NR4A1 gene molecular marker related to early body weight gain of sheep and application of NR4A1 gene molecular marker

Abstract

The invention discloses a molecular marker influencing the early weight of sheep as well as a primer and application of the molecular marker. According to the molecular marker capable of influencing the early weight of the sheep, two complete linkage sites of NC056056.1: g.26656G > A and NC056056.1: g.26473C > T of NR4A1 genes of the sheep, and three genotypes of GGCC, AGCT and AATT are shared. The weaning weight of the AGCT type sheep at the age of 45 days and the average daily gain from newborn to weaning are obviously higher than those of GGCC type sheep. The invention relates to a method for screening an early-stage rapid growth sheep variety (line), which comprises the following steps: detecting the G / A polymorphism of a NR4A1NC056056.1: g.26656 site and the C / T polymorphism of a NC056056.1: g.26473 site of sheep, and selecting AGCT type individuals for breeding. The polymorphic site can be used for early auxiliary selection of sheep growth traits, the selection accuracy is improved, and the breeding process is accelerated.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to the application of SNPs molecular markers NC_056056.1: g.26656 G>A and NC_056056.1: g.26473 C>T complete linkage sites in sheep molecular marker-assisted breeding. Technical Background

[0002] NR4A is a subfamily of orphan nuclear receptors (NRs) with no known ligands. Many studies have shown that they can participate in a series of physiological activities without relying on receptors. NR4A1 is expressed in multiple tissues and is widely involved in cell proliferation, differentiation, apoptosis, glucose and lipid metabolism, mediating inflammatory responses, cancer, vascular atherosclerosis and other diseases (Chao, Bensinger et al. 2008).

[0003] NR4A1 plays an important role in the regulation of glucose metabolism (Deng, Chen et al. 2022), affecting the activity of key enzymes in glycolysis, thereby affecting the absorption and utilization of glucose by skeletal muscle. NR4A1 can also regulate lipid metabolism, affecting the proliferation of adipocyte precursors and the ability to synthesize fat; promoting the expression of related proteins in the lipolysis pathway, affecting the decomposition of fat (Chao, Bensinger et al. 2008).

[0004] NR4A1 regulates cell proliferation and apoptosis and can affect cell cycle proteins, cyclin-dependent kinases, and other cell cycle-related genes. NR4A1 translocates from the nucleus to the mitochondria and binds to Bcl-2, converting Bcl-2 into a pro-apoptotic protein, which then induces the release of cytochrome C and apoptosis (Moll, Marchenko et al. 2006).

[0005] Studies have shown that NR4A1 is a candidate gene for pig semen quality. The NR4A1 c.956+796 A>G site mutation is associated with sperm deformity rates in Duroc and Large White pigs, and with sperm motility (MOT) in Large White and Landrace pigs (Zhao, Ma et al. 2019). It is a potential molecular marker for improving boar semen quality. The NR4A1 CDS region and unique intron sequences of pigs were amplified, and the A>G mutation in intron 5 of Large White and Meishan pigs significantly affected litter size (Liu, Li et al. 2011). RNA sequencing found that the NR4A1 gene was significantly differently expressed in the mammary gland of lactating Holstein cows with extremely high and extremely low milk protein and milk fat content. Seven SNP sites were identified that had multiple significant correlations with dairy cow production traits. Among them, one SNP site changed the specific transcription factor binding site in the promoter, thereby regulating the activity of the promoter, and was a potential functional variation for milk traits. Linkage disequilibrium analysis found that a haplotype was significantly correlated with milk production traits (Li, Han et al. 2019).

[0006] Although it has been found that NR4A1 polymorphism in pigs and cattle is related to litter size and milk production performance, there are no reports on the study of NR4A1 gene polymorphism in sheep. Summary of the invention

[0007] The purpose of the present invention is to provide a molecular marker that affects the early body weight gain of sheep in order to improve the accuracy of growth trait selection in sheep breeding and accelerate genetic progress.

[0008] Another object of the present invention is to provide applications of molecular markers.

[0009] Another object of the present invention is to provide a method for screening fast-growing sheep breeds (lines).

[0010] The purpose of the present invention can be achieved through the following technical solutions:

[0011] A molecular marker affecting early body weight of sheep, the molecular marker is a nucleotide sequence cloned from the NC_056056.1:g.26656 and NC_056056.1:g.26473 sites in the 3'UTR region of the sheep NR4A1 gene, wherein the NC_056056.1:g.26656 site has a G / A polymorphism, and the NC_056056.1:g.26473 site has a C / T polymorphism, the two sites are completely linked, and the weaning weight and daily weight gain from birth to weaning of AGCT type sheep are significantly higher than those of GGCC type sheep.

[0012] The molecular marker is preferably a 782bp amplification product obtained by PCR amplifying sheep genomic DNA with the primer pair shown in SEQ ID NO.1 and SEQ ID NO.2, comprising two completely linked sites NC_056056.1:g.26656 G>A and NC_056056.1:g.26473 C>T in the 3'UTR region of the sheep NR4A1 gene, with three genotypes of GGCC, AGCT and AATT, among which the weaning weight and daily weight gain from birth to weaning of AGCT type sheep are significantly higher than those of GGCC type sheep.

[0013] Furthermore, the present application provides a primer pair for detecting the SNPs molecular marker, wherein the upstream primer P1 is shown as SEQ ID NO.1, and the downstream primer P2 is shown as SEQ ID NO.2.

[0014] The primer pair of the present invention is used in sheep breeding, preferably by using the primer pair to PCR amplify the molecular marker of the present invention in the sheep genome, sequencing the amplified product, and interpreting the G / A polymorphism of the NC_056056.1:g.26656 site and the C / T polymorphism of the NC_056056.1:g.26473 site of the sheep NR4A1 gene.

[0015] A method for detecting the molecular markers of the present invention comprises using the primers to PCR amplify the molecular markers in the sheep genome, sequencing the amplified products, and interpreting the G / A polymorphism of the NC_056056.1:g.26656 site and the C / T polymorphism of the NC_056056.1:g.26473 site of the sheep NR4A1 gene.

[0016] A method for screening early fast-growing sheep breeds (lines), detecting the G / A polymorphism of the NC_056056.1:g.26656 site and the C / T polymorphism of the NC_056056.1:g.26473 site of the sheep NR4A1 gene, and selecting AGCT type individuals for seed preservation.

[0017] The method of the present invention preferably comprises the following steps:

[0018] 1) Extracting sheep genomic DNA;

[0019] 2) using the primer pair P1 and P2, PCR amplified the 3'UTR region sequence of the NR4A1 gene to obtain a 782 bp amplification product;

[0020] 3) The 782bp amplified product was sequenced and typed using the primer P2. The NC_056056.1:g.26656 site was divided into GG type, AG type, and AA type; the NC_056056.1:g.26473 site was divided into CC type, CT type, and TT type. There were three completely linked genotypes, GGCC, AGCT, and AATT.

[0021] 4) Select AGCT type individuals for seed preservation.

[0022] Beneficial Effects

[0023] Livestock growth traits are important economic traits and belong to quantitative traits. Traditional phenotypic selection has low accuracy, long cycle, and slow genetic progress. The present invention uses PCR amplification combined with sequencing to detect the G / A polymorphism of the NC_056056.1:g.26656 site of the sheep NR4A1 gene and the C / T polymorphism of the NC_056056.1:g.26473 site, and performs correlation analysis between the genotype and the early weight of the sheep. It is found that the NC_056056.1:g.26656 site of the sheep NR4A1 gene is completely linked to the NC_056056.1:g.26473 site, and the weaning weight and the average daily weight gain from birth to weaning of AGCT sheep are significantly higher than those of GGCC sheep. This site can be used for molecular assisted marking of sheep to improve the accuracy of selection. Selection can be carried out by detecting the genotype of sheep when they are born, which can speed up the breeding process and reduce breeding costs. It has important practical significance for further improving the growth traits of sheep and has important practical value for the breeding of sheep breeds (lines). BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Sequencing map of sheep NR4A1 gene NC_056056.1: g.26656 site

[0025] 1a is GG type, 1b is AG type, and 1c is AA type.

[0026] Figure 2 Sequencing map of sheep NR4A1 gene NC_056056.1: g.26473 site

[0027] 2a is CC type, 2b is CT type, and 2c is TT type. DETAILED DESCRIPTION

[0028] The experimental methods mentioned in the following examples are conventional methods unless otherwise specified. PCR reagents were purchased from Nanjing Novozyme Biotechnology Co., Ltd., and Sanger sequencing was entrusted to Nanjing Qingke Biotechnology Co., Ltd.

[0029] Example 1: Molecular marker selection method for completely linked loci of NC_056056.1: g.26656 G / A and NC_056056.1: g.26473C / T in Hu sheep NR4A1 gene:

[0030] 1. Flock of Sheep

[0031] The 181 Hu sheep samples were uniformly raised and managed by Jiangsu Xilai Original Ecological Agriculture Co., Ltd., with consistent nutrition and management levels. Their weight data were provided by Jiangsu Xilai Original Ecological Agriculture Co., Ltd.

[0032] (II) Methods

[0033] 1. Sample collection

[0034] Ear tissue samples were collected from each individual, placed in dry ice and brought back to the laboratory, where they were stored at -80°C.

[0035] 2. DNA Extraction

[0036] DNA was extracted by conventional phenol and chloroform method, and electrophoresis and OD were measured. 260 / 280 Check DNA quality.

[0037] 3. Amplification of sequences containing NC_056056.1:g.26656 and NC_056056.1:g.26473 sites of NR4A1 gene

[0038] According to the sequence NC_056056.1, a pair of specific primers (sequence P1: CAGCGCATCTTCTACCTCAA (SEQ ID NO.1), P2: GTGGATTCGATTCCTGGTCA (SEQ ID NO.2)) were designed using Primer Premier5 to PCR amplify the sequence of the Hu sheep NR4A1 gene including the NC_056056.1: g.26656 and NC_056056.1: g.26473 sites.

[0039] The total reaction system for PCR amplification is 25 μL, template DNA 15-200 ng, TaqMix 12.5 μL, primers P1 and P2 1 μL (10 μmol) each, and ddH2O is added to 25 μL; the reaction program for the PCR amplification is: pre-denaturation at 97°C for 5 min; denaturation at 97°C for 15 s, annealing at 60°C for 20 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min.

[0040] 4. Sequencing and typing of PCR amplification products. Primer P2 was used to perform Sanger sequencing typing on the 782bp amplification product. There were three linkage genotypes at the NC_056056.1:g.26656 site and the NC_056056.1:g.26473 site, which were divided into GGCC, AGCT and AATT types.

[0041] 5. The significance analysis of the early body weight differences of Hu sheep with different genotypes was conducted using the One-way ANOVA method in SPSS.

[0042] (III) Results and analysis

[0043] 1. Polymorphism of NR4A1 gene NC_056056.1:g.26656 and NC_056056.1:g.26473

[0044] The products of PCR amplification of DNA from 181 Hu sheep samples were sequenced using Sanger sequencing with P2 primer, and three linked genotypes, GGCC, AGCT and AATT, were found.

[0045] 2. Significance analysis of early body weight differences of Hu sheep at different genotypes of NR4A1 gene NC_056056.1:g.26656 and NC_056056.1:g.26473

[0046] One-way ANOVA was used to compare the differences in early body weight among flocks with different genotypes. It was found that the birth weight, weaning weight at 45 days of age, and average daily weight gain from birth to weaning of AGCT-type Hu sheep were higher than those of GGCC and AATT-type Hu sheep. Among them, the differences in weaning weight and average daily weight gain from birth to weaning between AGCT-type and GGCC-type Hu sheep reached a significant level (p < 0.05) (Table 1).

[0047] Table 1 Early body weight of sheep with different genotypes of NR4A1 gene NC_056056.1:g.26656 and NC_056056.1:g.26473

[0048]

[0049] Note: Different lowercase letters in the same column indicate significant differences (p<0.05).

[0050] Comprehensive analysis of the above results shows that AGCT sheep have advantages in early growth. This locus can be used as a molecular marker for the selection of sheep growth traits and AGCT individuals can be selected when keeping breeding stock.

Claims

1. A molecular marker affecting early growth in sheep, characterized by The molecular marker is a nucleotide sequence cloned from sheep genomic DNA and contains two completely linked mutation sites NC_056056.1:g.26656 G>A and NC_056056.1:g.26473C>T in the 3'UTR region of the sheep NR4A1 gene. The AGCT type has higher weaning weight at 45 days of age and average daily weight gain from birth to weaning than the GGCC type.

2. The molecular marker according to claim 1, characterized in that The molecular marker is a 782bp amplification product obtained by PCR amplifying sheep genomic DNA with the primer pair shown in SEQ ID NO.1 and SEQ ID NO.2, which includes the NC_056056.1:g.26656 G>A and NC_056056.1:g.26473 C>T sites in the 3'UTR region of the sheep NR4A1 gene. The AGCT type has higher weaning weight at 45 days of age and average daily weight gain from birth to weaning than the GGCC type.

3. Use of the molecular marker according to claim 1 or 2 in sheep breeding, preferably in screening fast-growing sheep breeds (lines).

4. A primer pair for amplifying the molecular marker described in claim 1, characterized in that As shown in the specification, the upstream primer P1 is SEQ ID NO.1, and the downstream primer P2 is SEQ ID NO.

2.

5. Use of the primer pair according to claim 4 in screening fast-growing sheep breeding.

6. The use according to claim 5, characterized in that The primers described in claim 4 are used to PCR amplify the molecular markers described in claim 1 in the sheep genome, and the amplified products are sequenced to interpret the sheep NR4A1 gene NC_056056.1:g.26656 site G / A polymorphism and NC_056056.1:g.26473 C / T polymorphism.

7. A method for detecting the molecular marker according to claim 1, characterized in that The method comprises using the primers described in claim 4 to PCR amplify the molecular markers described in claim 1 in the sheep genome, sequencing the amplified products, and interpreting the NC_056056.1:g.26656 site G / A polymorphism and NC_056056.1:g.26473 C / T polymorphism of the sheep NR4A1 gene.

8. A method for screening early fast-growing sheep breeds (lines), characterized in that It includes detecting the G / A polymorphism at the NC_056056.1:g.26656 site and the C / T polymorphism at the NC_056056.1:g.26473 site of the sheep NR4A1 gene, and selecting AGCT type individuals for breeding.

9. The method according to claim 8, characterized in that The following steps are involved: 1) Extracting sheep genomic DNA; 2) using the primer pair described in claim 4 to PCR amplify the 3'UTR region sequence of the NR4A1 gene to obtain a 782 bp amplification product; 3) using the primer P2 described in claim 4 to sequence and type the 782 bp amplification product, and dividing it into GGCC type, AGCT type, and AATT type; 4) Select AGCT type individuals for seed preservation.

10. The method according to claim 8, characterized in that The total reaction system of the PCR amplification is 25 μL, template DNA 15-200 ng, Taq Mix 12.5 μL, primers P1 and P2 1 μL (10 μmol) each, and ddH2O is added to 25 μL; the reaction program of the PCR amplification is: pre-denaturation at 97°C for 5 min; denaturation at 97°C for 15 s, annealing at 60°C for 20 s, extension at 72°C for 30 s, 35 cycles, and extension at 72°C for 10 min.

Images