System and method for determining influence of GM130 on ovarian cancer cell proliferation through 14-3-3 zeta

Abstract

The invention belongs to the technical field of biomedicine, and discloses a method for determining the influence of GM130 on ovarian cancer cell proliferation through 14-3-3 zeta, the expression relation of GM130 and 14-3-3 zeta in human tissue is observed, then expression of GM130 in ovarian cancer cells is knocked down, expression of 14-3-3 zeta and related protein is explored, and the influence of GM130 on ovarian cancer cell proliferation is determined. The change of gene expression in ovarian cancer cells after down-regulation of GM130 is analyzed through a transcriptome sequencing technology, the influence of GM130 on 14-3-3 zeta and a molecular mechanism are preliminarily explored through bioinformatics analysis, and a potential target spot is found for subsequent diagnosis and treatment of ovarian cancer. In ovarian epithelial malignant tumor tissues, expression of GM130 and 14-3-3 zeta is high and higher than that of normal ovarian tissues, and a positive correlation exists between GM130 and 14-3-3 zeta. The GM130 can influence the cell cycle and proliferation capacity of the ovarian cancer SKOV3 by influencing 14-3-3 zeta, and the mechanism may be that a cycle key factor CDK1 and other proliferation related proteins are influenced.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and in particular relates to a method for determining the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ. Background Art

[0002] The 14-3-3 protein family is common in eukaryotes. It can specifically bind to peptides containing phosphorylated Ser and Thr and participate in a variety of signal transductions. 14-3-3 proteins are also involved in regulating a variety of cellular biological activities, including cell cycle, proliferation, apoptosis, etc. Its abnormal expression is closely related to the occurrence and development of a variety of diseases. 14-3-3ζ is an oncogene that is overexpressed in most tumors and can participate in tumor cell proliferation, cell cycle, apoptosis, migration and invasion. It can regulate multiple cancer signaling pathways and thus affect tumor progression. Targeted therapy of 14-3-3ζ through siRNA can delay tumor development. Increased 14-3-3ζ is also associated with poor prognosis and affects the survival rate of cancer patients.

[0003] Studies have shown that the binding site of YSK1 and GM130 is located at amino acids 75-271, and YSK1 cannot be localized to the Golgi apparatus in cells where GM130 is consumed. This shows that YSK1 binds to a specific domain of the Golgi matrix protein GM130 and shows GM130-dependent localization in cells, thereby localizing to the Golgi apparatus. 14-3-3ζ is a substrate that mediates the action of YSK1. At the same time, the research team previously showed through immunohistochemistry and other experiments that GM130 and 14-3-3ζ are overexpressed in ovarian epithelial malignancies, and their expression levels are positively correlated. Through a protein interaction network query, it was found that GM130 and 14-3-3ζ are connected through the structural protein SPTBN2, but the specific interaction is still unclear.

[0004] The following are some key issues in the prior art:

[0005] 1. Insufficient accuracy: Traditional test environment comparison methods often rely on simplified numerical calculations or manual analysis and lack multi-dimensional data fusion, resulting in insufficient accuracy of the comparison results.

[0006] 2. Insufficient fusion of heterogeneous data: Existing methods do not adequately handle various types of environmental data and fail to efficiently integrate different data resources, affecting the accuracy and comprehensiveness of the comparison.

[0007] 3. Low level of intelligence: Traditional methods rely on manual intervention and experience, lack automated and intelligent environmental comparison, and are unable to process large-scale and complex environmental data.

[0008] 4. Neglect of subtle differences: Traditional methods are unable to fully capture and analyze subtle differences between environments, resulting in insufficient accuracy in equivalence assessments. Summary of the invention

[0009] In view of the problems existing in the prior art, the present invention provides a method for determining the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ.

[0010] The present invention is achieved by a method for determining the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ, comprising:

[0011] Step 1: Use Western blot and RT-PCR techniques to screen out cells with higher GM130 protein and mRNA expression in the SKOV3 / A2780 ovarian cancer cell line for subsequent experiments;

[0012] Step 2: Use fluorescent double staining technology to preliminarily detect the spatial position relationship between GM130 and 14-3-3ζ proteins in SKOV3 cells and confirm the co-localization of the two;

[0013] Step 3: Transfect the designed shRNA plasmid fragment into SKOV3 cells, and screen the best shRNA fragment that successfully knocks down GM130 expression by Western blot and RT-PCR techniques;

[0014] Step 4: Use CCK-8 kit to detect the proliferation of ovarian cancer cells in different groups and evaluate the effect of GM130 on cell proliferation;

[0015] Step 5: Flow cytometry was used to detect the changes in the cell cycle of ovarian cancer cells in different groups and to analyze the regulatory effect of GM130 knockdown on the cell cycle;

[0016] Step 6: Analyze the expression levels of 14-3-3ζ, GRASP65, P115 and proliferation-related proteins in different groups by Western blot to further study the molecular mechanism of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ;

[0017] Among them, the Western blot, RT-PCR, fluorescent double staining, CCK-8, flow cytometry and Western blot detection are all performed on an automated software and hardware equipment platform to ensure data accuracy and high-throughput processing capabilities.

[0018] Furthermore, in step 1, Western blot and RT-PCR techniques are used to screen out cells with higher protein and mRNA expression of GM130 in the SKOV3 / A2780 ovarian cancer cell line, and comparative analysis is performed to ensure that the selected cell line has higher experimental reliability.

[0019] Furthermore, in step 2, the spatial relationship between GM130 and 14-3-3ζ proteins in SKOV3 cells was preliminarily detected using fluorescent double staining technology, and real-time observation and image capture were performed using a fluorescent microscope to ensure the accuracy of the detection results.

[0020] Furthermore, in step 4, the proliferation of ovarian cancer cells in different groups was detected using a CCK-8 kit, the absorbance value (OD value) was measured using a microplate reader, and the differences between different groups were statistically analyzed to further evaluate the effect of GM130 on cell proliferation.

[0021] The present invention also provides a determination system based on the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ, comprising the following modules:

[0022] 1) Cell culture module, used to culture and process SKOV3 / A2780 ovarian cancer cells, and to perform cell growth, fluid replacement, subculture, and cryopreservation operations through temperature-controlled cell culture incubators, culture fluids, pipettes, and other equipment;

[0023] 2) Western blot and RT-PCR detection modules were used to screen cells with higher expression of GM130 protein and mRNA in the SKOV3 / A2780 cell line and conduct subsequent experimental analysis;

[0024] 3) Transfection module, used to design and transfect shRNA plasmid fragments into SKOV3 cells, and screen the best fragments for knocking down GM130 expression by Western blot and RT-PCR;

[0025] 4) Cell proliferation detection module, using CCK-8 kit to detect the proliferation of ovarian cancer cells in different groups after transfection, and measuring the absorbance (OD value) by microplate reader to evaluate the cell proliferation;

[0026] 5) Flow cytometry analysis module, used to detect the cell cycle changes of different groups of ovarian cancer cells and analyze the regulatory effect of GM130 knockdown on the cell cycle;

[0027] 6) Western blot analysis module was used to detect the protein levels of 14-3-3ζ, GRASP65, P115 and proliferation-related proteins, and to further study the molecular mechanism of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ.

[0028] Furthermore, the cell culture module includes equipment such as cell culture bottles, pipettes, clean benches, constant temperature incubators, and waste liquid collection systems. All operations are performed in a sterile environment and are equipped with an automated temperature control and culture medium replacement system to ensure the stability of cell growth conditions.

[0029] Furthermore, the Western blot and RT-PCR detection module includes a Western blot instrument, a gel electrophoresis system, a PCR instrument, a chemiluminescence detection device and related reagents, and all experimental processes are automatically controlled to ensure efficient and accurate protein and gene expression analysis;

[0030] Furthermore, the cell proliferation detection module uses a high-throughput microplate reader, which can support parallel detection of multiple well plates and automatically generate proliferation curves to improve experimental efficiency and accuracy of data analysis;

[0031] Furthermore, the flow cytometry analysis module includes a flow cytometer and a sample pretreatment system, which can automatically analyze the cell cycle distribution of different groups, and provide accurate cell cycle analysis results in combination with data processing software, supporting high-throughput detection of multiple cell analysis parameters. In combination with the above technical solutions and the technical problems solved, please analyze the advantages and positive effects of the technical solutions to be protected by the present invention from the following aspects:

[0032] First, the present invention observes the expression relationship between GM130 and 14-3-3ζ in human tissues, and then explores the expression of 14-3-3ζ and related proteins by knocking down the expression of GM130 in ovarian cancer cells, and analyzes the changes in gene expression in ovarian cancer cells after downregulating GM130 through transcriptome sequencing technology. Through bioinformatics analysis, the effect of GM130 on 14-3-3ζ and its molecular mechanism are preliminarily explored to find potential targets for the diagnosis and treatment of ovarian cancer.

[0033] In ovarian epithelial malignant tumor tissues, the expression of GM130 and 14-3-3ζ is high and higher than that of normal ovarian tissues, and there is a positive correlation between the two. GM130 can affect the cell cycle and proliferation ability of ovarian cancer SKOV3 by affecting 14-3-3ζ, and its mechanism may be to affect the key cycle factor CDK1 and other proliferation-related proteins.

[0034] GM130 is a structural protein on the Golgi apparatus, which can be used to identify the location and morphology of the Golgi apparatus. The disintegration and reorganization of the Golgi apparatus can cause GM130 to be phosphorylated and dephosphorylated. Song et al. verified that the early secretory pathway of cells mainly occurs in the cell body by analyzing the difference in the expression of GM130 in the mouse spinal cord and sciatic nerve. Petrosyan et al. showed that downregulating the expression of GM130 can inhibit the formation of lateral pools of the Golgi apparatus, disrupt the distribution of secretory proteins and Golgi enzymes, and affect the transport and location of glycoproteins. GM130 can also participate in activities such as vesicle binding, cell cycle control, cell signaling, cell polarization and directional cell migration. The PDZ domain of GM130 can recognize the PDZ1 domain of the Golgi stacking protein GRASP65 and form a complex with it. The two are tightly bound under interphase and mitotic conditions.

[0035] Second, the technical solution of the present invention solves several key problems in the prior art in industrial applications and brings about significant technological progress, which is specifically reflected in the following aspects:

[0036] 1. Solved the problem of insufficient accuracy of traditional methods in quantifying the equivalence of test environments

[0037] Traditional test environment comparison methods often rely on simplified numerical calculations or manual analysis, which easily ignore the complex multidimensional data in the environment and their interrelationships, resulting in insufficient accuracy of the comparison results. The test environment equivalence quantification method based on graph similarity measurement proposed in the present invention converts the environment data into a graph data structure, which can more comprehensively process heterogeneous data (such as assets, topology, vulnerabilities, source code defects, etc.), and improves the accuracy of environment comparison through graph similarity calculation methods, overcoming the limitations of traditional methods.

[0038] 2. Achieved efficient integration and analysis of heterogeneous data

[0039] In the prior art, the processing of heterogeneous data usually has the problem of insufficient fusion processing, which makes it impossible to fully utilize various data resources in the environment. By introducing deep learning technologies such as graph convolutional neural network (GCN), Word2Vec and Bert model, the present invention can not only process complex graph data, but also automatically extract and fuse various types of data, improve the accuracy and efficiency of data fusion, and ensure accurate comparison between different environments.

[0040] 3. Improved the intelligent level of quantification of test environment equivalence

[0041] Traditional methods rely on manual analysis and experience-based comparisons, while the present invention achieves automated and intelligent environmental comparisons through deep learning methods, greatly improving the speed and accuracy of the comparison process. Especially when processing large-scale and complex environmental data, intelligent algorithms can be optimized adaptively, reducing the need for manual intervention and improving the intelligence of data processing.

[0042] 4. Provides a more accurate test environment equivalence evaluation method

[0043] Traditional test environment comparisons often ignore subtle differences between environments. The present invention effectively captures subtle differences between environments by combining graph similarity calculation and multi-dimensional environmental data analysis, and can more comprehensively and accurately evaluate the equivalence of different test environments. Especially in some complex environments, it can more accurately reflect the similarity of environments.

[0044] In summary, the present invention has achieved significant technical progress in improving the test environment comparison accuracy, data fusion efficiency and intelligence level through an innovative test environment equivalence quantification method based on graph similarity measurement, overcomes multiple bottlenecks in the prior art, and provides a new solution for the evaluation and optimization of complex test environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 It is a flow chart of the method for determining the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ provided in an embodiment of the present invention.

[0046] Figure 2 It is a system structure diagram of the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ provided by an embodiment of the present invention.

[0047] Figure 3 1 is a graph of protein and mRNA expression of GM130 and 14-3-3ζ in ovarian cancer cells of different malignant degrees provided in an embodiment of the present invention.

[0048] Figure 4 It is a co-localization relationship diagram of GM130 and 14-3-3ζ provided by an embodiment of the present invention.

[0049] Figure 5 The best fragment for knocking down GM130 expression by Western Blot and RT-PCR provided in the embodiment of the present invention, *P<0.0001.

[0050] Figure 6 This is the effect of knocking down GM130 and CCK-8 detection on cell proliferation ability provided by the embodiment of the present invention, *P<0.001.

[0051] Figure 7This is a figure showing cell cycle detection by flow cytometry after GM130 knockdown provided in an embodiment of the present invention, *P<0.001.

[0052] Figure 8 The expression levels of 14-3-3ζ, GRASP65, P115, P21, CDC25A, and CyclinA proteins detected by Western Blot after knocking down GM130 provided in an embodiment of the present invention, P<0.01, *P<0.001. DETAILED DESCRIPTION

[0053] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0054] like Figure 1 As shown, a method for determining the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ provided in an embodiment of the present invention comprises the following steps:

[0055] S101, Western blot and RT-PCR were used to screen cells with higher GM130 protein and mRNA expression in the SKOV3 / A2780 cell line for experiments;

[0056] S102, preliminary detection of the spatial relationship between GM130 and 14-3-3ζ in SKOV3 cells by fluorescent double staining;

[0057] S103, the designed shRNA plasmid fragments were stably transformed into SKOV3, and the best fragment for knocking down GM130 was screened by Western blot and RT-PCR;

[0058] S104, CCK-8 was used to detect the proliferation of ovarian cancer cells in each group;

[0059] S105, flow cytometry was used to detect the changes in the cell cycle of ovarian cancer cells in each group;

[0060] S106, Western blot was used to detect the protein levels of 14-3-3ζ, GRASP65, P115 and proliferation-related proteins in each group.

[0061] The cell experiment method provided in the embodiment of the present invention is as follows:

[0062] (1) Cell culture

[0063] 1) Cell recovery

[0064] ①Put disposable cell culture bottles, pipettes, centrifuge tubes, PBS buffer, DMEM culture medium, film gloves, rubber gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the ultraviolet sterilization for 30 minutes; preheat the 37℃ water bath; thaw the serum culture medium and penicillin-streptomycin double antibody solution to room temperature; after sterilization, turn off the ultraviolet, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks;

[0065] ② Prepare DMEM cell culture medium: 89% pure DMEM + 10% fetal bovine serum + 1% penicillin-streptomycin double antibody, and mark it;

[0066] ③ The cells were frozen in a liquid nitrogen tank, taken out and thawed in a preheated water bath, and after 2 minutes, an equal amount of DMEM was added, and the mixture was transferred to a centrifuge tube, placed in a centrifuge at 1000 rpm, and centrifuged for 3 minutes;

[0067] ④Discard the supernatant, add DMEM to mix the cells thoroughly, transfer to a cell culture bottle, and mark it;

[0068] ⑤ After spraying with alcohol, place in a 5% CO2, 37°C constant temperature sterile cell culture incubator for culture;

[0069] 2) Cell culture medium replacement

[0070] ①Put disposable cell culture bottles, pipettes, PBS buffer, DMEM culture medium, rubber gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the UV sterilizer for 30 minutes; after the sterilization is completed, turn off the UV, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks;

[0071] ②Observe the cell growth under a microscope; spray with alcohol and place in a clean bench;

[0072] ③Discard the original DMEM medium, add PBS buffer, shake the bottle gently and discard the PBS, repeat three times;

[0073] ④ Add DMEM culture medium, spray with alcohol and place in a cell culture incubator for culture;

[0074] 3) Cell passaging

[0075] ①Put disposable cell culture bottles, pipettes, PBS buffer, trypsin digestion solution, DMEM culture medium, gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the ultraviolet sterilization for 30 minutes; after the sterilization is completed, turn off the ultraviolet, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks;

[0076] ②Observe the cell growth under a microscope, and subculture when the cell number reaches 70%-90% of the bottom area of ​​the bottle; spray with alcohol and place in a clean bench;

[0077] ③Discard DMEM, add PBS buffer, shake the bottle gently and discard PBS, repeat three times;

[0078] ④ Add trypsin and digest at room temperature for 3 minutes. Check whether the cells have become round under a microscope, add an equal amount of DMEM to stop digestion, use a pipette to blow off the adherent cells and mix them; transfer the cell suspension to a centrifuge tube, put it into a centrifuge at 1000 rpm, and centrifuge for 3 minutes;

[0079] ⑤Discard the supernatant, add PBS to wash the cells, transfer to a centrifuge tube, and centrifuge at 1000 rpm for 3 minutes;

[0080] ⑥Discard the supernatant, add DMEM, spray with alcohol and place in a cell culture incubator for incubation;

[0081] 4) Cell cryopreservation

[0082] ①Put disposable cell culture bottles, pipettes, PBS buffer, trypsin digestion solution, DMEM culture medium, waste liquid tank, serum, DMSO, cryopreservation tubes, gloves, masks and other experimental reagents and equipment in the clean bench, turn on the ultraviolet sterilization for 30 minutes; after the sterilization is completed, turn off the ultraviolet, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks;

[0083] ② Prepare freezing solution: 90% DMEM pure culture medium + 10% DMSO, mark it (cell freezing solution + time), and store it away from light;

[0084] ③Observe the cell growth under an optical microscope, and freeze when the cell number reaches 70%-90% of the bottom area of ​​the bottle; spray with alcohol and place in a clean bench;

[0085] ④ Wash cells: same as cell passage ③;

[0086] ⑤ Digested cells: same as cells passaged ④ and ⑤;

[0087] ⑥Discard the supernatant, add cell freezing solution and mix well, transfer to freezing tube, seal the tube with sealing film, and mark (cell name + freezing time + personnel);

[0088] ⑦ Place in a 4℃ refrigerator for 30 minutes, a -20℃ refrigerator for 30 minutes, and a -80℃ refrigerator overnight. The next day, transfer to a liquid nitrogen tank for long-term storage.

[0089] 5) Cell seeding plate

[0090] ①Put disposable cell culture bottles, 6-well plates / 96-well plates, pipettes, trypsin digestion solution, DMEM culture medium, PBS buffer, gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the ultraviolet sterilization for 30 minutes; after the sterilization is completed, turn off the ultraviolet, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks;

[0091] ②Observe the growth of cells under a microscope. When the number of cells reaches 70%-90% of the bottom area of ​​the bottle, perform subculture. Spray with alcohol and place in a clean bench.

[0092] ③ Wash cells: same as cell passage ③;

[0093] ④Digested cells: same as cells passaged ④ and ⑤;

[0094] ⑤Discard the supernatant, add DMEM to reselect cells, mix well and pipette 10ul of cell suspension onto a counting plate, and count the number of cells under a microscope;

[0095] ⑥ Seed the plate according to the following conditions: 5×103 cells / well, 100ul / well of culture medium for 96-well plate, 2×104 cells / well, 2ml / well of culture medium for 6-well plate, shake gently to mix thoroughly, spray with alcohol and place in cell culture incubator for culture;

[0096] (2) Cell transfection

[0097] 1) The experimental groups are as follows:

[0098] ①WT group: no fragments were transfected;

[0099] ②NC group: transfected with negative control fragment: GTTCTCCGAACGTGTCACGT;

[0100] ③313 group: transfected with GOLGA2-homo-313 fragment: GGCGGCATCTCAGAATCATGA;

[0101] ④153 group: transfection with GOLGA-homo-153 fragment: GCAGGTAATGGAGTCGGTTAG; ⑤655 group: transfection with GOLGA2-homo-655 fragment: GCAGTTACAGGTTCACATTCA;

[0102] ⑥488 group: transfected with GOLGA-homo-248 fragment: GGTAGAGGAACTGGAACATCG;

[0103] 2) All transfection steps were performed according to the instructions of Lipo6000. The main steps are as follows:

[0104] ① Logarithmically growing SKOV3 cells were seeded into 6-well plates and cultured for 24 hours;

[0105] ② On the second day, when the cell density reaches 70% under microscope, transfection is performed;

[0106] ③Discard the supernatant, wash with PBS three times, and replace the culture medium in the well plate with DMEM containing only 10% serum and no double antibody;

[0107] ④ Take two enzyme-free sterilized EP tubes and prepare the transfection mixture in each well according to the following concentrations: add 125ul of opti-DMEM medium and 5ul of lipofectine6000TM to the first tube, mix well and wait for 5 minutes; add 125ul of opti-DMEM medium and 5ul (500ng / ul) of plasmid DNA to the other tube, mix well and wait for 5 minutes;

[0108] ⑤After 5 minutes, add the solution containing plasmid DNA to the solution containing lipo, mix and wait for 5 minutes;

[0109] ⑥ Add an appropriate amount of the mixed solution to the well plate and shake it gently to mix it thoroughly, then place it in the incubator;

[0110] ⑦ After 6 hours, discard the supernatant in the well plate and replace it with DMEM containing serum and double antibodies to improve transfection efficiency; spray alcohol and place in a cell culture incubator for continued culture;

[0111] ⑧ Check the cell fluorescence under a fluorescence microscope to confirm the success of transfection.

[0112] The CCK-8 provided in the embodiment of the present invention detects the proliferation of ovarian cancer cells in each group:

[0113] (1) The experimental groups were as follows: WT group, NC group, and 313 group;

[0114] (2) SKOV3 cells were inoculated in 96-well plates and cultured for 24 h, with five replicate wells in each group;

[0115] (3) Treat according to the above transfection steps;

[0116] (4) After transfection, add 10ul CCK-8 detection reagent to each well, mix well and keep away from light;

[0117] (5) Place the cells in an incubator and continue culturing for 2 hours. Measure the OD value at 450 nm using an ELISA reader.

[0118] Preliminary detection of fluorescent double staining provided by the embodiment of the present invention:

[0119] (1) SKOV3 cells were seeded in 96-well plates and cultured for 24 hours;

[0120] (2) The next day, remove the waste solution and wash the cells with PBS for 3 minutes, repeating this process three times.

[0121] (3) Add 100 μl of 4°C precooled methanol to each well and wait for 15 minutes at room temperature; remove the waste liquid and wash the cells with PBS for 3 minutes, repeating 3 times;

[0122] (4) Add 100 μl of 0.1% Triton to each well and wait for 30 minutes at room temperature for permeabilization; remove the waste liquid and wash the cells with PBS for 3 minutes. Repeat 3 times;

[0123] (5) Add 100 μl of goat serum to each well and seal the well at 37°C for 30 minutes.

[0124] (6) Remove the goat serum, add 50ul GM130 (1:100) and 14-3-3ζ (1:50) antibodies to each well and incubate overnight in a 4°C refrigerator away from light. The two primary antibodies come from different sources.

[0125] (7) Remove the primary antibody and wash the cells with PBS for 3 minutes. Repeat this process three times.

[0126] (8) Add 50ul of fluorescent secondary antibody, green light (FITC, 1:200) and red light (cy3, 1:400) to each well, and wait for 1 hour at room temperature away from light; aspirate the waste liquid, wash the cells with PBS for 3 minutes, and repeat 3 times;

[0127] (9) Add 50 μl of DAPI nuclear stain to each well and incubate in the dark for 15 minutes; remove the waste liquid and wash the cells with PBS for 3 minutes. Repeat 3 times;

[0128] (10) Observe and collect images under a fluorescence microscope, and analyze and statistically analyze the results using ImageJ.

[0129] Western blot provided by the embodiment of the present invention:

[0130] (1) Total protein extraction:

[0131] ①After transfection and drug addition, discard the supernatant, wash the cells 3 times with PBS, and place them on ice for later use;

[0132] ② Prepare protein lysis buffer (lysis buffer: PMSF = 100:1), add 50ul to each well and place on ice for 30 minutes to completely lyse the cells;

[0133] ③ Scrape the adherent cells and transfer to a 4°C centrifuge; centrifuge at 12,000 rpm for 10 minutes; the supernatant is the total protein, transfer the supernatant to a new EP tube and record the volume;

[0134] (2) Protein concentration determination:

[0135] ① In a 96-well plate, add 0, 1, 2, 4, 8, 12, 16, and 20 μl of the protein standard, respectively. If the amount is less than 20 μl, use 4°C PBS to make up.

[0136] ② Add 4ul of the protein sample to be tested and add PBS to make up to 20ul;

[0137] ③ Prepare BCA working solution (A:B=50:1) according to the instructions, add 200ul BCA to each well, and wait in a 37℃ incubator for 30 minutes;

[0138] ④Measure the OD value with a microplate reader at 570nm, draw a standard curve based on the OD value, and calculate the protein concentration and protein loading amount;

[0139] (3) Protein denaturation:

[0140] ① Add 1 / 4 volume of the protein to be tested in loading buffer, put into boiling water and cook for 5 minutes; ② After cooling naturally to room temperature, put into a -20°C refrigerator to freeze.

[0141] RT-PCR provided by the embodiment of the present invention:

[0142] (1) RNA extraction:

[0143] ① Wash the cells three times with PBS, digest with trypsin, centrifuge and discard the supernatant, and collect the cell pellet in an enzyme-free EP tube;

[0144] ② Add 1 ml RNAisoPlus to the precipitate, shake and mix, and place on ice for 5 minutes; centrifuge at 4°C, 12,000 g, and centrifuge for 5 minutes;

[0145] ③ Collect the supernatant in a new enzyme-free EP tube, add 1 / 5 of the supernatant volume of chloroform, shake and mix, and let stand on ice for 5 minutes; centrifuge at 4℃, speed 12000g, centrifuge for 15 minutes;

[0146] ④ Transfer about 200ul of the top supernatant to a new enzyme-free EP tube (be careful not to aspirate the middle layer);

[0147] ⑤ Add 200ul of isopropanol, shake evenly, and let stand on ice for 10 minutes; centrifuge at 4℃, speed 12000g, centrifuge for 20 minutes;

[0148] ⑥Discard the supernatant, a small amount of white RNA can be seen at the bottom of the tube; add 75% ethanol and wash the precipitate upside down; centrifuge at 4℃, speed 12000g, centrifuge for 5 minutes; repeat 3 times;

[0149] ⑦Discard the supernatant and place the EP tube upside down on filter paper to dry for 30 minutes;

[0150] ⑧Add 20ulDEPC water to mix and dissolve the precipitate, and store in a -80℃ refrigerator;

[0151] (2) Measure RNA concentration:

[0152] ① Clean the nucleic acid concentration meter with 1ul enzyme-free ddH2O, repeat 3 times and then calibrate;

[0153] ②Take 1ul of the RNA to be tested and measure its concentration and purity, repeat 3 times.

[0154] The flow cytometry detection provided by the embodiment of the present invention:

[0155] ① The experimental groups were as follows: WT group, NC group, and 313 group;

[0156] ② Untreated and transfected ovarian cancer cells in logarithmic growth were washed three times with PBS, digested with trypsin, washed three more times with PBS, centrifuged to remove the supernatant, and then 100ul PBS was added to resuspend the cells and 500ul 4℃ 75% alcohol was added to fix the cells, and then placed in a 4℃ refrigerator overnight;

[0157] ③On the next day, the samples were sent to our school’s flow cytometry center for testing.

[0158] like Figure 2 As shown, a system for influencing GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ provided by an embodiment of the present invention includes:

[0159] Screening module, used to screen cells with higher GM130 protein and mRNA expression in SKOV3 / A2780 cell line by Western blot and RT-PCR for experiments;

[0160] Fluorescence detection module, used for preliminary detection of the spatial relationship between GM130 and 14-3-3ζ in SKOV3 cells by fluorescence double staining;

[0161] The transfer module is used to stably transfer the designed shRNA plasmid fragment into SKOV3, and screen the best fragment for knocking down GM130 by Western blot and RT-PCR;

[0162] Proliferation detection module, used for CCK-8 detection of ovarian cancer cell proliferation in each group;

[0163] A cycle detection module is used to detect the changes in the cycle of each group of ovarian cancer cells by flow cytometry;

[0164] The protein level detection module is used for Western blot detection of the protein levels of 14-3-3ζ, GRASP65, P115 and proliferation-related proteins in each group.

[0165] Another object of the present invention is to provide a computer device, comprising a memory and a processor, wherein the memory stores a computer program, and when the computer program is executed by the processor, the processor executes the steps of the method for determining the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ.

[0166] Another object of the present invention is to provide a computer-readable storage medium storing a computer program, which, when executed by a processor, causes the processor to execute the steps of the method for determining the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ.

[0167] Another object of the present invention is to provide an information data processing terminal, which is used to implement the system for the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ. Specific implementation of the present invention: 1. Materials and methods

[0168] 1.1 Materials 1.1.1 Cells

[0169] 1.1.2 Experimental instruments

[0170]

[0171] 1.1.3 Main reagents

[0172]

[0173] 1.2 Methods

[0174] 1.2.1 Cell culture

[0175] (1) Cell recovery

[0176] ①Put disposable cell culture bottles, pipettes, centrifuge tubes, PBS buffer, DMEM culture medium, film gloves, rubber gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the UV sterilizer for 30 minutes. Preheat the 37℃ water bath. Thaw the serum-containing culture medium and penicillin-streptomycin double antibody solution to room temperature. After sterilization, turn off the UV, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks.

[0177] ② Prepare DMEM cell culture medium: 89% pure DMEM + 10% fetal bovine serum + 1% penicillin-streptomycin double antibody, and mark it (culture medium name + time + serum concentration).

[0178] ③ The cells were frozen in a liquid nitrogen tank. After being taken out, they were thawed in a preheated water bath. After 2 minutes, an equal amount of DMEM was added. The mixture was transferred to a centrifuge tube and placed in a centrifuge at 1000 rpm for 3 minutes.

[0179] ④Discard the supernatant, add DMEM to mix the cells thoroughly, transfer to a cell culture bottle, and mark (cell name + time + person).

[0180] ⑤ After spraying with alcohol, place in a sterile cell culture incubator with 5% CO2 and 37℃ constant temperature for culture.

[0181] (2) Cell culture medium replacement

[0182] ①Put disposable cell culture bottles, pipettes, PBS buffer, DMEM culture medium, rubber gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the UV sterilizer for 30 minutes. After the sterilization is completed, turn off the UV, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks.

[0183] ②Observe the cell growth under a microscope and place in a clean bench after spraying with alcohol.

[0184] ③Discard the original DMEM medium, add PBS buffer, shake the bottle gently and then discard the PBS, repeat three times.

[0185] ④ Add DMEM culture medium, spray with alcohol and place in cell culture incubator for culture.

[0186] (3) Cell passaging

[0187] ①Put disposable cell culture bottles, pipettes, PBS buffer, trypsin digestion solution, DMEM culture medium, gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the UV sterilizer for 30 minutes. After the sterilization is completed, turn off the UV, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks.

[0188] ②Observe the cell growth under a microscope, and subculture when the cell number reaches 70%-90% of the bottom area of ​​the bottle. Spray with alcohol and place in a clean bench.

[0189] ③Discard DMEM, add PBS buffer, shake the bottle gently and then discard PBS, repeat three times.

[0190] ④Add trypsin and digest at room temperature for 3 minutes. Check whether the cells have become round under a microscope, add an equal amount of DMEM to stop digestion, use a pipette to blow off the adherent cells and mix them. Transfer the cell suspension to a centrifuge tube and centrifuge it at 1000 rpm for 3 minutes.

[0191] ⑤Discard the supernatant, add PBS to wash the cells, transfer to a centrifuge tube, and centrifuge at 1000 rpm for 3 minutes.

[0192] ⑥Discard the supernatant, add DMEM, spray with alcohol and place in a cell culture incubator for incubation.

[0193] (4) Cell cryopreservation

[0194] ①Put disposable cell culture bottles, pipettes, PBS buffer, trypsin digestion solution, DMEM culture medium, waste liquid tank, serum, DMSO, cryopreservation tubes, gloves, masks and other experimental reagents and equipment in the clean bench, turn on the ultraviolet sterilization for 30 minutes. After the sterilization is completed, turn off the ultraviolet, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks.

[0195] ② Prepare freezing solution: 90% DMEM pure culture medium + 10% DMSO, mark it (cell freezing solution + time), and store it away from light.

[0196] ③Observe the cell growth under an optical microscope, and freeze when the cell count reaches 70%-90% of the bottom area of ​​the bottle. Spray with alcohol and place in a clean bench.

[0197] ④Wash cells: same as cell passaging ③.

[0198] ⑤Digested cells: Same as cells passaged ④ and ⑤.

[0199] ⑥Discard the supernatant, add cell freezing solution and mix well, transfer to freezing tube, seal the tube with sealing film, and mark (cell name + freezing time + person).

[0200] ⑦ Place them in a 4℃ refrigerator and wait for 30 minutes, a -20℃ refrigerator and wait for 30 minutes, and a -80℃ refrigerator and wait overnight. The next day, transfer them to a liquid nitrogen tank for long-term storage.

[0201] (5) Cell seeding plate

[0202] ①Put disposable cell culture bottles, 6-well plates / 96-well plates, pipettes, trypsin digestion solution, DMEM culture medium, PBS buffer, gloves, masks, waste liquid tanks and other experimental reagents and equipment in the clean bench, turn on the UV sterilizer for 30 minutes. After the sterilization is completed, turn off the UV, turn on the fluorescent lamp and exhaust fan, light the alcohol lamp, and put on gloves and masks.

[0203] ②Observe the growth of cells under a microscope, and when the number of cells reaches 70%-90% of the bottom area of ​​the bottle, perform subculture. Spray with alcohol and place in a clean bench.

[0204] ③Wash cells: same as cell passaging③.

[0205] ④Digested cells: Same cells as passages ④ and ⑤.

[0206] ⑤Discard the supernatant, add DMEM to reselect the cells, mix well and pipette 10ul of the cell suspension onto a counting plate, and count the number of cells under a microscope.

[0207] ⑥ Seed the cells in a 96-well plate at 5×103 / well and culture medium at 100ul / well, or in a 6-well plate at 2×104 / well and culture medium at 2ml / well. Gently shake to mix thoroughly, spray with alcohol, and place in a cell culture incubator for culture.

[0208] 1.2.2 Cell transfection

[0209] (1) The experimental groups are as follows (sequence fragments are synthesized by a gene company):

[0210] ①WT group: no fragments were transfected.

[0211] ②NC group: transfected negative control fragment: GTTCTCCGAACGTGTCACGT.

[0212] ③313 group: transfection of GOLGA2-homo-313 fragment: GGCGGCATCTCAGAATCATGA.

[0213] ④153 group: transfection with GOLGA-homo-153 fragment: GCAGGTAATGGAGTCGGTTAG. ⑤655 group: transfection with GOLGA2-homo-655 fragment: GCAGTTACAGGTTCACATTCA.

[0214] ⑥488 group: transfection with GOLGA-homo-248 fragment: GGTAGAGGAACTGGAACATCG.

[0215] (2) All transfection steps were performed according to the instructions of Lipo6000. The main steps are as follows:

[0216] ① Logarithmically growing SKOV3 cells were seeded into 6-well plates and cultured for 24 hours.

[0217] ②On the second day, when the cell density reaches 70% under microscope, transfection is performed.

[0218] ③Discard the supernatant, wash with PBS three times, and replace the culture medium in the well plate with DMEM containing only 10% serum and no double antibody.

[0219] ④ Take two enzyme-free sterilized EP tubes and prepare the transfection mixture in each well according to the following concentrations: add 125ul of opti-DMEM culture medium and 5ul of lipofectine6000TM to the first tube, mix well and wait for 5 minutes; add 125ul of opti-DMEM culture medium and 5ul (500ng / ul) of plasmid DNA to the other tube, mix well and wait for 5 minutes.

[0220] ⑤After 5 minutes, add the solution containing plasmid DNA to the solution containing lipo, mix and wait for 5 minutes.

[0221] ⑥ Add an appropriate amount of mixed solution to the well plate and shake it gently to mix it thoroughly, then place it in the incubator.

[0222] ⑦ After 6 hours, discard the supernatant in the well plate and replace it with DMEM containing serum and double antibody to improve transfection efficiency. Spray alcohol and place in the cell culture incubator for further culture.

[0223] ⑧ Check the cell fluorescence under a fluorescence microscope to confirm the success of transfection.

[0224] 1.2.3 CCK-8 assay for cell proliferation

[0225] (1) The experimental groups were as follows: WT group, NC group, and 313 group.

[0226] (2) SKOV3 cells were inoculated into 96-well plates and cultured for 24 hours, with 5 replicate wells in each group.

[0227] (3) Treat according to the above transfection steps.

[0228] (4) After transfection, add 10ul CCK-8 detection reagent to each well, mix well and keep away from light.

[0229] (5) Place the cells in an incubator and continue culturing for 2 hours. Measure the OD value at 450 nm using an ELISA reader.

[0230] 1.2.4 Cell immunofluorescence double staining

[0231] (1) SKOV3 cells were seeded in 96-well plates and cultured for 24 hours.

[0232] (2) The next day, remove the waste solution and wash the cells with PBS for 3 minutes. Repeat this process three times.

[0233] (3) Add 100ul of 4℃ precooled methanol to each well and wait for 15 minutes at room temperature. Aspirate the waste liquid and wash the cells with PBS for 3 minutes. Repeat 3 times.

[0234] (4) Add 100ul of 0.1% Triton to each well and wait for 30 minutes at room temperature for permeabilization. Aspirate the waste liquid and wash the cells with PBS for 3 minutes. Repeat 3 times.

[0235] (5) Add 100 μl of goat serum to each well, seal the wells at 37°C and wait for 30 minutes.

[0236] (6) Aspirate the goat serum, add 50ul GM130 (1:100) and 14-3-3ζ (1:50) antibodies to each well and incubate overnight in a 4°C refrigerator away from light. The two primary antibodies are from different sources.

[0237] (7) Aspirate the primary antibody and wash the cells with PBS for 3 minutes. Repeat three times.

[0238] (8) Add 50ul of fluorescent secondary antibody, green (FITC, 1:200) and red (cy3, 1:400) to each well, and wait for 1 hour at room temperature away from light. Aspirate the waste liquid, wash the cells with PBS for 3 minutes, and repeat 3 times.

[0239] (9) Add 50 μl of DAPI nuclear stain to each well and incubate in the dark for 15 minutes. Aspirate the waste liquid and wash the cells with PBS for 3 minutes. Repeat 3 times.

[0240] (10) Observe and collect images under a fluorescence microscope, and analyze and statistically analyze the results using ImageJ.

[0241] 1.2.5 Western Blot

[0242] (1) Total protein extraction:

[0243] ①After transfection and drug addition, discard the supernatant, wash the cells 3 times with PBS, and place on ice for later use.

[0244] ② Prepare protein lysis buffer (lysis buffer: PMSF = 100:1), add 50ul to each well and place on ice for 30 minutes to completely lyse the cells.

[0245] ③ Scrape the adherent cells and transfer to a 4°C centrifuge. Centrifuge at 12,000 rpm for 10 minutes. The supernatant is the total protein. Transfer the supernatant to a new EP tube and record the volume.

[0246] (2) Protein concentration determination:

[0247] ①In a 96-well plate, add 0, 1, 2, 4, 8, 12, 16, and 20 μl of the protein standard, respectively. If the volume is less than 20 ul, add 4°C PBS to make up.

[0248] ② Add 4ul of the protein sample to be tested and add PBS to make up to 20ul.

[0249] ③ Prepare BCA working solution (A:B=50:1) according to the instructions, add 200ul BCA to each well, and wait in a 37℃ incubator for 30 minutes.

[0250] ④Measure the OD value with a microplate reader at 570nm, draw a standard curve based on the OD value, and calculate the protein concentration and protein loading amount.

[0251] (3) Protein denaturation:

[0252] ① Add 1 / 4 volume of the protein to be tested in loading buffer, put into boiling water and cook for 5 minutes. ② Cool naturally to room temperature and freeze in a -20°C refrigerator.

[0253] (4) Western Blot:

[0254] ① The preparation ratio of each solution is as follows:

[0255] Electrophoresis buffer: glycine 14.4 g, Tris 3.03 g, SDS 1 g, dilute to 1000 ml with double distilled water, mix thoroughly, and store at room temperature.

[0256] Electrotransfer solution: 14.4 g glycine, 3.03 g Tris, 200 ml methanol, dilute to 1000 ml with double distilled water, mix thoroughly, and store at 4°C.

[0257] TBS: Tris 2.42g, NaCl 8.8g, concentrated hydrochloric acid 1ml, double distilled water to 1000ml, mix well.

[0258] TBST: Tris 2.42 g, NaCl 8.8 g, concentrated hydrochloric acid 1 ml, Tween-20 1 m, double distilled water to 1000 ml, mix well.

[0259] 10% ammonium persulfate solution (AP): 0.1 g AP, 1 ml double distilled water, mix well.

[0260] 5% strip blocking solution: 1g protein powder, 20ml TBST, mix well.

[0261] ②10% SDS-PAGE gel was prepared according to the instructions, the formula is as follows:

[0262]

[0263] ③ Glue preparation: Install the dry glass plate on the rack and use 1ml of anhydrous ethanol to test the airtightness. Add 5ml of prepared separation glue along one side of the glass plate, and then add 1ml of anhydrous ethanol to seal the layer to remove bubbles, and put it in a 65℃ constant temperature box and wait for 8 minutes. Use filter paper to absorb the anhydrous ethanol, add 1ml of concentrated glue, slowly insert a comb to prevent bubbles from forming, and put it in a 65℃ constant temperature box and wait for 5 minutes.

[0264] ④ Loading samples: Install the glass plate and check for leaks, add new electrophoresis liquid to the inner tank so that the electrophoresis liquid covers the sample loading holes, take out the comb vertically, add 4 ml of protein marker, and then add other protein samples to be tested to the remaining holes.

[0265] ⑤ Electrophoresis: Set the constant voltage to 80V and run the gel for 30 minutes. Then set the constant voltage to 110V and run the gel for 60 minutes. It can be seen that the protein has run to the bottom of the lower gel.

[0266] ⑥ Prepare the membrane: 20 minutes before the end of electrophoresis, cut a PVDF membrane of a certain width according to the loading situation, mark the protein name, soak it in methanol for 10 seconds, and then transfer it to the electro-transfer solution for soaking.

[0267] ⑦ Gel cutting: Pry open the glass plate, compare the molecular weight of the marker and the target protein, and cut the gel to a certain width. The gel must not dry during the cutting process. After cutting, place the membrane on the cut gel without bubbles.

[0268] ⑧ Transfer: Fix the PVDF membrane and gel in the order (black sponge, filter paper, gel, membrane, filter paper, black sponge), install them in the electrotransfer tank, and add 4℃ electrotransfer solution. Set the constant current of 250mA to transfer for 150 minutes (maximum molecular weight 130kDa). The whole process generates heat, so a small amount of ice packs should be placed in the transfer box and placed on ice to cool it down.

[0269] ⑨ Blocking: Wash the membrane with TBS for 5 minutes, repeat 3 times. Add milk powder and shake gently on a shaker for 2 hours at room temperature.

[0270] ⑩ Primary antibody incubation: Wash the membrane with TBS for 5 minutes, repeat 3 times. Place the membrane in the corresponding antibodies and incubate overnight at 4°C. Each antibody is matched with the primary antibody diluent: GAPDH (1:5000), GM130 (1:1000), 14-3-3ζ (1:1000), P115 (1:1000), GRASP65 (1:1000), P21 (1:1000), CylinA (1:1000), CDC25A (1:1000).

[0271] Secondary antibody incubation: Wash the membrane with TBST for 10 minutes, repeat 3 times. Then put it into the corresponding secondary antibody solution, shake it gently on a shaker and incubate it for 1 hour. Secondary antibody dilution ratio: anti-rabbit secondary antibody (1:5000), anti-mouse secondary antibody (1:5000), the source of the secondary antibody is the same as the primary antibody, and it is carried out at room temperature.

[0272] Development: Wash the membrane with TBST for 10 minutes, repeat 3 times. Prepare the luminescent solution according to the ratio of A solution to B solution = 1:1 and avoid light. Take out the membrane and dry it with filter paper, add the luminescent solution and put it into the gel imaging instrument for exposure and development.

[0273] Analysis: Semi-quantitative analysis of the band images was performed using ImageLab software, and the grayscale value of the bands was calculated using ImageJ software, as was the ratio of the grayscale value of the target protein to that of the internal reference, i.e., the relative expression level of each protein.

[0274] 1.2.6 RT-PCR

[0275] (1) RNA extraction:

[0276] ① Wash the cells three times with PBS, digest with trypsin, centrifuge and discard the supernatant, and collect the cell pellet in an enzyme-free EP tube.

[0277] ② Add 1 ml RNAisoPlus to the precipitate, shake and mix, and place on ice for 5 minutes. Centrifuge at 4°C, 12,000 g, for 5 minutes.

[0278] ③ Collect the supernatant in a new enzyme-free EP tube, add 1 / 5 of the supernatant volume of chloroform, shake and mix, and place on ice for 5 minutes. Centrifuge at 4℃, 12000g, and centrifuge for 15 minutes.

[0279] ④ Transfer about 200ul of the top supernatant to a new enzyme-free EP tube (be careful not to aspirate the middle layer).

[0280] ⑤ Add 200ul of isopropanol, shake evenly, and place on ice for 10 minutes. Centrifuge at 4℃, 12000g, and centrifuge for 20 minutes.

[0281] ⑥Discard the supernatant, a small amount of white RNA will be seen at the bottom of the tube. Add 75% ethanol and wash the precipitate by inverting it upside down. Centrifuge at 4℃, 12000g, for 5 minutes. Repeat 3 times.

[0282] ⑦Discard the supernatant and place the EP tube upside down on filter paper to dry for 30 minutes.

[0283] ⑧Add 20ulDEPC water to mix and dissolve the precipitate, and store in a -80℃ refrigerator.

[0284] (2) Measure RNA concentration:

[0285] ① Clean the nucleic acid concentration meter with 1ul enzyme-free ddH2O and repeat 3 times before calibration.

[0286] ②Take 1ul of the RNA to be tested and measure its concentration and purity, repeat 3 times.

[0287] (3) Reverse transcription:

[0288] ① Prepare the reverse transcription system according to the instructions (20ul in total):

[0289]

[0290] Wait for 5 minutes at room temperature and prepare the following system. Add and mix after 5 minutes.

[0291]

[0292] ③ Place the reaction system on the PCR instrument and follow the reverse transcription program at 37°C for 15 minutes, 85°C for 5 seconds, and 4°C for 5 minutes. Store in a -20°C refrigerator.

[0293] (4) RT-PCR:

[0294] ① Primer sequences were designed and synthesized by Shanghai Bioengineering Co., Ltd.:

[0295]

[0296] ② Prepare RT-PCR system according to the instructions (10ul in total):

[0297]

[0298] ② Place the reaction system on the RT-PCR instrument and follow the reaction conditions: pre-denaturation at 95°C for 1 minute; denaturation at 95°C for 5 seconds, annealing and extension at 60°C for 30 seconds; and finally reaction at 95°C for 5 seconds and 60°C for 30 seconds.

[0299] 1.2.6 Flow cytometry for cell cycle detection

[0300] ① The experimental groups were as follows: WT group, NC group, and 313 group.

[0301] ② Untreated and transfected ovarian cancer cells in logarithmic growth were washed three times with PBS, digested with trypsin, washed three more times with PBS, centrifuged and the supernatant removed. 100ul PBS was added to resuspend the cells and 500ul 4℃ 75% alcohol was added to fix the cells. The cells were placed in a 4℃ refrigerator overnight.

[0302] ③On the next day, the samples were sent to our school’s flow cytometry center for testing.

[0303] 1.2.7 Statistical analysis

[0304] The results were shown as mean ± standard deviation (x_±s) and analyzed and plotted using SPSS26.0 and GraphPadPrism8. Student's t-test or one-way analysis of variance was used, and P < 0.05 was considered statistically significant.

[0305] 2. Results

[0306] 2.1 Expression of GM130 and 14-3-3ζ in two ovarian cancer cells The expression of GM130 and 14-3-3ζ in SKOV3 cells and A2780 cells was detected by Western Blot and RT-PCR. The results showed ( Figure 3 ), the expression level of GM130 in SKOV3 cells was significantly higher than that in A2780 cells (P<0.05), and there was no significant difference in 14-3-3ζ between SKOV3 cells and A2780 cells (P>0.05). Therefore, SKOV3 cells were selected for subsequent experiments.

[0307] 2.2 Spatial relationship between GM130 and 14-3-3ζ in ovarian cancer SKOV3 Immunofluorescence co-localization staining of GM130 and 14-3-3ζ in SKOV3 cells was performed simultaneously. The results suggest that ( Figure 4 ), GM130 is mainly expressed in the cytoplasm, and the expression level near the nuclear membrane is higher in a stacked manner; 14-3-3ζ is mainly expressed in the cytoplasm, and less in the nucleus. The double staining results show that the two may have a co-localization relationship.

[0308] 2.3 Screening for the best fragment for knocking down GM130 expression

[0309] In order to screen out the best fragment to downregulate GM130 expression, the six designed fragments were transfected into SKOV3 cell line by lipo6000, and the expression of GM130 after transfection was detected by Western Blot and RT-PCR. Figure 5 ), after transfection with 313 group fragments, the down-regulation effect on GM130 was the best.

[0310] 2.4 After knocking down GM130 expression, CCK-8 was used to detect cell proliferation

[0311] CCK-8 results suggest that ( Figure 6 ), the proliferation ability of cells in the plasmid 313 transfection group was significantly reduced (P<0.05), while the proliferation ability of cells in the control group had no significant change (P>0.05), which was not statistically significant.

[0312] 2.5 Flow cytometry analysis of cell cycle after knockdown of GM130 expression

[0313] Streaming result prompt ( Figure 7 ), the number of cells arrested in the G1 phase increased in the plasmid 313 transfection group (P<0.05), the number of cells arrested in the G2 phase decreased significantly (P<0.05), and the number of cells arrested in the S phase decreased (P<0.05), while there was no significant change in the cycle of the control group (P>0.05), which was not statistically significant.

[0314] 2.6 After knocking down GM130 expression, Western Blot was used to detect the expression levels of 14-3-3ζ, GRASP65, P115 and cycle- and proliferation-related proteins. SKOV3 cells were transfected with the 313 fragment, and the proteins were extracted for Western blot detection. The results are as follows. There was no significant difference in the expression of GM130, 14-3-3ζ, P115, and GRASP65 proteins between the blank group (WT) and the control group (NC) (P>0.05). However, the expression of GM130, 14-3-3ζ, P115, and GRASP65 was significantly downregulated in the transfected plasmid group (313), (P<0.05) ( Figure 8 A). To further explore the effect of GM130 on the proliferation of ovarian cancer cells, the expression of proliferation and cycle-related proteins was detected in cells with downregulated GM130. The protein expression of CyclinA and Cdc25A in the 313 group was significantly decreased (P<0.05), and P21 was significantly increased (P<0.05). There was no significant difference between the WT and NC groups (P>0.05) ( Figure 8 B).

[0315] GM130 is a structural protein on the Golgi apparatus, which can be used to identify the location and morphology of the Golgi apparatus. The disintegration and reorganization of the Golgi apparatus can cause GM130 to be phosphorylated and dephosphorylated. Song et al. verified that the early secretory pathway of cells mainly occurs in the cell body by analyzing the difference in the expression of GM130 in the mouse spinal cord and sciatic nerve. Petrosyan et al. showed that downregulating the expression of GM130 can inhibit the formation of lateral pools of the Golgi apparatus, disrupt the distribution of secretory proteins and Golgi enzymes, and affect the transport and localization of glycoproteins. GM130 can also participate in activities such as vesicle binding, cell cycle control, cell signaling, cell polarization and directional cell migration. The PDZ domain of GM130 can recognize the PDZ1 domain of the Golgi stacking protein GRASP65 and form a complex with it. The two are tightly bound under interphase and mitotic conditions. The previous study of the research group found that after silencing GRASP65 in gastric cancer cells, the expression of GM130 was significantly reduced. P115 is a Golgi vesicle transport protein. Studies have shown that downregulating the expression of P115 will cause restricted proliferation and migration of colon cancer cells. Giacomello, E. et al. found that knocking down GM130 or P115 would affect the reorganization of the Golgi complex and the endoplasmic reticulum exit site, thereby inhibiting myotube fusion and the transport of M-cadherin to the sarcolemma. At the same time, GM130 can act as a "binding factor" for vesicles together with P115, giantin and GRASP65, promoting the fusion of vesicles with the Golgi membrane. The research team's previous study on P115 found that the mechanism of P115's promotion of gastric cancer cell growth may be achieved by upregulating the expression of MIF and thus regulating the Erk signal transduction pathway. The results of this part of the experiment show that after knocking down the expression of GM130, the protein expression levels of P115 and GRASP65 also decreased, which is consistent with the expected hypothesis that GM130, P115, and GRASP65 may be a complex structure on the Golgi apparatus. The three can affect other key proteins on the Golgi apparatus through interaction, and then play a role in cell function. However, these speculations need further research to be confirmed.

[0316] 14-3-3ζ has become a key regulator of multiple cellular pathways in various cancers. The gene YWHAZ of 14-3-3ζ is located on chromosome 8 q22.3. When YWHAZ is phosphorylated on Thr-232, the interaction with phosphorylated RAF1 is inhibited, which may affect the cardiofacial skin syndrome by activating the RAF-ERK pathway. The interaction between 14-3-3ζ and TP53 enhances the transcriptional activity of P53, while the phosphorylation of Ser-58 can inhibit this interaction and inhibit the transcriptional activity of P53. At the same time, 14-3-3ζ can stabilize and activate Gli2 to bind to Smads. The complex activates PTHrP and promotes TGF-β, thereby inducing bone metastasis. By querying the protein interaction network, it was found that GM130 and 14-3-3ζ were connected through the structural protein SPTBN2. SPTBN2 is the main component of the cell membrane-cytoskeleton. It can be expressed in small amounts in the Golgi apparatus. It is composed of two α and two β spectrin subunits and participates in vesicle-mediated transport. Current studies have shown that missense expression or mutation of the SPTBN2 sequence can cause cerebellar ataxia in infants and young children. In the earlier Han pedigree of Parkinson's disease, abnormal gene fragments of SPTBN2 were found. Children's attention deficit is related to DNA methylation in LIME1 and SPTBN2 genes. However, there are still few studies on the interaction between GM130 and 14-3-3ζ in cancer through SPTBN2. Therefore, this part of the experiment preliminarily explored the spatial location of GM130 and 14-3-3ζ in ovarian cancer SKOV3 cells. The results of immunofluorescence double staining suggest that the two may have a co-localization relationship. Preisinger's research shows that GM130 binds to and activates the kinase YSK1, causing it to affect cell migration by acting on the substrate 14-3-3ζ. Therefore, it is speculated that GM130 can affect a series of cellular biological functions by affecting 14-3-3ζ. The results showed that in SKOV3 cells that were transfected with shRNA to knock down GM130 expression, 14-3-3ζ expression also decreased significantly, the growth and proliferation of ovarian cancer cells were restricted, the number of cells in the G1 phase of the cell cycle increased significantly, and the number of cells arrested in the G2 and S phases decreased. In the early G1 phase, CyclinD binds to CDK2 / CDK4 to form a complex that can regulate the initiation of the cell cycle; in the G1 / S phase, CyclinE binds to CDK2 to regulate the cells to pass through the R restriction point and enter the S phase; after entering the S phase, CyclinA is expressed, and CyclinD and CyclinE are degraded; in the late S phase and early G2 phase, CyclinA binds to CDK2 to regulate the cells to enter the G2 phase from the S phase; in the G2 / M transition phase, CyclinB binds to CDK1 to promote the cells to enter the M phase, thereby completing a cell cycle.The cell division cycle gene CDC25A is a protein phosphatase that can phosphorylate CDK4 or dephosphorylate CDK6, thereby activating the CyclinD-CDK4 / CDK6 complex. It can also drive the cell cycle from G1 to S phase and regulate the transition of the cell cycle from G1 / S checkpoint to G2 / S checkpoint. P21 is a negative regulator of differentiation and a member of the inhibitor family CIP / KIP. It can inhibit the progression of the cell cycle. P21 binds to the promoter of CDC25A to inhibit its expression. Studies have shown that when DNA is damaged, the inhibition of CDC25A is achieved by upregulating P21 through P53

[22] . From the results of Western Blot, the expression of CyclinA and CDC25A was downregulated, and the expression of P21 was increased. Consistent with the expected conjecture, after knocking down GM130, cells stayed in the G1 phase more, waiting for DNA repair or apoptosis, thereby inhibiting the growth of ovarian cancer cells. In the previous study, the research group compared the basal apoptosis of A2780 and SKOV3 cell lines and found that the apoptosis rate was higher in A2780 cell lines with lower GM130 expression. After reducing the expression of GM130 in SKOV3 cells, it was found that the apoptosis rate of the treated cell lines was higher than that of the untreated cells, and the expression of the pro-apoptotic protein Caspase3 was also increased. It is speculated that the Golgi apparatus is a subcellular organelle corresponding to oxidative stress, and several signaling proteins involved in the apoptotic signaling pathway (tumor necrosis factor receptor TNF-R1, protein kinase PKD, death receptor Fas, PI-3K kinase, etc.) are enriched on the Golgi membrane. When GM130 is downregulated, the corresponding apoptotic signaling proteins on the Golgi are activated. Therefore, it is speculated that downregulating the expression of GM130 will damage the structure of the Golgi apparatus, thereby affecting the expression of downstream 14-3-3ζ and affecting the cycle, proliferation and apoptosis of ovarian cancer cells. The detailed mechanism is what needs to be explored in the next part.

[0317] 1. Specific application fields or related products of the present invention:

[0318] The test environment equivalence quantification method based on graph similarity measurement of the present invention is applicable to multiple industries and fields, especially the following fields:

[0319] 1) Test environment comparison and verification: It can be widely used in aerospace, military equipment, electronic equipment, computer network security and other fields to help R&D personnel verify the equivalence between different test environments and ensure that the simulation environment is consistent with the actual operating environment.

[0320] 2) System security assessment: Applicable to the fields of network security and information security, it helps evaluate the security of the system by quantitatively comparing vulnerabilities, configurations and other security-related features in different environments.

[0321] 3) Smart Manufacturing and Industrial Testing: It can be used for environmental testing in smart manufacturing to help evaluate the differences between the production environment and the standard test environment, thereby optimizing production lines, equipment and product design.

[0322] 4) Environmental monitoring and optimization: It can be used in large-scale intelligent monitoring systems to help evaluate and optimize various configurations in the test environment in real time to ensure the reliability and safety of experiments or operations.

[0323] Related products include but are not limited to intelligent testing equipment, network security monitoring systems, environmental simulation platforms, etc.

[0324] II. Evidence related to the technical effects obtained by the embodiments of the present invention:

[0325] The present invention has achieved remarkable technical effects in realizing the quantification of environmental equivalence, which is specifically reflected in the following aspects:

[0326] 1) Improve comparison accuracy: By combining traditional numerical calculations with graph data structures, it is possible to more comprehensively capture the subtle differences between environments. Multi-dimensional environmental data (such as assets, topology, vulnerabilities, etc.) is more accurately integrated and processed, significantly improving the accuracy of equivalence comparisons.

[0327] 2) Enhanced ability to process heterogeneous data: Through the combination of deep learning technologies such as graph convolutional neural networks (GCN), Word2Vec and BERT, the present invention can effectively process and fuse data from different sources, especially the integration capability of heterogeneous data, significantly improving the fusion effect of multiple environmental data.

[0328] 3) Improved intelligence level: The use of machine learning methods reduces the need for manual intervention and experience-based judgment, realizes automated environmental comparison, greatly improves the intelligence level of the comparison process, and makes large-scale, multi-environment data processing and analysis possible.

[0329] 4) Verification and case support: Through practical application, the implementation of the method of the present invention can be reliably verified in a real environment, especially between a laboratory environment and an actual operating environment, and the equivalence of the two can be accurately evaluated, providing a strong basis for system optimization and adjustment.

[0330] Through the evidence of these technical effects, the present invention provides a more efficient, accurate and intelligent environment comparison and optimization method for the relevant field, solving multiple problems existing in the prior art.

[0331] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A measurement system based on the effect of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ, characterized in that: Includes the following modules: 1) Cell culture module, used to culture and process SKOV3 / A2780 ovarian cancer cells, and to perform cell growth, fluid replacement, subculture, and cryopreservation operations through temperature-controlled cell culture incubators, culture fluids, pipettes, and other equipment; 2) Western blot and RT-PCR detection modules were used to screen out cells with higher expression of GM130 protein and mRNA in the SKOV3 / A2780 cell line and conduct subsequent experimental analysis; 3) Transfection module, used to design and transfect shRNA plasmid fragments into SKOV3 cells, and screen the best fragments for knocking down GM130 expression by Western blot and RT-PCR; 4) Cell proliferation detection module, using CCK-8 kit to detect the proliferation of ovarian cancer cells in different groups after transfection, and measuring the absorbance (OD value) by microplate reader to evaluate the cell proliferation; 5) Flow cytometry analysis module, used to detect the cell cycle changes of different groups of ovarian cancer cells and analyze the regulatory effect of GM130 knockdown on the cell cycle; 6) Western blot analysis module was used to detect the protein levels of 14-3-3ζ, GRASP65, P115 and proliferation-related proteins to further study the molecular mechanism of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ.

2. The measuring system for the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ according to claim 1, characterized in that: The cell culture module includes cell culture bottles, pipettes, clean benches, constant temperature incubators, waste liquid collection systems and other equipment. All operations are performed in a sterile environment and are equipped with automated temperature control and culture medium replacement systems to ensure stable cell growth conditions.

3. The measuring system for the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ according to claim 1, characterized in that: The Western blot and RT-PCR detection module includes a Western blot instrument, a gel electrophoresis system, a PCR instrument, a chemiluminescence detection device and related reagents. All experimental processes are automatically controlled to ensure efficient and accurate protein and gene expression analysis.

4. The measuring system for the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ according to claim 1, characterized in that: The cell proliferation detection module uses a high-throughput microplate reader, can support parallel detection of multiple well plates, and automatically generate proliferation curves to improve experimental efficiency and the accuracy of data analysis.

5. The measuring system for the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ according to claim 1, characterized in that: The flow cytometry analysis module includes a flow cytometer and a sample pretreatment system, which can automatically analyze the cell cycle distribution of different groups, and provide accurate cell cycle analysis results in combination with data processing software, supporting high-throughput detection of multiple cell analysis parameters.

6. A method for determining the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ, characterized in that: The following steps are involved: Step 1: Use Western blot and RT-PCR techniques to screen out cells with higher GM130 protein and mRNA expression in the SKOV3 / A2780 ovarian cancer cell line for subsequent experiments; Step 2: Use fluorescent double staining technology to preliminarily detect the spatial relationship between GM130 and 14-3-3ζ proteins in SKOV3 cells and confirm their co-localization; Step 3: Transfect the designed shRNA plasmid fragment into SKOV3 cells, and screen the best shRNA fragment that successfully knocks down GM130 expression by Western blot and RT-PCR techniques; Step 4: Use CCK-8 kit to detect the proliferation of ovarian cancer cells in different groups and evaluate the effect of GM130 on cell proliferation; Step 5: Flow cytometry was used to detect the changes in the cell cycle of ovarian cancer cells in different groups and to analyze the regulatory effect of GM130 knockdown on the cell cycle; Step 6: Analyze the expression levels of 14-3-3ζ, GRASP65, P115 and proliferation-related proteins in different groups by Western blot to further study the molecular mechanism of GM130 on the proliferation of ovarian cancer cells through 14-3-3ζ; Among them, the Western blot, RT-PCR, fluorescent double staining, CCK-8, flow cytometry and Western blot detection are all performed on an automated software and hardware equipment platform to ensure data accuracy and high-throughput processing capabilities.

7. The method for determining the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ as claimed in claim 1, characterized in that: In step 1, Western blot and RT-PCR techniques are used to screen out cells with higher protein and mRNA expression of GM130 in the SKOV3 / A2780 ovarian cancer cell line, and comparative analysis is performed to ensure that the selected cell line has higher experimental reliability.

8. The method for determining the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ according to claim 6, characterized in that: In step 2, the spatial relationship between GM130 and 14-3-3ζ proteins in SKOV3 cells was preliminarily detected by fluorescent double staining technology, and real-time observation and image capture were performed using a fluorescent microscope to ensure the accuracy of the detection results.

9. The method for determining the effect of GM130 on the proliferation of ovarian cancer cells via 14-3-3ζ according to claim 6, characterized in that: In step 4, the proliferation of ovarian cancer cells in different groups is detected using a CCK-8 kit, the absorbance value (OD value) is measured using an ELISA instrument, and the differences between different groups are statistically analyzed to further evaluate the effect of GM130 on cell proliferation.

Images