Rennilla luciferase vector and construction method thereof
By designing a Renilla luciferase vector containing the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence, the problem of inaccuracy of experimental results caused by GC-rich motif when detecting SP1 activity is solved, achieving higher experimental rigor and accuracy.
Patent Information
- Application Number
- CN202311123594.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-01
- Publication Date
- 2025-03-04
AI Technical Summary
When detecting SP1 activity, the existing Renilla luciferase vector is susceptible to SP1 regulation because it contains GC-rich motif, resulting in inaccuracy and serious errors in the experimental results.
A Renilla luciferase vector was designed that contained the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence that did not contain GC-rich motif, reducing dependence on SP1 activity.
By using the GAPDH promoter sequence Renilla luciferase vector, it can effectively reduce the interference of SP1 on experimental results, improve the rigor and accuracy of the experiment, significantly surpassing the traditional pRL-TK, pRL-CMV and pRL-SV40 vectors.
Smart Images
Figure CN119552899A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biomedicine, and in particular to a Renilla luciferase vector used for detecting SP1 activity in a luciferase experiment and a construction method thereof. Background Art
[0002] Luciferase reporter assay is the most commonly used method to detect the binding of transcription factors and DNA sequences in the field of molecular cell biology. It can be used to study signal transduction pathways, microRNA targets, protein-to-RNA degradation, protein-protein interactions, drug screening, etc. In the luciferase reporter system, the single luciferase reporter assay uses only one luciferase vector, and the dual luciferase reporter assay uses two luciferases at the same time, which is also the most common reporter gene system. Firefly luciferase is used as a reporter gene for experimental analysis, while Renilla luciferase is used as an internal reference. Its main function is to reduce the impact of human and external factors on experimental data, including human operation errors, cell density differences, cell processing errors, and proliferation differences between wells. In short, the use of Renilla luciferase vectors will make the entire experiment more accurate and rigorous.
[0003] There are three commonly used Renilla luciferase reporter vectors: pRL-TK, pRL-CMV and pRL-SV40, which use the herpes simplex virus thymidine kinase promoter (HSV TK promoter), human cytomegalovirus promoter (CMV promoter) and simian virus 40 promoter (SV40 promoter) as promoter sequences to initiate Renilla luciferase gene expression. Unfortunately, these viral promoters all contain common cis-elements GC-rich motifs, and the transcription factor SP1 can specifically recognize and bind to the GC-rich motif to regulate the expression of the target gene. Therefore, after gene editing or drug treatment changes the expression and activity of SP1, the expression of Renilla luciferase, which is the internal reference of the reporter gene, changes and significantly interferes with the experimental results. At the same time, it was found that the activity of the TK promoter in the commercial pRL-TK Renilla luciferase expression vector was significantly regulated by SP1. When SP1 expression increased, the activity of the TK promoter increased by more than 10 times, and using it as an internal reference vector led to serious errors in the experiment. Similarly, pRL-CMV and pRL-SV40 both had this situation. So far, no Renilla luciferase vector can be used for SP1-related luciferase reporter experiments. Summary of the invention
[0004] In view of this, the object of the present invention is to provide a Renilla luciferase vector and a construction method for detecting SP1 activity in a luciferase experiment.
[0005] To achieve the above purpose, the present invention adopts the technical solution as follows:
[0006] A Renilla luciferase vector, characterized in that the vector contains a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence.
[0007] The selected GAPDH is human GAPDH (known sequence from NCBI, Gene ID: 2597), or GAPDH from other mammals such as rats, mice, etc.; or similar sequence fragments in GAPDH from other species.
[0008] The start site of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence is located at any nucleotide between -490 and -64 (with the transcription start site TSS as the +1 position), or at several nucleotide positions upstream or downstream of the selected fragment; the termination site is located at any nucleotide position between the +1 and +53 sequences, or at several nucleotide positions upstream or downstream of the selected fragment.
[0009] The start site of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence is located at any nucleotide between -214 and -64 (with the transcription start site TSS as the +1 position), or at several nucleotide positions upstream or downstream of the selected fragment; the termination site is located at any nucleotide position between +1 and +53 sequences, or at several nucleotide positions upstream or downstream of the selected fragment.
[0010] The start site of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence is located at any nucleotide between -214 and -64 (with the transcription start site TSS as the +1 position); the termination site is located at any nucleotide position between +1 and +53 sequences.
[0011] The vector skeleton is a transient plasmid or a viral plasmid, and a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter is inserted into the 5' end of a Renilla luciferase encoding gene.
[0012] The vector backbone is pRL, pcDNA or pCMV.
[0013] A method for constructing a Renilla luciferase vector:
[0014] 1) Extracting glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by genomic extraction method;
[0015] 2) using the above fragment as a template, amplifying the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence, and recovering the PCR fragment;
[0016] 3) Using restriction endonucleases to double-digest the recovered PCR fragments and vector backbone, respectively, to remove the original promoter sequence of the Renilla luciferase gene on the vector backbone, and to connect the double-digestion product to the vector backbone using T4 DNA ligase to construct a Renilla luciferase expression vector.
[0017] Further,
[0018] 1) Extracting glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by genomic extraction method;
[0019] 2) Using the above fragment as a template, amplify the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence start site at any nucleotide between -214 and -64 (with the transcription start site TSS as the +1 position), or at several nucleotide positions upstream or downstream of the selected fragment; the termination site is located at any nucleotide position between +1 and +53, or at a base sequence at several nucleotide positions upstream or downstream of the selected fragment, and recover the PCR fragment;
[0020] 3) The recovered PCR fragment and pRL-TK vector backbone were double-digested with restriction endonucleases BglII and NheI, respectively, the original TK promoter and intron on the vector backbone were removed, and the double-digested products were connected with T4 DNA ligase to construct the corresponding vector.
[0021] An application of the Renilla luciferase vector, the application of the vector in gene expression regulation, signal transduction, promoter analysis, receptor function identification, gene therapy and drug screening.
[0022] Application of the vector as an effective internal reference in a luciferase experiment for detecting SP protein expression and activity
[0023] The beneficial effects of the present invention are:
[0024] The present invention finds through truncation experiments that a sequence in the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter has strong transcriptional activity and does not contain a GC-rich motif, so its activity is hardly affected by SP1, while retaining a high sea kidney luciferase activity. In a luciferase experiment for studying SP1 activity, this sequence shows rigor and effectiveness far exceeding those of commercial pRL-TK, pRL-CMV and pRL-SV40 vectors, and is a very potential sea kidney luciferase promoter sequence, and can be further extended for use in more reporter experiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 The present invention provides an embodiment of the present invention providing Renilla luciferase and firefly luciferase analysis results using a luciferase reporter assay; wherein, Figure A is an analysis of changes in firefly luciferase (Firefly) after SP1 expression after adjustment using the real-time fluorescence quantitative PCR result as the internal reference value; Figure B is an analysis of changes in Renilla luciferase (Renilla) after SP1 expression after adjustment using the real-time fluorescence quantitative PCR result as the internal reference value; Figure C is an analysis of changes in firefly luciferase (Firefly) using Renilla luciferase (Renilla) as the internal reference according to a general method, expressed as the ratio of Firefly to Renilla.
[0026] Figure 2 HEK293T cells provided in the embodiment of the present invention were transfected with different Renilla luciferase vectors and N-Myc empty vector or Myc-SP1 vector, and luciferase experiments were performed 48 hours later to analyze the expression of Renilla luciferase. At the same time, genomic DNA was extracted and real-time fluorescence quantitative PCR was performed using specific primers to level the experimental error effect diagram;
[0027] Figure 3 HEK293T cells provided in the embodiment of the present invention were transfected with Renilla luciferase vectors carrying different GAPDH promoter fragments and N-Myc empty vectors or Myc-SP1 vectors. After 48 hours, a luciferase experiment was performed to analyze the expression of Renilla luciferase. At the same time, genomic DNA was extracted and specific primers were used to perform real-time fluorescence quantitative PCR to level the experimental error effect diagram.
[0028] Figure 4 The HEK293T cells provided in the embodiment of the present invention were transfected with different Renilla luciferase vectors, and a luciferase experiment was performed 48 hours later to analyze the expression of Renilla luciferase. At the same time, genomic DNA was extracted and real-time fluorescence quantitative PCR was performed using specific primers to level the experimental error, and the background expression levels of different Renilla luciferase vectors were analyzed.
[0029] Figure 5 The present invention provides the analysis results of Renilla luciferase and firefly luciferase detected by luciferase reporter assay; wherein Figure A is a leveling analysis of firefly luciferase (Firefly) changes after SP1 expression using pRL-GAPDH (-214 / +53) constructed by us as an internal reference; Figure B is a leveling analysis of firefly luciferase (Firefly) changes after SP1 expression using real-time fluorescence quantitative PCR results as internal reference values. DETAILED DESCRIPTION
[0030] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.
[0031] The vectors used in the following examples were purchased from Promega, including pRL-TK No. E2241, pRL-CMV No. E2261, and pRL-SV40 No. E2231.
[0032] Embodiment 1:
[0033] This example takes pRL-GAPDH (-490 / +53) as an example to describe the construction process of the Renilla luciferase vector.
[0034] First, primers with specific restriction sequences were designed to amplify the -490 to +53 fragment of the human GAPDH promoter. The primer sequences are as follows:
[0035] Forward primer 5'-GGGGAGATCTGCCTCGAGGAGAAGTTCCCCAAC-3' (AGATCT is the recognition site of restriction endonuclease BglII),
[0036] The reverse primer is 5′-GGGGAAGCTTCTGGCGACGCAAAAGAAGATGC-3′ (AAGCTT is the recognition site of restriction endonuclease HindIII).
[0037] Using HEK293T genomic DNA as a template, the human GAPDH promoter -490 / +53 fragment was amplified by PCR and recovered.
[0038] Next, the recovered human GAPDH promoter -490 / +53 fragment and pRL-TK vector were double-digested with two endonucleases, BglII and HindIII, and the cut promoter fragment and pRL backbone were recovered after digestion.
[0039] Afterwards, the recovered GAPDH promoter fragment and the pRL backbone were ligated using T4 DNA ligase at 22°C for 2 h, and the ligation product was transformed into an ampicillin plate and incubated inverted at 37°C overnight.
[0040] Finally, single clones were selected for sequencing, and the clones with correct sequencing were selected to extract the plasmid, which was the constructed pRL-GAPDH (-490 / +53) Renilla luciferase vector.
[0041] The construction of other vectors is similar. According to the GAPDH promoter sequence, the corresponding primers are designed to perform PCR, restriction digestion and ligation reactions. For example, to construct the pRL-GAPDH (-64 / +53) Renilla luciferase vector, the primers designed are: forward primer 5'-GGGGAGATCTTCCGAGTCACCGCCTGCCGCC-3', reverse primer 5'-GGGGAAGCTTCTGGCGACGCAAAAGAAGATGC-3'; to construct the pRL-GAPDH (-214 / +53) Renilla luciferase vector, the primers designed are: forward primer 5'-GGGGAGATCTCGCTCGG TGCGTGCCCAGTTG-3', reverse primer 5'-GGGGAAGCTTCTGGCGACGCAAAAGAAGATGC-3'; construct pRL-GAPDH(-35 / +53) Renilla luciferase vector, designed primers: forward primer 5'-GGGGAGATCTGGTTTCTATAAATTGAGCCCGC-3', reverse primer 5'-GGGGAAGCTTCTGGCGACGCAAAAGAAGATGC-3'.
[0042] The construction of pRL-ACTB (-500 / +3) was carried out according to the above method, with the difference that the corresponding primers were designed according to the promoter sequence of human ACTB gene to construct the pRL-ACTB (-500 / +3) Renilla luciferase vector. The primer sequences were: forward primer 5'-GGGGAGATCTACTGCCTGGCCACTCCATGCCC-3', reverse primer 5'-GGGGAAGCTTGGTGGTGGCGCGTCGCGCCGC-3'.
[0043] Example 2 Response of different Renilla luciferase vectors to SP1 transcription factor
[0044] To eliminate transfection errors and human errors, during the luciferase experiment, a counter-well was added to each well during transfection to extract cell DNA (genomic DNA and plasmid DNA transfected into cells), and the relative content of Renilla luciferase plasmid in the cells in the well was analyzed by real-time fluorescence quantitative PCR using Renilla luciferase primers. The sequences of Renilla luciferase primers were qhRLuc-F: TGAATCATGGGATGAATGGCCT; qhRLuc-R: TTGGACGACGAACTTCACCT.
[0045] First, the feasibility of using the commercial Renilla luciferase vector pRL-TK as an internal reference for studying the transcription factor SP1 was tested:
[0046] The commercial firefly luciferase vector is pGL-4×GC. pGL is a firefly luciferase vector. The firefly luciferase gene promoter contains four repeated GC-rich motifs (4×GC) recognized by SP1. When SP1 is expressed, the promoter activity is significantly increased.
[0047] Specifically:
[0048] pGL-4×GC, pRL-TK were co-transfected with blank vector (Ctrl) or SP1 expression vector (SP1), with 6 replicates in each group. After 48 hours of transfection, 3 replicates in each group were subjected to luciferase assay to detect firefly luciferase activity and Renilla luciferase activity. Total cell DNA was extracted from the remaining 3 samples, and real-time fluorescence quantitative PCR (qPCR) was performed using qhRLuc-F and qhRLuc-R as primers to detect the relative content of pRL-TK in cells. The fluorescence changes in each group were analyzed using Renilla luciferase activity and qPCR results as controls.
[0049] Table 1
[0050]
[0051] Depend on Figure 1 As shown in Table 1, the activity of pGL-4×GC increased significantly by 5 times after SP1 expression ( Figure 1 A, Table 1), however, the activity of pRL-TK as an internal reference increased by 13 times ( Figure 1 B), ratio analysis showed that the promoter activity in pGL-4×GC decreased significantly after SP1 expression, which was about 43% of the control group ( Figure 1 C) This serious error comes from the activation of the internal reference pRL-TK by SP1. Similar results were also found in the SP1 study using pRL-CMV and pRL-SV40 as internal references.
[0052] Example 3
[0053] To further analyze whether SP1 has regulatory effects on different promoters, the Renilla luciferase vector with the -490 / +53 fragment of the GAPDH promoter and the Renilla luciferase vector with the -500 / +3 fragment of the human ACTB promoter constructed in Example 1 were selected as candidate sequences to analyze the regulatory effects of transcription factor SP1 on TK promoter, CMV promoter, SV40 promoter, GAPDH promoter and ACTB promoter;
[0054] Specifically:
[0055] pRL-TK (TK), pRL-CMV (CMV), pRL-SV40 (SV40), pRL-GAPDH (-490 / +53) (GAPDH), and pRL-ACTB (-500 / +3) (β-Actin) were co-transfected with blank vector (Ctrl) or SP1 expression vector (SP1), with 6 replicates in each group. After 48 hours of transfection, luciferase assay was performed on 3 replicates in each group to detect the activity of Renilla luciferase. Total cell DNA was extracted from the remaining 3 samples, and real-time fluorescence quantitative PCR (qPCR) was performed using qhRLuc-F and qhRLuc-R as primers to detect the relative content of pRL vectors in cells. The qPCR results were used as a control to analyze the changes in Renilla luciferase in each group.
[0056] The results showed that the activities of these promoters can be regulated by SP1. The TK promoter was the most affected by SP1. The activities of CMV promoter, SV40 promoter and ACTB promoter changed by more than 3 times, while the GAPDH promoter was less affected by SP1 (about 1.8 times) ( Figure 2 ).
[0057] Example 4 Fluorescence intensity analysis of different Renilla luciferase vectors
[0058] Further, the pRL-GAPDH vector containing different truncated GAPDH promoters (-214 / +53, -64 / +53, -35 / +53) constructed in Example 1 was used for transfection and luciferase detection in the above manner. The luciferase activity of the promoter fragments with lengths of -214 / +53, -64 / +53 and -35 / +53 was hardly affected by SP1 and could be used as potential luciferase internal reference vectors ( Figure 3 ).
[0059] Based on the previous results, it can be seen that the background activity of Renilla luciferase in pRL-GAPDH (-214 / +53) and pRL-GAPDH (-64 / +53) is high, while the background activity of luciferase in pRL-GAPDH (-35 / +53) is low, although it is not regulated by SP1 ( Figure 4 ).
[0060] Then, the constructed pRL-GAPDH (-214 / +53) Renilla luciferase vector and qPCR results were used as internal references in the manner described in the above examples to detect the effects of the two in the SP1 luciferase study (Table 2 and Figure 5 ).
[0061] Table 2
[0062]
[0063] From the results, it can be seen that SP1 can activate the pGL vector with GC-Rich motif, but the Renilla luciferase expressed by pRL-GAPDH (-214 / +53) as an internal control has almost no change (Table 2, Figure 5 A), and the results of using pRL-GAPDH (-214 / +53) Renilla luciferase vector as an internal reference were very similar to those using qPCR as an internal reference ( Figure 5 B), indicating that the pRL-GAPDH (-214 / +53) we constructed can be used in the luciferase experiment of SP1 and can well reflect the activation of SP1 on GC-Rich motif.
Claims
1. A Renilla luciferase vector, characterized in that: The vector contains the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence.
2. The Renilla luciferase vector according to claim 1, characterized in that: The start site of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence is located at any nucleotide between -490 and -64 (with the transcription start site TSS as the +1 position), or at several nucleotide positions upstream or downstream of the selected fragment; the termination site is located at any nucleotide position between the +1 and +53 sequences, or at several nucleotide positions upstream or downstream of the selected fragment.
3. The Renilla luciferase vector according to claim 2, characterized in that: The start site of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence is located at any nucleotide between -214 and -64 (with the transcription start site TSS as the +1 position), or at several nucleotide positions upstream or downstream of the selected fragment; the termination site is located at any nucleotide position between +1 and +53 sequences, or at several nucleotide positions upstream or downstream of the selected fragment.
4. The Renilla luciferase vector according to claim 3, characterized in that: The start site of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter sequence is located at any nucleotide between -214 and -64 (with the transcription start site TSS as the +1 position); the termination site is located at any nucleotide position between +1 and +53 sequences.
5. The Renilla luciferase vector according to any one of claims 1 to 3, characterized in that: The vector skeleton is a transient plasmid or a viral plasmid, and a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter is inserted into the 5' end of a Renilla luciferase encoding gene.
6. The Renilla luciferase vector according to claim 5, characterized in that: The vector backbone is pRL, pcDNA or pCMV.
7. A method for constructing the Renilla luciferase vector according to claim 1, characterized in that: 1) Extracting glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by genomic extraction method; 2) using the above fragment as a template, amplifying the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence, and recovering the PCR fragment; 3) Using restriction endonucleases to double-digest the recovered PCR fragments and vector backbone, respectively, to remove the original promoter sequence of the Renilla luciferase gene on the vector backbone, and to connect the double-digestion product to the vector backbone using T4 DNA ligase to construct a Renilla luciferase expression vector.
8. A use of the Renilla luciferase vector according to claim 1, characterized in that: Use of the vector described in claim 1 in gene expression regulation, signal transduction, promoter analysis, receptor function identification, gene therapy and drug screening.
9. The use according to claim 8, characterized in that: The vector is used as an effective internal reference in a luciferase experiment for detecting the expression and activity of SP protein.