Primer group, kit and method for detecting aeromonas hydrophila of micropterus salmoides

Abstract

The invention belongs to the technical field of biology, and provides a primer group, a kit and a method for detecting aeromonas hydrophila of micropterus salmoides. The primer group comprises outer primers F3 and B3, inner primers FIP and BIP, and loop primers LF and LB. The kit comprises a reaction solution, and the reaction solution comprises the primer group. The detection method comprises the step of carrying out LAMP detection by using the kit. The designed LAMP special specific primer group is used for recognizing a plurality of specific areas of the aeromonas hydrophila target gene, and the target gene can be successfully detected by carrying out amplification reaction at a constant temperature through strand displacement DNA polymerase. The detection method disclosed by the invention is strong in specificity, high in sensitivity, convenient and rapid in detection and strong in applicability, and lays a foundation for on-site rapid and accurate detection of micropterus salmoides infected with aeromonas hydrophila.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to a primer set, a kit and a method for detecting Aeromonas hydrophila in largemouth bass. Background Art

[0002] As an important freshwater economic fish in my country, largemouth bass has the advantages of fast growth and strong adaptability, and is suitable for a variety of breeding modes, including pond breeding, cage breeding and water breeding. With the advancement of technology and the accumulation of breeding experience, the breeding area and output of largemouth bass have expanded rapidly in recent years, and its annual growth rate ranks among the top freshwater fish species. With the increase of breeding density, the immunity of fish decreases, and various bacterial diseases occur frequently, which has become a major obstacle to its development.

[0003] Diseases caused by Aeromonas hydrophila are particularly threatening to the health of largemouth bass. Infection with this bacterium can cause symptoms such as ulcers on the fish's body surface, gill rot, and enlarged spleen. In severe cases, it can cause large-scale deaths of fish. Outbreaks of Aeromonas hydrophila are often seasonal and sudden. Once they occur, prevention and control are difficult, causing huge economic losses to farmers. Therefore, how to effectively detect Aeromonas hydrophila has become a key challenge for the healthy development of the largemouth bass industry.

[0004] The detection of Aeromonas hydrophila has traditionally relied on molecular detection techniques such as PCR. Although such techniques are sensitive, their amplification reactions require variable temperature operation. Therefore, the detection equipment is bulky and expensive, and has high requirements for operators. The detection cycle is long, making it difficult to achieve rapid on-site detection. In contrast, isothermal amplification technology not only has a small detection module and low cost, but is also more suitable for on-site use. Although the recombinase polymerase amplification (RPA) method has been used in the detection of Aeromonas hydrophila in species such as sturgeon, RPA has a high cost, low amplification efficiency, and poor specificity.

[0005] Therefore, it is particularly necessary to provide a more efficient, specific and low-cost method for detecting Aeromonas hydrophila in largemouth bass. Summary of the invention

[0006] The present disclosure provides a primer set, a kit and a method for detecting Aeromonas hydrophila of largemouth bass, so as to at least solve the above technical problems existing in the prior art.

[0007] According to a first aspect of the present disclosure, a primer set for detecting Aeromonas hydrophila in largemouth bass is provided, wherein the primer set is used to detect Aeromonas hydrophila in the largemouth bass via loop-mediated isothermal amplification (LAMP); the primer set comprises:

[0008] The outer primer F3 has a nucleic acid sequence as shown in SEQ ID NO: 1: CGCATCCGTCATGATGATGA;

[0009] The outer primer B3, whose nucleic acid sequence is shown in SEQ ID NO:2: CGCAAGAACCAGGCCATAC;

[0010] The inner primer FIP has a nucleic acid sequence as shown in SEQ ID NO:3: GATCACGGCACTGGGCTGTGGTAACGCAGCTTGTCCGG;

[0011] The internal primer BIP has a nucleic acid sequence as shown in SEQ ID NO:4: GCCCACCTCTTGCGAGGAGACGCTCAAGGGCAAGATCC;

[0012] Loop primer LF, whose nucleic acid sequence is shown in SEQ ID NO:5: AGGTCGCGACGAGTACAAC;

[0013] The nucleic acid sequence of the loop primer LB is shown in SEQ ID NO:6: TCATCTTGTCGAAACGGGC CTTC.

[0014] Specifically, when detecting whether Aeromonas hydrophila exists in largemouth bass, LAMP technology quickly amplifies the target sequence by identifying the specific gene sequence of Aeromonas hydrophila. The nucleic acid sequence of the specific gene sequence of Aeromonas hydrophila is shown in SEQ ID NO:7: CGCATCCGTCATGATGATG ATGTTGTGGTAACGCAGCTTGTCCGGGTTGTACTCGTCGCGACCTATGCCACAGCCCAGTGCCGTGATCAGGGTGCCCACCTCTTGCGAGGAGATCATCTTGTCGAAACGGGCCTTCTCCACGTTCAGGATCTTGCCCTTGAGCGGCAGTATGGCCTGGTTCTTGCG. The above primer set is designed based on the specific gene sequence.

[0015] According to a second aspect of the present disclosure, a kit for detecting Aeromonas hydrophila in largemouth bass is provided, wherein the kit is used for detecting Aeromonas hydrophila in the largemouth bass via LAMP; the kit comprises a reaction solution, and the reaction solution comprises the above-mentioned primer set.

[0016] In one embodiment, the reaction solution further comprises a buffer, Bst DNA polymerase, fluorescent dye Evagreen and water.

[0017] In one embodiment, the concentration of each reagent in the reaction solution is as follows: the concentration of the outer primer F3 and the outer primer B3 are both 8-12 μM, the concentration of the inner primer FIP and the inner primer BIP are both 95-105 μM, the concentration of the loop primer LF and the loop primer LB are both 95-105 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 7.5-8.5 U / μL.

[0018] In a preferred embodiment, the concentration of each reagent in the reaction solution is as follows: the concentration of the outer primer F3 and the outer primer B3 are both 10 μM, the concentration of the inner primer FIP and the inner primer BIP are both 100 μM, the concentration of the loop primer LF and the loop primer LB are both 100 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 8 U / μL.

[0019] In a preferred embodiment, the reaction solution is: 0.5 μL outer primer F3, 0.5 μL outer primer B3, 0.4 μL inner primer FIP, 0.4 μL inner primer BIP, 0.2 μL loop primer LF, 0.2 μL loop primer LB, 12.5 μL 2× buffer, 1 μL BstDNA polymerase, 1.25 μL fluorescent dye Eva green, and water is added to make the total system 25 μL.

[0020] According to a third aspect of the present disclosure, a method for detecting Aeromonas hydrophila in largemouth bass is provided, comprising the following steps: performing LAMP detection using the above-mentioned kit.

[0021] In one embodiment, the temperature of the LAMP detection is 60-65°C.

[0022] According to an implementable embodiment of the present disclosure, at least the following beneficial effects are achieved:

[0023] The present invention utilizes a designed LAMP-specific primer set to identify multiple specific regions of the target gene of Aeromonas hydrophila, and performs an amplification reaction at a constant temperature (60-65°C) by a strand displacement DNA polymerase, which can successfully detect the target gene. Compared with traditional PCR, LAMP does not require complex temperature cycles, and only requires a simple constant temperature device to complete the amplification. The accumulation of amplified products can be visually observed by fluorescence or colorimetry, without the need for electrophoresis or other complex subsequent detection methods. It is particularly suitable for on-site detection and large-scale screening applications, and provides an efficient and convenient solution for rapid monitoring of pathogens in aquaculture.

[0024] Currently, there is no dedicated primer combination for LAMP of Aeromonas hydrophila of largemouth bass. The present disclosure lays a foundation for achieving on-site rapid and accurate detection of largemouth bass infected with Aeromonas hydrophila.

[0025] It should be understood that the content described in this section is not intended to identify the key or important features of the embodiments of the present disclosure, nor is it intended to limit the scope of the present disclosure. Other features of the present disclosure will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The above and other objects, features and advantages of the exemplary embodiments of the present disclosure will become readily understood by reading the detailed description below with reference to the accompanying drawings. In the accompanying drawings, several embodiments of the present disclosure are shown in an exemplary and non-limiting manner, in which:

[0027] In the drawings, the same or corresponding reference numerals represent the same or corresponding parts.

[0028] Figure 1 The result graph of loop-mediated isothermal amplification of multiple pathogens in Example 3 of the present disclosure is shown; wherein, NC-negative target; AH-Aeromonas hydrophila; MSRV-largemouth bass rhabdovirus; ISKNV-infectious spleen and kidney necrosis virus; LMBV-largemouth bass iridovirus; DIV1-decapod iridovirus 1; WSSV-white spot syndrome virus; EHP-shrimp hepatoenterocytosis;

[0029] Figure 2 The result diagram of loop-mediated isothermal amplification of templates of different dilution concentrations in Example 4 of the present disclosure is shown; wherein, NC-negative target; the unit of target concentration is copies / μL;

[0030] Figure 3 A graph showing the relationship between the LAMP amplification threshold time and the target concentration in Example 4 of the present disclosure is shown;

[0031] Figure 4 The result of LAMP detection using a portable nucleic acid amplification instrument in Example 5 of the present disclosure is shown; wherein the target concentrations of Tubes A to H are 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 0 (i.e., NC) copies / μL; NC-negative target;

[0032] Figure 5 FIG. 4 shows a visualization result diagram of LAMP performed using a portable nucleic acid amplification instrument in Example 6 of the present disclosure; wherein the concentrations of the amplified products from left to right are 10 7 , 10 6 , 10 5 , 10 4, 10 3 , 10 2 , 10 1 , 0 (i.e. NC) copies / μL; NC-negative amplification product. DETAILED DESCRIPTION

[0033] In order to make the purpose, features, and advantages of the present disclosure more obvious and easy to understand, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the drawings in the embodiments of the present disclosure. Obviously, the described embodiments are only part of the embodiments of the present disclosure, not all of the embodiments. Based on the embodiments in the present disclosure, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present disclosure.

[0034] Example 1

[0035] In this example, a primer set for detecting Aeromonas hydrophila of largemouth bass via LAMP was designed and synthesized.

[0036] According to the gene sequences related to Aeromonas hydrophila published by NCBI (National Center for Biotechnology), the gyrB region of Aeromonas hydrophila (the nucleic acid sequence of the region is shown in SEQ ID NO:7: CGCATCCGTCATGATGATGA TGTTGTGGTAACGCAGCTTGTCCGGGTTGTACTCGTCGCGACCTATGCCACAGCCCAGTGCCGTGATCAGGGTGCCCACCTCTTGCGAGGAGATCATCTTGTCGAAACGGGCCTTCTCCACGTTCAGGATCTTGCCCTTGAGCGGCAGTATGGCCTGGTTCTTGCG) was selected and imported through the software PrimerExplorerV5 to design the LAMP primer set for the pathogen.

[0037] Primer set includes:

[0038] The outer primer F3, whose nucleic acid sequence is shown in SEQ ID NO: 1: CGCATCCGTCATGATGAT GA;

[0039] The outer primer B3, whose nucleic acid sequence is shown in SEQ ID NO:2: CGCAAGAACCAGGCCAT AC;

[0040] The inner primer FIP has a nucleic acid sequence as shown in SEQ ID NO:3: GATCACGGCACTGGGCTGTGGTAACGCAGCTTGTCCGG;

[0041] The internal primer BIP has a nucleic acid sequence as shown in SEQ ID NO:4: GCCCACCTCTTGCGAGGAGACGCTCAAGGGCAAGATCC;

[0042] Loop primer LF, whose nucleic acid sequence is shown in SEQ ID NO:5: AGGTCGCGACGAGTACA AC;

[0043] The nucleic acid sequence of the loop primer LB is shown in SEQ ID NO:6: TCATCTTGTCGAAACGG GCCTTC.

[0044] Example 2

[0045] This embodiment provides a kit for detecting Aeromonas hydrophila of largemouth bass by LAMP to achieve rapid detection of Aeromonas hydrophila. The kit includes a reaction solution, and the reaction solution includes the primer set designed in Example 1.

[0046] The kit specifically includes the following components: 0.5 μL outer primer F3 (10 μM), 0.5 μL outer primer B3 (μM), 0.4 μL inner primer FIP (100 μM), 0.4 μL inner primer BIP (100 μM), 0.2 μL loop primer LF (100 μM), 0.2 μL loop primer LB (100 μM), 12.5 μL 2×Buffer, 1 μL Bst DNA polymerase (8 U / μL), 1.25 μL fluorescent dye Eva green, 2 μL template to be tested, and the remainder is filled with ddH2O to a total system of 25 μL. The kit can be used for rapid isothermal amplification detection of Aeromonas hydrophila.

[0047] Example 3

[0048] In this example, the kit provided in Example 2 was used to perform loop-mediated isothermal amplification on various pathogens to verify the specificity of the kit.

[0049] Plasmid DNA of Aeromonas hydrophila (AH), largemouth bass rhabdovirus (MSRV), infectious spleen and kidney necrosis virus (ISKNV), largemouth bass iridovirus (LMBV), decapod iridovirus 1 (DIV1), white spot syndrome virus (WSSV), and enterohepatocytosis of shrimp (EHP) were used as detection templates, and ddH2O was set as a negative control. Loop-mediated isothermal amplification was performed at 65°C. The results are as follows: Figure 1 shown. Figure 1 It shows that except for Aeromonas hydrophila which has an obvious exponential amplification curve, other templates have no amplification, which indicates that the loop-mediated isothermal amplification primer set and kit provided by the present disclosure have the performance of specific detection of Aeromonas hydrophila and can accurately detect the presence of the pathogen.

[0050] Example 4

[0051] This example tests the sensitivity and repeatability of the kit provided in Example 2.

[0052] Based on the primer set in the kit of Example 2, a recombinant plasmid of Aeromonas hydrophila was prepared. The amplification product of the above primers was prepared into a recombinant plasmid, and the plasmid was gradiently diluted (10 4 , 10 3 , 10 2 , 10 1 The diluted plasmid was used as a template and loop-mediated isothermal amplification was performed using the kit of Example 2 and the corresponding amplification program. A negative control group with ddH2O as the template was set up at the same time. The results are as follows Figure 2 shown. Figure 2 It shows that when the plasmid dilution concentration of the test sample is 10 2 At 100 copies / μL and above, an obvious exponential amplification curve can be observed, and the three replicates of each concentration of the target all showed obvious exponential amplification, while the negative control showed no amplification. In addition, the relationship between the LAMP amplification threshold time and the target concentration was tested, and the results were as follows: Figure 3 As shown. It can be seen that the minimum detection sensitivity of the loop-mediated isothermal amplification system established in the present disclosure for Aeromonas hydrophila can reach 10 2 copies / μL, and the system has good reproducibility.

[0053] Example 5

[0054] This example tests the portability of the kit provided in Example 2.

[0055] The above examples were all performed on a traditional nucleic acid amplification instrument, which is not conducive to on-site detection. Therefore, in this example, the above kit and the corresponding amplification system were tested on a portable nucleic acid amplification instrument. 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 copies / μL), ddH2O was used as negative control, and LAMP was performed on a portable nucleic acid amplification instrument. The results are shown in Figure 4 shown. Figure 4 Display, except G hole (10 1Except for the detection of 100 copies / μL, the others showed obvious exponential amplification, which was consistent with the detection results of traditional nucleic acid amplification instruments. This shows that the kit and the corresponding loop-mediated isothermal amplification system provided by the present disclosure can be used for on-site nucleic acid detection.

[0056] Example 6

[0057] This example tests the degree of visualization of the kit provided in Example 2 when performing LAMP.

[0058] In order to meet the needs of different users, the amplified product of Example 5 was placed in a visual portable nucleic acid amplification instrument for observation. The results are as follows: Figure 5 shown. Figure 5 The positive amplification product (10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 copies / μL) showed obvious green fluorescence under the excitation of 480nm excitation light.

[0059] In summary, the primer set, kit and visual detection method for loop-mediated isothermal amplification for detecting Aeromonas hydrophila provided in the present disclosure have the advantages of strong specificity, high sensitivity, convenient and fast detection, strong applicability, etc.

[0060] It should be understood that the various forms of processes shown above can be used to reorder, add or delete steps. For example, the steps recorded in this disclosure can be executed in parallel, sequentially or in different orders, as long as the desired results of the technical solution of this disclosure can be achieved, and this document is not limited here.

[0061] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the features. In the description of the present disclosure, the meaning of "plurality" is two or more, unless otherwise clearly and specifically defined.

[0062] The above is only a specific embodiment of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any person skilled in the art who is familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed in the present disclosure, which should be included in the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be based on the protection scope of the claims.

Claims

1. A primer set for detecting Aeromonas hydrophila in largemouth bass, characterized in that: The primer set is used to detect Aeromonas hydrophila in the largemouth bass via LAMP; the primer set includes: The outer primer F3 has a nucleic acid sequence as shown in SEQ ID NO: 1: CGCATCCGTCATGATGATGA; The outer primer B3, whose nucleic acid sequence is shown in SEQ ID NO:2: CGCAAGAACCAGGCCATAC; The inner primer FIP has a nucleic acid sequence as shown in SEQ ID NO:3: GATCACGGCACTGGGCTGT GGTAACGCAGCTTGTCCGG; The internal primer BIP has a nucleic acid sequence as shown in SEQ ID NO:4: GCCCACCTCTTGCGAGGAG ACGCTCAAGGGCAAGATCC; Loop primer LF, whose nucleic acid sequence is shown in SEQ ID NO:5: AGGTCGCGACGAGTACAAC; The nucleic acid sequence of the loop primer LB is shown in SEQ ID NO:6: TCATCTTGTCGAAACGGGC CTTC.

2. A kit for detecting Aeromonas hydrophila in largemouth bass, characterized in that: The kit is used for detecting Aeromonas hydrophila in the largemouth bass through LAMP; the kit comprises a reaction solution, and the reaction solution comprises the primer set according to claim 1.

3. The kit according to claim 2, characterized in that: The reaction solution also includes a buffer, Bst DNA polymerase, fluorescent dye Eva green and water.

4. The kit according to claim 3, characterized in that: The concentrations of the reagents in the reaction solution are as follows: the concentrations of the outer primers F3 and B3 are both 8 to 12 μM, the concentrations of the inner primers FIP and BIP are both 95 to 105 μM, the concentrations of the loop primers LF and LB are both 95 to 105 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 7.5 to 8.5 U / μL.

5. The kit according to claim 4, characterized in that: The concentration of each reagent in the reaction solution is as follows: the concentration of the outer primer F3 and the outer primer B3 are both 10 μM, the concentration of the inner primer FIP and the inner primer BIP are both 100 μM, the concentration of the loop primer LF and the loop primer LB are both 100 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 8 U / μL.

6. The kit according to claim 4, characterized in that: The reaction solution comprises: 0.5 μL of outer primer F3, 0.5 μL of outer primer B3, 0.4 μL of inner primer FIP, 0.4 μL of inner primer BIP, 0.2 μL of loop primer LF, 0.2 μL of loop primer LB, 12.5 μL of 2× buffer, 1 μL of Bst DNA polymerase, 1.25 μL of fluorescent dye Eva green, and water is added to make the total system 25 μL.

7. A method for detecting Aeromonas hydrophila in largemouth bass, characterized in that: The following steps are involved: The LAMP detection is performed using the kit according to any one of claims 2 to 6.

8. The method according to claim 7, characterized in that: The temperature of the LAMP detection is 60-65°C.

Images