, and the method has important application value in production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a vector for transforming a protease gene and application thereof. Background Art

[0002] Transgenic plant bioreactor refers to a production system that uses plant cells, tissues or whole plants to produce vaccines, antibodies and other medical proteins and other biological preparations through genetic engineering technology. The use of plants as bioreactors to produce medical protein products, diagnostic reagents or functional foods has received widespread attention in the field of biopharmaceuticals and has become a hot topic in today's medical and life science research. Transgenic plants have many advantages in producing pathogen antigens as bioreactors. First, the system has low production costs, simple vaccine production, easy large-scale production, and convenient refrigerated transportation. Secondly, the plant expression system is more similar to animals in the folding and assembly of exogenous proteins, thus having similar biological activity and immunogenicity to animal cell expression products. Third, this protein processing method only uses soil, air and water, which can be said to be green, safe and environmentally friendly, and has more advantages in the context of social energy conservation and emission reduction. Fourth, plants are resistant to gastrointestinal enzymatic digestion, and oral administration methods are simple. Therefore, transgenic plants provide a new strategy for the development of safe and cheap animal or human proteins with very broad application prospects and opportunities.

[0003] Proteases are ubiquitous in all organisms. The plant genome encodes hundreds of proteases, which are widely involved in the growth and development of plants, as well as in the response of plants to environmental or growth stimuli. As foreign substances, exogenous proteins are often targeted by plant proteases, resulting in partial or complete hydrolysis of exogenous proteins, thereby reducing the expression of exogenous proteins. Chinese patent CN202210079560.5 A method for improving the expression level of recombinant proteins in an endosperm bioreactor, using storage gluten protein mutant (LGC-1) hybridization, gene editing (TALEN technology and CripsrCas9) technology to knock out endogenous storage protein genes, reduce endogenous storage protein content, alleviate endoplasmic reticulum stress, and improve the transport efficiency of recombinant proteins in endosperm cells, thereby improving the expression of recombinant proteins in endosperm cells. Chinese patent CN202310033597.9 The application of Trichinella serine protease inhibitors in transgenic plant bioreactors, by providing a soybean plant that effectively expresses Trichinella antigens to achieve the application of Trichinella antigens in transgenic plant bioreactors.

[0004] Nicotiana benthamiana is a commonly used plant bioreactor, mainly used for transient expression of exogenous proteins, and has the advantages of high conversion efficiency and the ability to carry target genes with larger target fragments. Nicotiana benthamiana is also widely used in the fields of vaccine production and drug development. At present, there is no method for knocking out (knocking down) the gene encoding protease in Nicotiana benthamiana by genetic engineering means, thereby increasing the expression amount of exogenous proteins in Nicotiana benthamiana.

[0005] Summary of the invention

[0006] The technical problem to be solved by the present invention is that Nicotiana benthamiana is a commonly used plant bioreactor, which is mainly used for transient expression of exogenous proteins and has the advantages of high conversion efficiency and the ability to carry target genes with larger target fragments. Currently, there is no method for knocking out (knocking down) the gene encoding protease in Nicotiana benthamiana by genetic engineering means to increase the expression amount of exogenous proteins in Nicotiana benthamiana.

[0007] To solve the above problems, the present invention provides a vector for modifying the protease gene, by designing a transient silencing fragment of protease SBT6.1, constructing a TRV2::SBT 6.1 vector using homologous recombination technology, and injecting the TRV2::SBT6.1 vector into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to obtain plants with high expression of exogenous proteins. It was found that after transient silencing of protease SBT6.1, the expression level of the exogenous target protein increased significantly, achieving the purpose of improving the Nicotiana benthamiana bioreactor, and having great application value in production.

[0008] To achieve the above purpose, the present invention is implemented by the following technical means: a protease gene-modified vector, by designing a protease SBT6.1 transient silencing fragment, the sequence of which is shown in SEQ ID NO.1, and constructing a TRV2::SBT 6.1 vector using homologous recombination technology.

[0009] SEQ ID NO.1:

[0010] ACTGAGAGATGATGTCATTAATTCAGGTCTAAGTGTAGTTGTATTTGCTGACTGGTACAATGTGGACACAATGGTAAAAATGAGGTTCTTTGATGACAATACACGTAGCTGGTGGACTCCGGTCACTGGAGGTGCCAATATTCCTGCCTT AAATGATTCTTTTGGCATCCTTTGGGATTGCATTTGGGAATAAAATTCTGAATGGTGATTTTGTCCTCAACGGTGAACAGAGTCGGTATGCATCTGGAGCTGATATTCTGAAGTTCCCAAGAGGTGGATACTTGCACAGCTTCCCCTTCAT.

[0011] Furthermore, the primers used to construct the vector are as follows: SBT6.1

[0012] F:AAGGTTACCGAATTCACTGAGAGATGATGT; SBT6.1

[0013] R:GAGACGGCTGAGCTCCATGAAGGGGAAGCT.

[0014] Furthermore, the method for increasing the expression of exogenous proteins in Nicotiana benthamiana using the above-mentioned vector was to construct plants by injecting the TRV2::SBT 6.1 vector into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to achieve high expression of exogenous proteins.

[0015] The application of the above-mentioned vector in preparing Nicotiana benthamiana with high expression of exogenous protein.

[0016] Furthermore, the amino acid sequence of the knocked-out protease SBT6.1 of the present invention is shown in SEQ ID NO.2.

[0017] SEQ ID NO.2:

[0018]

[0019] Furthermore, the nucleic acid sequence encoding the protease SBT6.1 in Nicotiana benthamiana is shown in SEQ ID NO.3.

[0020] SEQ ID NO.3:

[0021]

[0022] The present invention has the following beneficial effects:

[0023] The present invention is the first to discover that the SBT6.1 protease in Nicotiana benthamiana affects the expression of exogenous target proteins to a certain extent. By designing a transient silencing fragment of the protease SBT6.1, it is confirmed that after it is transiently silenced, the expression level of the exogenous target protein is significantly increased, thereby achieving the purpose of improving the Nicotiana benthamiana bioreactor, and has great application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Green fluorescent protein images of TRV2::SBT6.1 and TRV2::GUS;

[0025] Figure 2 is the relative expression level of the targeted genes of TRV2::SBT6.1 and TRV2::GUS;

[0026] Figure 3 The graph shows the protein expression levels of TRV2::SBT6.1 and TRV2::GUS. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Embodiment 1:

[0029] A protease gene-modified vector is disclosed. A protease SBT6.1 transient silencing fragment is designed by VIGS TOOL, and a TRV2::SBT 6.1 vector is constructed by homologous recombination technology.

[0030] The method for increasing the expression of exogenous proteins in Nicotiana benthamiana using the above-mentioned vector is to design a transient silencing fragment of SBT6.1 and construct a TRV2::SBT6.1 vector using homologous recombination technology; at the same time, a TRV2::GUS vector is constructed as a control. TRV2::SBT6.1 and TRV1 are co-injected into 2-week-old Nicotiana benthamiana leaves using Agrobacterium as the experimental treatment (T), and TRV2::GUS and TRV1 are co-injected as the control (CK). After 15 days, TRBO::GFP Agrobacterium is injected into T and CK respectively, and the leaves are photographed and sampled after 3 days.

[0031] Designing silence segments:

[0032] Design and transient silencing fragments: Based on the sequence of the target gene, a fragment that can silence SBT6.1 was designed using VIGS TOOL.

[0033] Through the VIGS TOOL ( https: / / vigs.solgenomics.net / ), the database selected was Nicotiana benthisiana v1.0.1, the N-MER size was set to 21, the fragment length was set to 300, and the misalignment was set to 0.

[0034] After entering the gene sequence of SBT6.1 into the sequence box and running the analysis, the target gene parameter was set to 1, and a 300bp sequence and a target gene sequence were obtained. The target gene sequence was then aligned with the SBT6.1 sequence to confirm that the 300bp sequence designed by the website could target SBT6.1.

[0035] The obtained 300bp sequence is: ACTGAGAGATGATGTCATTAATTCAGGTCTAAGTGTAGTTGTA TTTGCTGACTGGTACAATGTGGACACAATGGTAAAAATGAGGTTCTTTGATGACAATACACGTAGCTGGTGGACTCCGGTCACTGGAGGTGCCAATATTCCTGCCTTAAATGATCTTTTGGCATCCTT TGGGATTGCATTTGGGAATAAAATTCTGAATGGTGATTTTGTCCTCAACGGTGAACAGAGTCGGTATGCATCTGGAGCTGATATTCTGAAGTTCCCAAGAGGTGGATACTTGCACAGCTTCCCCTTCAT

[0036] Construction of vector:

[0037] Preparation of DNA fragments required for vector construction

[0038] The transient silencing fragments required for vector construction were obtained by PCR, and the restriction sites required for cloning at both ends were introduced by PCR primers. The primers used were as follows: F: AAGGTTACCGAATTCACTGAGAGATGATGT; R: GAGACGCGTGAGCTCCATGAAGGGGAAGCT.

[0039] The amplification of the transient silencing fragment of SBT6.1 was performed by PCR using the cDNA of Nicotiana benthamiana as a template and primers SBT1.9 F / SBT1.9R. PCR was performed using SupRealQ Ultra Hunter SYBR qPCR Master Mix (Q713-02, Nanjing Novozymes) reagent according to the instructions.

[0040] The TRV2 vector was double-digested using restriction sites EcoR1 and Sac1, and the transient silencing fragment was ligated to the TRV2 vector to construct the vector TRV2::SBT6.1.

[0041] After the vector TRV2::SBT6.1 was transformed into competent E. coli (E. coli DH5α), single clones were selected for colony PCR, and positive single clones were selected for testing. After comparison, colonies with correct sequences were selected to extract plasmids.

[0042] After the correct plasmid is transformed into Agrobacterium competent cells (GV3101), single clones are selected for colony PCR, and positive single clones are selected for testing. After comparison, colonies with correct sequences are selected for shaking.

[0043] Agrobacterium TRV2::SBT6.1 and Agrobacterium TRV1 were co-injected into 2-week-old Nicotiana benthamiana leaves at a ratio of 1:1. TRV2::GUS was used as the control. After 15 days, TRBO::GFP Agrobacterium was injected. After 3 days, the leaves were photographed and samples were taken for the next step of testing.

[0044] Detection of GFP green fluorescent protein expression:

[0045] RNA extraction: RNA extraction kit (CW0581M) was used to extract sample RNA according to the instructions of the kit.

[0046] cDNA preparation, using a reverse transcription kit (Novozyme, R333-01) to complete genome cleaning and reverse transcription of RNA, the method is operated according to the instructions in the kit

[0047] The samples were tested by qRT-qPCR, and the expression of genes was detected using a fluorescence quantitative kit (Novozyme, Q711-02). And compared with the control TRV2::GUS. Quantitative primers: Actin (F: CGGAATCCACGAGACTACAT AC; R: GGGAAGCCAAGATAGAGC); SBT6.1 (F: GCCGAGGTGGAGTTGGATTT; R: CGGTTTG AGGAGGTTAGGGG). The method was operated according to the instructions in the kit.

[0048] Prepare 10 ml of protein extraction solution: 500 μl of 1 M Tris HCl (pH: 8.0), 500 μl of 2.5 M Nacl (pH: 8.0), 200 μl of EDTA (pH: 8.0), 1 ml of glycerol, 200 μl of 100 mM PMSF, and 7.6 ml of ddH2O.

[0049] Extract the total protein of the sample, add the same volume of 10 protein extract solution after grinding the sample, place it on ice for 30 minutes, and shake the centrifuge tube up and down every 5 minutes. Set the centrifuge speed to 12000 rpm, temperature 4℃, time 10 minutes. After the protein sample is centrifuged, aspirate the supernatant. Add 5×SDS PAGE protein loading buffer (solarbioP1040) to the supernatant in proportion, and place it in a 95℃ metal bath for 10 minutes. Place the sample at -20℃ for later use.

[0050] A 12.5% ​​PAGE gel was prepared using a PAGE gel rapid preparation kit (Yazyme PG113) according to the instructions in the kit.

[0051] Use the prepared PAGE gel, and dot the samples in 12 into the PAGE gel wells in order. Pour Running Buffer (Yazyme PS120) into the electrophoresis pool, set the voltage to 180V, and set the time to 60min. Stain with Coomassie Brilliant Blue dye, decolorize with water, and observe the bands. Adjust to a consistent amount of protein loading.

[0052] According to the electrophoresis steps, the expression level of GFP green fluorescent protein was detected by Wesernt Blot technology.

[0053] result:

[0054] like Figure 1 As shown in the figure, the brightness of GFP green fluorescent protein on TRV2::SBT6.1 is higher than that of GFP green fluorescent protein on TRV2::GUS. This proves that transient silencing of SBT6.1 increases the expression of GFP green fluorescent protein

[0055] like Figure 2 As shown, compared with TRV2::GUS, the two genes targeted in TRV2::SBT6.1 were significantly down-regulated, demonstrating that the transient silencing vector TRV2::SBT6.1 reduced the expression of the targeted genes.

[0056] like Figure 3 As shown, the expression level of GFP protein in RV2::SBT6.1 was significantly higher than that in TRV2::GUS, which proved that the expression level of exogenous protein GFP can be increased by transiently silencing the gene encoding SBT6.1 protease.

[0057] In summary, SBT6.1 protease in N. benthamiana affects the expression of exogenous target protein to a certain extent. After transient silencing, the expression level of exogenous target protein increased significantly, achieving the purpose of further improving the bioreactor of N. benthamiana.

[0058] Finally, it should be noted that although the above embodiments describe the specific implementation of the present invention, they are not intended to limit the present invention; those skilled in the art should understand that these are only examples, and the scope of protection of the present invention is defined by the appended claims. All modifications or equivalent substitutions should be included in the scope of protection of the present invention. The raw materials in the above embodiments, unless otherwise specified, are commercially available.

Claims

1. A vector modified by protease gene, characterized in that: A transient silencing fragment of protease SBT6.1 was designed, the sequence of which is shown in SEQ ID NO.1, and a TRV2::SBT 6.1 vector was constructed using homologous recombination technology.

2. A method for increasing the expression of exogenous proteins in Nicotiana benthamiana using the vector according to claim 1, characterized in that: The TRV2::SBT 6.1 vector was injected into 2-week-old Nicotiana benthamiana leaves using Agrobacterium to construct plants, achieving high expression of exogenous proteins.

3. The method according to claim 2, characterized in that: The primers used to construct the vector are as follows: SBT6.1 F:AAGGTTACCGAATTCACTGAGAGATGATGT; SBT6.1 R:GAGACGGCTGAGCTCCATGAAGGGGAAGCT.

4. The method according to claim 2, characterized in that: The amino acid sequence of the knocked-out protease SBT6.1 is shown in SEQ ID NO.

2.

5. The method according to claim 2, characterized in that: The nucleic acid sequence encoding protease SBT6.1 is shown in SEQ ID NO.

3.

6. Use of the vector according to claim 1 in preparing Nicotiana benthamiana with high expression of exogenous protein.

Images