HPV16 and HPV18 nucleic acid detection kit based on one-step two-channel RPA-CRISPR

Abstract

The invention provides an HPV16 and HPV18 nucleic acid detection kit based on a one-step two-channel RPA-CRISPR, and belongs to the technical field of cervical cancer detection. The kit for detecting the HPV16 and the HPV18 by the one-step method, provided by the invention, comprises an RPA (recombinase polymerase amplification) reaction reagent, a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas13a detection reagent and a CRISPR / Cas12a detection reagent. The kit disclosed by the invention can be used for simultaneously detecting the HPV16 nucleic acid and the HPV18 nucleic acid on the basis of a one-step two-channel RPA-CRISPR / Cas12a-Cas13a, so that the multi-step transfer operation and the aerosol pollution risk of a two-step CRISPR reaction are effectively avoided, the HPV16 DNA as low as 2.5 copies / L and the HPV18 DNA as low as 5 copies / L can be detected in 30 minutes, and the specificity is good. The sensitivity of the kit for detecting cervix uteri and vagina swab samples is 94.7%, and the specificity is 100%.

Description

Technical Field

[0001] The present invention belongs to the technical field of cervical cancer detection, and specifically relates to a one-step dual-channel RPA-CRISPR-based HPV16 and HPV18 nucleic acid detection kit. Background Art

[0002] Cervical cancer is the fourth most common cancer that threatens women's health. The main cause of cervical cancer is persistent infection with high-risk human papillomavirus (HR-HPV), of which HPV16 and HPV18 are the two most common and most carcinogenic types, causing approximately 50% and 20% of cervical cancer cases, respectively. In 2020, the World Health Organization proposed a global strategy to accelerate the elimination of cervical cancer, aiming to reduce the morbidity and mortality of the disease through vaccination, screening and treatment. Cervical cancer screening is an important stage in achieving this strategic goal. HPV DNA testing is recommended as the main screening method for cervical cancer. At present, routine detection of HPV mainly relies on laboratory methods such as real-time fluorescence quantitative polymerase chain reaction (qPCR) and hybridization capture. Although these methods have high sensitivity and specificity, they require large centralized laboratory facilities and professional technicians to complete the complex analysis process of nucleic acid extraction and fluorescence signal acquisition, and are often time-consuming. Therefore, it is urgent to develop new methods for HPV detection that are simple, fast and low-cost.

[0003] CRISPR / Cas system-based diagnostics (CRISPR-Dx) show great potential in point-of-care testing (POCT). However, the sensitivity of detection that relies solely on CRISPR reactions is often limited, and if target pre-amplification is performed first, the amplification product needs to be transferred, which is easy to cause aerosol contamination and increase the complexity of the operation. However, if the target pre-amplification and CRISPR reaction are combined into a one-step method, the indiscriminate cleavage activity of the Cas protein will inhibit the efficiency of target pre-amplification. Therefore, how to make the one-step detection have high sensitivity and avoid false positives has always been a technical problem that needs to be solved in this field. It is crucial to detect multiple targets simultaneously from a sample, which can provide more accurate and comprehensive information for molecular diagnosis. The development of multiplex CRISPR-Dx is of great significance to improve the detection efficiency, accuracy and clinical applicability of CRISPR-based diagnostics. However, the trans-cleavage of the reporter by the CRISPR-Cas system is non-specific, which makes it difficult to distinguish signals when multiple targets are present. Therefore, multiplex detection is a key bottleneck of CRISPR-Dx. Moreover, when performing multiple CRISPR-Dx, two-step CRISPR reactions are used, which not only increases the operation process and detection time, but also increases the risk of amplification product contamination. However, if multiple CRISPR reactions are performed simultaneously in a system, mutual influence will inevitably occur. Therefore, it is of great significance to establish a one-step multiple CRISPR reaction POCT method for simultaneously detecting multiple targets. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a one-step detection kit for HPV16 and HPV18, which can simultaneously detect two targets, HPV16 and HPV18, from one sample, and can detect as low as 2.5 copies / µL (5 copies per reaction) of HPV16 DNA and 5 copies / µL (10 copies per reaction) of HPV18 DNA in 30 minutes with good specificity.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a one-step kit for detecting HPV16 and HPV18, the kit comprising an RPA reaction reagent, a CRISPR / Cas13a detection reagent and a CRISPR / Cas12a detection reagent; The RPA reaction reagents include HPV16 RPA amplification primers and HPV18 RPA amplification primers; The CRISPR / Cas13a detection reagent includes Cas13a protein, RNA reporter probe and Cas13 crRNA, and the nucleotide sequence of the Cas13 crRNA is shown in SEQ ID No.3; The CRISPR / Cas12a detection reagent includes Cas12a protein, DNA reporter probe and Cas12 crRNA, and the nucleotide sequence of the Cas12 crRNA is shown in SEQ ID No.6.

[0006] Preferably, the nucleotide sequences of the upstream primer and the downstream primer of the HPV16 RPA amplification primer are shown as SEQ ID No.1 and SEQ ID No.2, respectively; the nucleotide sequences of the upstream primer and the downstream primer of the HPV18 RPA amplification primer are shown as SEQ ID No.4 and SEQ ID No.5, respectively.

[0007] Preferably, the RNA reporter probe is composed of poly-U, a fluorescent group and a quencher group; the DNA reporter probe is composed of poly-C, a fluorescent group and a quencher group; the fluorescent group includes FAM, ROX, HEX, CY3 or CY5, and the quencher group includes BHQ1, BHQ2 or BHQ3; the fluorescent group of the RNA reporter probe is different from the fluorescent group of the DNA reporter probe.

[0008] Preferably, the kit further comprises a transcription reagent and an extraction-free virus lysis solution; the transcription reagent comprises T7 RNA polymerase, an RNAse inhibitor and rNTP.

[0009] Preferably, the extraction-free virus lysis solution comprises Chelex-100, Tris, EDTA and DTT.

[0010] Preferably, the RPA reaction reagent further includes an RPA reagent, and the RPA reagent includes RPA lyophilized powder, RPA resuspension and magnesium acetate; the concentration of the magnesium acetate is 5-50 mM.

[0011] Preferably, the concentrations of the raw materials in the kit are: Cas13a protein 12.5-100 nM, Cas12a protein 12.5-100 nM, RNA reporter probe 0.1-4 µM, DNA reporter probe 0.1-4 µM, Cas13 crRNA 10-100 nM, Cas12 crRNA 10-100 nM, HPV16 RPA amplification primer 50-250 nM, HPV18 RPA amplification primer 125-400 nM.

[0012] Preferably, the concentration of the T7 RNA polymerase is 0.05-0.5 U / µL; the concentration of the RNase inhibitor is 0.25-2 U / µL; and the concentration of the rNTP is 0.25-2 mM.

[0013] Preferably, the concentration of Chelex-100 is 2.5 g / 100 mL-40 g / 100 mL; the concentration of Tris is 1-100 mM; the concentration of EDTA is 0.1-10 mM; and the concentration of DTT is 10-200 mM.

[0014] Preferably, the mean of the fluorescence intensity value of the negative control ddH2O and the sum of three times the standard deviation are used as a benchmark. If the fluorescence intensity value of the sample group to be tested is higher than the benchmark, it is determined that the sample to be tested contains HPV16 and / or HPV18.

[0015] Beneficial effects of the present invention: The present invention provides a constant temperature detection kit and method for simultaneously detecting HPV16 and HPV18 nucleic acids based on one-step dual-channel RPA-CRISPR / Cas12a-Cas13a, which effectively avoids the multi-step transfer operation and aerosol contamination risk of the two-step CRISPR reaction, and can detect HPV16 DNA as low as 2.5 copies / µL (5 copies per reaction) and HPV18 DNA as low as 5 copies / µL (10 copies per reaction) in 30 minutes. In the specificity verification, there is no cross reaction with other high-risk HPV subtypes (including HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV66 and HPV68), and the specificity is good. The detection sensitivity of the kit provided by the present invention for clinical cervical vaginal swab samples is 94.7%, and the specificity is 100%. The present invention can achieve the purpose of more simple, rapid, highly sensitive and simultaneous detection of HPV16 and HPV18, meeting the application requirements of on-site instant detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Results of HPV16 RPA amplification primers and crRNA screening; Figure 2 Results of HPV18 RPA amplification primers and crRNA screening; Figure 3 Optimize the primer concentration for RPA amplification; Figure 4 Results for T7 RNA polymerase concentration optimization; Figure 5 Optimize the results for rNTP mixture concentration; Figure 6Optimize results for RNase inhibitor concentration; Figure 7 Optimization results for LbCas12a protein concentration; Figure 8 Optimization results for LwaCas13a protein concentration; Fig. 9 Optimization results for Cas12 crRNA concentration; Fig.10 Optimization results for Cas12 crRNA concentration; Fig.11 is the sensitivity test result, where a and c are the sensitivity test results for HPV16, and b and d are the sensitivity test results for HPV18; Fig.12 The end point fluorescence result of the detection of the sample with the detection limit concentration of the kit of the present invention; Fig.13 is the specific test result; Fig.14 The end point fluorescence result of the clinical sample detection of the kit of the present invention; Fig.15 is the ROC curve of clinical sample detection of the kit of the present invention, wherein a is the ROC curve of HPV16, and b is the ROC curve of HPV18; Fig.16 It is a comparison of the results of clinical sample detection by the kit of the present invention and qPCR, wherein the horizontal axis is the Ct value of the qPCR detection result, and the vertical axis is the endpoint fluorescence signal intensity detected by the kit of the present invention. DETAILED DESCRIPTION

[0017] The present invention provides a one-step kit for detecting HPV16 and HPV18, the kit comprising an RPA reaction reagent, a CRISPR / Cas13a detection reagent and a CRISPR / Cas12a detection reagent; The RPA reaction reagents include HPV16 RPA amplification primers and HPV18 RPA amplification primers; The CRISPR / Cas13a detection reagent includes Cas13a protein, RNA reporter probe and Cas13 crRNA, and the nucleotide sequence of the Cas13 crRNA is shown in SEQ ID No.3; The CRISPR / Cas12a detection reagent includes Cas12a protein, DNA reporter probe and Cas12 crRNA, and the nucleotide sequence of the Cas12 crRNA is shown in SEQ ID No.6.

[0018] The present invention designs and synthesizes RPA amplification primers and crRNA for HPV16 and HPV18 L1 genes. The CRISPR / Cas13a detection reagent of the present invention is used for the detection of the HPV16 target gene, and the CRISPR / Cas12a detection reagent is used for the detection of the HPV18 target gene.

[0019] The upstream primer sequence of the HPV16 RPA amplification primer is preferably 5'-CTGTCCCAGTATCTAAGGTTGTAAGCACGG-3' (SEQ ID No. 1), and the upstream primer sequence with a T7 promoter sequence is 5'-cctctaatacgactcactatagggCTGTCCCAGTATCTAAGGTTGTAAGCACGG-3', wherein positions 1-24 are the T7 promoter sequence for specific binding to RNA polymerase; positions 25-54 are the upstream primer sequence for amplifying the specific L1 gene fragment of HPV16, which is used to specifically amplify the HPV16 specific DNA fragment; the downstream primer sequence of the HPV16 RPA amplification primer is: 5'-GTATCTGGATTATAAAATGAGGTGTCAGGA-3' (SEQ ID No. 2), wherein positions 1-30 are the downstream primer sequence for amplifying the specific L1 gene fragment of HPV16, which is used to specifically amplify the HPV16 specific DNA fragment. The crRNA sequence designed for the HPV16L1 gene is as follows: 5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACTAGGAAAATAGGGATGTCCAACTGCAAG -3' (SEQ ID No. 3), wherein positions 1-36 are the structural sequence of crRNA that binds to the Cas13a protein, and positions 37-64 are the guide sequence that targets the HPV16-specific DNA fragment.

[0020] The sequences of the RPA upstream primer and RPA downstream primer designed for the HPV18 L1 gene are as follows: RPA upstream primer: 5'-CCCTGCTATTGGGGAACACTGGGCTAAAG-3' (SEQ ID No. 4); RPA downstream primer: 5'-CTACCATATCACCATCTTCCAAAACTGTGT-3' (SEQ ID No. 5).

[0021] The crRNA sequence designed for the HPV18 L1 gene is as follows: 5'-UAAUUUCUACUAAGUGUAGAUTAAATCGCGTCCTTTATCAC-3' (SEQ ID No. 6), positions 1-21 are the structural sequence of crRNA that binds to Cas12a protein, and positions 22-41 are the guide sequence that targets HPV18-specific DNA fragments.

[0022] In the present invention, the Cas13 crRNA and Cas12 crRNA can be prepared by in vitro transcription or directly chemically synthesized.

[0023] In the present invention, the RPA reaction reagent is a component for DNA amplification, including an RPA reagent and an amplification primer pair. DNA isothermal amplification can be achieved by mixing the template DNA, the corresponding amplification primer pair and the RPA reagent. In the present invention, the RPA reagent preferably includes RPA lyophilized powder, RPA resuspension and magnesium acetate. In the present invention, the concentration of the magnesium acetate is preferably 5-50 mM, more preferably 10-40 mM, and further preferably 14-30 mM.

[0024] In the present invention, the RNA reporter probe is preferably composed of poly U, a fluorescent group and a quencher group; the DNA reporter probe is preferably composed of poly C, a fluorescent group and a quencher group; the fluorescent group includes FAM, ROX, HEX, CY3 or CY5, and the quencher group includes BHQ1, BHQ2 or BHQ3; the fluorescent group of the RNA reporter probe is different from the fluorescent group of the DNA reporter probe. The poly U is preferably UUUUU or UUUUUU, and the poly C is preferably CCCCCC or CCCCCCC. The present invention does not specifically limit the specific preparation method of the single-stranded RNA reporter probe and the single-stranded DNA reporter probe, and the conventional preparation method in the art can be used.

[0025] In the present invention, the kit preferably further comprises a transcription reagent and an extraction-free virus lysis solution; the transcription reagent comprises T7 RNA polymerase, an RNase inhibitor and rNTP. In the present invention, the transcription reagent is used for in vitro transcription of HPV16 DNA.

[0026] In the present invention, the extraction-free virus lysis solution is a composition for lysing viruses and releasing DNA, which can achieve rapid lysis of HPV in cervical swab samples under constant temperature conditions, and preferably includes Chelex-100, Tris (trishydroxymethylaminomethane), EDTA (ethylenediaminetetraacetic acid) and DTT (dithiothreitol). The extraction-free virus lysis solution is preferably prepared by mixing enzyme-free sterile water with Chelex-100, DTT, Tris and EDTA.

[0027] In the kit of the present invention, the concentration of Cas13a protein is preferably 12.5-100 nM, more preferably 25-80 mM; the concentration of Cas12a protein is preferably 12.5-100 nM, more preferably 25-80 mM; the concentration of RNA reporter probe is preferably 0.1-4 µM, more preferably 1-3 µM; the concentration of DNA reporter probe is preferably 0.1-4 µM, more preferably 1-3 µM; the concentration of Cas13crRNA is preferably 10-100 nM, more preferably 25-80 nM; the concentration of Cas12 crRNA is preferably 10-100 nM, more preferably 50-70 nM; the concentration of HPV16 RPA amplification primer is preferably 50-250 nM, more preferably 125-200 nM, and the concentration of the upstream primer of the HPV16 RPA amplification primer is preferably 50-250 nM, more preferably 125-200 nM, the downstream primer concentration of the HPV16 RPA amplification primer is preferably 50-250 nM, more preferably 125-200 nM; the concentration of the HPV18 RPA amplification primer is preferably 125-400 nM, more preferably 250-350 nM, the upstream primer concentration of the HPV18 RPA amplification primer is preferably 125-400 nM, more preferably 250-350 nM, and the downstream primer concentration of the HPV18 RPA amplification primer is preferably 125-400 nM, more preferably 250-350 nM.

[0028] In the kit of the present invention, the concentration of the T7 RNA polymerase is preferably 0.05-0.5 U / µL, more preferably 0.25-0.4 U / µL; the concentration of the RNase inhibitor is preferably 0.25-2 U / µL, more preferably 1-1.5 U / µL; the concentration of the rNTP is preferably 0.25-2 mM, more preferably 0.5-1.5 mM. The concentration of the Chelex-100 is preferably 2.5g / 100 mL-40g / 100 mL, more preferably 20g / 100 mL-30g / 100 mL; the concentration of the Tris is preferably 1-100 mM, more preferably 10-80 mM; the concentration of the EDTA is preferably 0.1-10 mM, more preferably 1-5 mM; the concentration of the DTT is preferably 10-200 mM, more preferably 50-150 mM.

[0029] The optimized reaction system of the present invention can realize the efficient detection of HPV16 and HPV18 dual target nucleic acids under constant temperature conditions.

[0030] In the present invention, HPV16 RPA amplification primers, HPV18 RPA amplification primers, CRISPR / Cas13a detection reagents, CRISPR / Cas12a detection reagents, transcription reagents and RPA lyophilized powder are preferably mixed to prepare lyophilized powder, which can further simplify the operation process and facilitate transportation and storage.

[0031] The detection principle of the kit of the present invention is: HPV DNA is amplified by RPA to generate double-stranded DNA amplicons. For HPV16, the upstream primer with a T7 promoter tag can cause the double-stranded DNA amplicon to be transcribed into single-stranded RNA by T7 RNA polymerase. Subsequently, the Cas13a protein binds to the HPV16 crRNA and can specifically recognize the HPV16 RNA sequence, activate the trans-cleavage activity of the Cas13a protein, and cut the single-stranded RNA reporter molecule labeled with fluorescence quenching, thereby releasing a fluorescent signal. For HPV18, the Cas12a protein binds to the HPV18 crRNA and can specifically recognize the HPV18 DNA sequence, activate the trans-cleavage activity of the Cas12a protein, and cut the single-stranded DNA reporter molecule labeled with another fluorescence quenching, thereby releasing another fluorescent signal. Thus, HPV16 and HPV18 can be detected simultaneously in a single reaction system without interfering with each other.

[0032] If the sample to be tested does not contain HPV16 and HPV18, template amplification and in vitro transcription cannot be achieved, the nonspecific cleavage activity of the Cas13a protein will not be activated, the reporter RNA will not be cleaved and thus no fluorescent signal will be emitted; the nonspecific cleavage activity of the Cas12a protein will not be activated, the reporter DNA will not be cleaved and thus no other fluorescent signal will be emitted.

[0033] When the kit of the present invention is used for simultaneous detection of HPV16 and HPV18, the following steps are preferably included: The collected cervical swab sample is lysed using the extraction-free virus lysis solution to obtain a lysed sample; the lysed sample, RPA reaction reagent, CRISPR / Cas13a detection reagent and CRISPR / Cas12a detection reagent are mixed and incubated; the fluorescence intensity of the reaction is detected using a fluorescence detection device. Whether the sample to be tested is HPV16 and / or HPV18, or whether it contains HPV16 and / or HPV18, can be determined based on the presence or absence of a positive signal. The concentration of HPV16 and / or HPV18 in the sample to be tested can also be determined based on the strength of the positive signal. A positive signal is a fluorescent signal. If the fluorescence intensity value of the test group is higher than the mean of the fluorescence intensity value of the negative control (ddH2O) plus the sum of three times the standard deviation, it is determined to be a positive result (i.e., it is considered to have a positive signal).

[0034] In the present invention, the incubation temperature is preferably 37° C., and the incubation time is preferably 25 min.

[0035] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0036] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0038] The HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68 gDNA quality control products in the following examples are products of Jingliang Technology (Shenzhen) Co., Ltd.

[0039] In the following embodiments, LwaCas13a is a product of Tolo Company with a product number of 32117-01; LbCas12a is a product of Tolo Company with a product number of 32108.

[0040] The T7 RNA polymerase in the following embodiments is a product of New England Biolabs, with the catalog number M0251; the rNTP mixture is a product of New England Biolabs, with the catalog number N0466; the RNase inhibitor is a product of Solebao, with the catalog number R8061; the RPA lyophilized powder, RPA resuspension and 280 mM magnesium acetate are TwistDxTM products, with the catalog number TABAS03KIT; chelex-100 is a product of Solebao, with the catalog number C8230; DTT is a product of Thermo Fisher, with the catalog number 20290; Tris is a product of Thermo Fisher, with the catalog number 15568025; and EDTA is a product of Thermo Fisher, with the catalog number AM9260G.

[0041] The RNA reporter probe (ie, fluorescence quenching probe) in the following examples was commissioned to be synthesized by Shanghai Sangon Engineering Co., Ltd.; the DNA reporter probe (ie, fluorescence quenching probe) was commissioned to be synthesized by Shanghai Sangon Engineering Co., Ltd.

[0042] The primers and crRNA preparation templates in the following examples were commissioned to be synthesized by Shanghai Biotech Co., Ltd. Note: The crRNA described in the present invention is prepared by in vitro transcription. Specifically, crRNA in vitro transcription mainly includes three steps: annealing hybridization reaction, transcription, and RNA purification. (1) Annealing hybridization reaction: used to produce a double-stranded DNA template to be transcribed. Specifically, the 10µL annealing reaction system contains 1µL chemically synthesized crRNA preparation template (100µM), 1µL T7 promoter primer (sequence: GAAATTAATACGACTCACTATAGGG (SEQ ID NO.27)) (100 µM), 1µL Standard Taq buffer (10×) (purchased from New England Biolabs, catalog number B9014), and 7µL enzyme-free sterile water (purchased from Solebol, catalog number R1600). The reaction system was denatured at 95°C for 5 min on a Biorad t200 PCR instrument, and then annealed to 4°C at a gradient cooling rate of 0.1°C / s. (2) Transcription: Use HiScribe™ T7 Fast and Efficient RNA Synthesis Kit (purchased from NewEngland Biolabs, catalog number E2040) to transcribe the annealing reaction product according to the manufacturer's instructions. Incubate in a metal bath at 37°C for 8-12 h. (3) RNA purification: Use deoxyribonuclease (purchased from Promega, catalog number M6101) to degrade excess DNA in the transcription product. Then, according to the manufacturer's instructions, use RNA Clean&Concentrator-5 Kit (purchased from ZYMO, catalog number R1013) to purify the transcribed RNA to complete the preparation of crRNA. The crRNA prepared above was quantified by Qubit™ Flex fluorescence spectrophotometer and stored at -80°C for a long time for subsequent use.

[0043] The 128 clinical samples in the following examples were provided by the Second Affiliated Hospital of Henan University of Traditional Chinese Medicine and Ditan Hospital, the First Affiliated Hospital of Zhejiang University School of Medicine, and the patients have signed informed consent.

[0044] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0045] The following examples used GraphPad Prism statistical software to process the data, and the experimental results were expressed as mean ± standard deviation, using a Two-tailed Student t test, ns means no significant difference, P>0.05.

[0046] Example 1 A one-step kit for detecting HPV16 and HPV18, comprising an extraction-free virus lysate, an RPA reaction reagent, a transcription reagent, a CRISPR / Cas13a detection reagent, and a CRISPR / Cas12a detection reagent; The extraction-free virus lysis solution consists of 20 g / 100 mL chelex-100, 50 mM DTT, 10 mM Tris, 1 mM EDTA, and enzyme-free sterile water; RPA reaction reagent: composed of HPV16 RPA amplification primer, HPV18 RPA amplification primer and RPA reagent; the RPA reagent is composed of RPA lyophilized powder, RPA resuspension and magnesium acetate; the upstream primer of the HPV16 RPA amplification primer is shown in SEQ ID NO.1, with a concentration of 125 nM, and the downstream primer sequence is shown in SEQ ID NO.2, with a concentration of 125 nM; the upstream primer of the HPV18 RPA amplification primer is shown in SEQ ID NO.4, with a concentration of 250 nM, and the downstream primer sequence is shown in SEQ ID NO.5, with a concentration of 250 nM; the concentration of the magnesium acetate is 14 mM.

[0047] The transcription reagent consisted of 0.25 U / µL T7 RNA polymerase, 1 U / µL RNase inhibitor, and 0.5 mM rNTP mixture; The CRISPR / Cas13a detection reagent consists of 25 nM LwaCas13a protein, 1 µM RNA reporter probe and 25 nMCas13 crRNA; the RNA reporter probe is 5'-FAM-UUUUU-BHQ1-3'; the nucleotide sequence of the Cas13 crRNA is shown in SEQ ID No.3; The CRISPR / Cas12a detection reagent consists of 25 nM LbCas12a protein, 1 µM DNA reporter probe and 50 nMCas12 crRNA; the DNA reporter probe is 5'-ROX-CCCCCC-BHQ2-3'; the nucleotide sequence of the Cas12 crRNA is shown in SEQ ID No.6.

[0048] Example 2 When the kit of Example 1 is used to simultaneously detect HPV16 and HPV18, the following steps are included: The extraction-free virus lysis solution in the kit of Example 1 was mixed with the sample to be tested (the collected cervical swab sample), and the mixture was reacted at 80°C for 5 minutes to obtain a lysed sample; the RPA resuspension in the RPA reaction reagent was mixed with 280 mM magnesium acetate at a ratio of 12:1 (v / v) to obtain a buffer solution, 5 µL of the lysed sample, 15 µL of the buffer solution, the remaining raw materials in the RPA reaction reagent, the CRISPR / Cas13a detection reagent, and the CRISPR / Cas12a detection reagent were mixed, and the mixture was incubated at 37°C for 25 minutes; the fluorescence intensity was detected using the real-time fluorescence PCR system ABI-7500, and the detection result was determined based on the fluorescence value; the mean of the fluorescence intensity value of the negative control ddH2O and the sum of three times the standard deviation were used as the benchmark, and if the fluorescence intensity value of the sample group to be tested was higher than the benchmark, it was determined that the sample to be tested contained HPV16 and / or HPV18.

[0049] Specifically: if there is a FAM positive signal, it is determined that the sample to be tested contains HPV16; if there is no FAM positive signal, it is determined that the sample to be tested does not contain HPV16; if there is a ROX positive signal, it is determined that the sample to be tested contains HPV18; if there is no ROX positive signal, it is determined that the sample to be tested does not contain HPV18.

[0050] The concentration of HPV16 and HPV18 in the sample to be tested is determined according to the strength of the positive signal: the stronger the FAM positive signal, the higher the HPV16 content in the sample to be tested; the weaker the FAM positive signal, the lower the HPV16 content in the sample to be tested. The stronger the ROX positive signal, the higher the HPV18 content in the sample to be tested; the weaker the ROX positive signal, the lower the HPV18 content in the sample to be tested.

[0051] Example 3 Amplification primers and guide RNA screening Three crRNAs were designed for the HPV16 L1 gene, and three RPA amplification primers were designed for the upstream and downstream (as shown in Table 1). NCBI BLAST was used for similarity sequence alignment to verify the specificity of the designed primers and crRNA. It was synthesized by Shanghai Shenggong Biotechnology. In the present invention, the above-mentioned amplification primers and crRNA were combined for screening, totaling 27 groups. Different primers were combined with crRNA to detect HPV16 quality control products (concentration of 1000 copies / µL) using the method of Example 2 (except that the RPA amplification primers and crRNA are different from the kit of Example 1, the rest are the same as the kit of Example 1). The results are as follows Figure 1 As shown, the fluorescence detection results showed that the combination of HPV16-RPA-F3, HPV16-RPA-R2 and HPV16-crRNA-1 had the best effect.

[0052] Three crRNAs and four RPA amplification primers upstream and downstream were designed for the HPV18 L1 gene (as shown in Table 1). NCBI BLAST was used for similarity sequence alignment to verify the specificity of the designed primers and crRNA. It was synthesized by Shanghai Shenggong Biotechnology. In the present invention, the above-mentioned amplification primers and crRNA were combined for screening, totaling 48 groups. Different primers were combined with crRNA to detect HPV18 quality control products (concentration of 1000 copies / µL) using the method of Example 2 (except that the RPA amplification primers and crRNA are different from the kit of Example 1, the rest are the same as the kit of Example 1). The results are as follows Figure 2 As shown, the fluorescence detection results showed that the combination of HPV18-RPA-F2, HPV18-RPA-R4 and HPV18-crRNA-1 had the best effect.

[0053] Table 1 Upstream and downstream RPA amplification primers and crRNA sequences

[0054] Example 4 Reaction system optimization This embodiment gradually optimizes the concentrations of RPA amplification primers, T7 RNA polymerase, rNTP mixture, RNAse (RNase inhibitor) inhibitor, LbCas12a protein, LwaCas13a protein, Cas12 crRNA and Cas13 crRNA.

[0055] (1) Optimization of RPA amplification primer concentration: The concentrations of HPV16 RPA amplification primers / HPV18 RPA amplification primers (HPV16 / HPV18) were set to 50nM / 125nM, 50nM / 250nM, 50nM / 400nM, 125nM / 125nM, 125nM / 250nM, 125nM / 400nM, 250nM / 125nM, 250nM / 250nM, and 250nM / 400nM, respectively. The concentrations of other components in the kit were: 0.2U / μL T7 RNA polymerase, 0.4mM rNTP mixture, 0.8U / μL RNase inhibitor, 20nM LbCas12a protein, 20nM LwaCas13a protein, 40nM Cas12 crRNA and, 20nM Cas13 crRNA; the concentrations of the other raw materials were the same as in Example 1. The mixture of HPV16 quality control product and HPV18 quality control product was detected by the method of Example 2. The concentrations of both quality control products were 500 copies / µL, and each group was repeated three times independently. The results are shown in Figure 3 As shown, the detection performance is best when the HPV16 / HPV18 primer concentration is 125nM / 250nM.

[0056] (2) Optimization of T7 RNA polymerase concentration: The concentration of HPV16 RPA amplification primer / HPV18 RPA amplification primer (HPV16 / HPV18) was set to 125nM / 250nM, and the concentration of T7 RNA polymerase was modified to 0.05U / μL, 0.125U / μL, 0.25U / μL, and 0.5U / μL, respectively. The rest was the same as step (1). Figure 4 As shown, it shows that the detection performance is best when the T7 RNA polymerase concentration is 0.25U / µL.

[0057] (3) Optimization of rNTP mixture concentration: The concentration of HPV16 RPA amplification primer / HPV18 RPA amplification primer (HPV16 / HPV18) was set to 125nM / 250nM, the concentration of T7 RNA polymerase was set to 0.25 U / µL, and the concentration of rNTP mixture was set to 0.25mM, 0.5mM, 1mM, and 2mM respectively. The rest was the same as step (1). The results are shown in Figure 5 As shown, it is shown that the detection performance is best when the concentration of rNTP mixture is 0.5mM.

[0058] (4) Optimization of RNase inhibitor concentration: The concentration of HPV16 RPA amplification primer / HPV18 RPA amplification primer (HPV16 / HPV18) was set to 125nM / 250nM, the concentration of T7 RNA polymerase was set to 0.25 U / µL, the concentration of rNTP mixture was set to 0.5mM, and the concentration of RNase inhibitor was set to 0.25 U / µL, 0.5 U / µL, 1 U / µL, and 2 U / µL, respectively. The rest was the same as step (1). The results are shown in Figure 6 As shown, it was shown that the detection performance was optimal when the RNase inhibitor concentration was 1 U / µL.

[0059] (5) Optimization of LbCas12a protein concentration: The concentration of HPV16 RPA amplification primer / HPV18 RPA amplification primer (HPV16 / HPV18) was set to 125nM / 250nM, the concentration of T7 RNA polymerase was set to 0.25 U / µL, the concentration of rNTP mixture was set to 0.5mM, the concentration of RNase inhibitor was set to 1 U / µL, and the concentration of LbCas12a protein was set to 12.5 nM, 25 nM, 50 nM, and 100 nM, respectively. The rest was the same as step (1). The results are shown in Figure 7 As shown, it was shown that the detection performance was best when the LbCas12a protein concentration was 25 nM.

[0060] (6) Optimization of LwaCas13a protein concentration: HPV16 RPA amplification primer concentration / HPV18 RPA amplification primer (HPV16 / HPV18) was set to 125nM / 250nM, T7 RNA polymerase concentration was set to 0.25 U / µL, rNTP mixture concentration was set to 0.5mM, RNase inhibitor concentration was set to 1 U / µL, LbCas12a protein concentration was set to 25 nM, LwaCas13a protein concentration was set to 12.5 nM, 25 nM, 50 nM, 100 nM respectively, and the rest was the same as step (1). The results are shown in Figure 8 As shown, it was shown that the detection performance was best when the LwaCas13a protein concentration was 25 nM.

[0061] (7) Optimization of Cas12 crRNA concentration: Set the HPV16 RPA amplification primer concentration / HPV18 RPA amplification primer (HPV16 / HPV18) to 125nM / 250nM, set the T7 RNA polymerase concentration to 0.25 U / µL, set the rNTP mixture concentration to 0.5mM, set the RNase inhibitor concentration to 1 U / µL, set the LbCas12a protein concentration to 25 nM, set the LwaCas13a protein concentration to 25 nM, set the Cas12 crRNA concentration to 10 nM, 25 nM, 50 nM, and 100 nM, respectively. The rest are the same as step (1). The results are as follows: Fig. 9 As shown, it was shown that the detection performance was best when the Cas12 crRNA concentration was 50 nM.

[0062] (8) Optimization of Cas13 crRNA concentration: Set the HPV16 RPA amplification primer concentration / HPV18 RPA amplification primer (HPV16 / HPV18) to 125nM / 250nM, set the T7 RNA polymerase concentration to 0.25 U / µL, set the rNTP mixture concentration to 0.5mM, set the RNase inhibitor concentration to 1 U / µL, set the LbCas12a protein concentration to 25 nM, set the LwaCas13a protein concentration to 25 nM, set the Cas12 crRNA concentration to 50 nM, set the Cas13 crRNA concentration to 10 nM, 25 nM, 50 nM, and 100 nM, respectively. The rest are the same as step (1). The results are as follows Fig.10 As shown, it was shown that the detection performance was best when the Cas13crRNA concentration was 25 nM.

[0063] Example 5 The performance evaluation of the detection method of Example 2 was performed using the kit described in Example 1 (1) Sensitivity test: The viral load in patients at the early stage of viral infection is often at a low level, so the sensitivity of the detection kit is crucial for early screening. Using digital PCR absolute quantitative HPV16 and HPV18 L1 gene reference as the reference standard, 1000, 100, 10, 5, 2.5, 1 and 0 (0 is NTC, which is a negative control) copies / µL of the above samples were selected for testing. Each group was repeated three times independently. The results are as follows: Fig.11 As shown, the results show that the detection limit of the kit of the present invention for HPV16 is 2.5 copies / µL, and the detection limit for HPV18 is 5 copies / µL. In order to further understand the actual detection limit of the method, HPV16 DNA with a concentration of 2.5 copies / µL and HPV18 DNA with a concentration of 5 copies / µL were selected for test verification. Each group was repeated 20 times independently, and a detection rate of not less than 19 / 20 was considered a detectable concentration. Fig.12 As shown, the results show that the detection rate of HPV16 2.5 copies / µL DNA is 19 / 20, and the detection rate of HPV18 5 copies / µL DNA is 20 / 20. Therefore, the final HPV16 detection limit of the method of the present invention is 2.5 copies / µL, and the final HPV18 detection limit is 5 copies / µL.

[0064] (2) Specificity test: The specificity of the reaction of the kit of Example 1 to HPV16 and HPV18 and other high-risk HPV subtypes (including HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV66 and HPV68) was tested. The results are as follows: Fig.13 As shown, the results show that the kit of the present invention has no cross reaction with the other high-risk HPV subtypes mentioned above and has good specificity.

[0065] Example 6 Clinical samples were tested using the kit described in Example 1 and the detection method described in Example 2 A total of 128 clinical cervicovaginal swab samples were collected (including 46 HPV16-positive samples, 11 HPV18-positive samples, 1 HPV16 and HPV18 double-positive sample, 44 other HPV subtype-positive samples, and 26 completely negative samples), such as Fig.14 As shown, the results showed that 125 samples were accurately detected, and 3 positive samples (including two HPV16-positive samples and 1 HPV18-positive sample) were not detected. Fig.15 The results showed that the detection sensitivity of the kit of the present invention for 128 clinical samples was 94.7% and the specificity was 100%. Fig.16It shows that the detection results of the kit of the present invention for clinical samples are completely consistent with the detection results of the qPCR method, the "gold standard" of nucleic acid detection, for samples with a CT value less than 36.

[0066] The qPCR method, the "gold standard" for nucleic acid detection, is to use TaKaRa (Cat. No. RR390) Premix Ex Taq (probe qPCR) for HPV16 and HPV18 qPCR detection. Each 25µL reaction mixture contains 12.5µL 2×PremixEx Taq (probe qPCR), 400 nM forward primer and reverse primer, 400 nM FAM probe, 2µL DNA template and 7.5µL nuclease-free water. qPCR is performed according to the following thermal cycle program: incubation at 50°C for 2 min, pre-denaturation at 95°C for 2.5 min, followed by 45 cycles, each cycle The cycle included 94°C for 30 s and 55°C for 30 s. The primer and probe sequences used were as follows: HPV16-qPCR-F: ATACATTTACCTGACCCCAA (SEQ ID NO.21), HPV16-qPCR-R: ACCTCAACACCTACACAGGC (SEQ ID NO.22), HPV16-qPCR-P:TTTGGTTTTCCTGACACCTCATT (SEQ ID NO. 23); HPV18-qPCR-F: GTGTGTATTCTCCCTCTCCA (SEQ ID NO.24), HPV18-qPCR-R: GACCCTGTGCCTTATGTAAC (SEQ ID NO. 25), HPV18-qPCR-P: TGGCTCTATTGTTACCTCTGACTCC (SEQ ID NO. 26).

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A one-step detection kit for HPV16 and HPV18, characterized in that: The kit includes an RPA reaction reagent, a CRISPR / Cas13a detection reagent, and a CRISPR / Cas12a detection reagent; The RPA reaction reagents include HPV16 RPA amplification primers and HPV18 RPA amplification primers; The CRISPR / Cas13a detection reagent includes Cas13a protein, RNA reporter probe and Cas13 crRNA, and the nucleotide sequence of the Cas13 crRNA is shown in SEQ ID No.3; The CRISPR / Cas12a detection reagent includes Cas12a protein, DNA reporter probe and Cas12 crRNA, and the nucleotide sequence of the Cas12 crRNA is shown in SEQ ID No.

6.

2. The kit according to claim 1, characterized in that The nucleotide sequences of the upstream primer and the downstream primer of the HPV16 RPA amplification primer are shown as SEQ ID No.1 and SEQ ID No.2, respectively; the nucleotide sequences of the upstream primer and the downstream primer of the HPV18 RPA amplification primer are shown as SEQ ID No.4 and SEQ ID No.5, respectively.

3. The kit according to claim 1, characterized in that The RNA reporter probe is composed of poly U, a fluorescent group and a quenching group; the DNA reporter probe is composed of poly C, a fluorescent group and a quenching group; the fluorescent group includes FAM, ROX, HEX, CY3 or CY5, and the quenching group includes BHQ1, BHQ2 or BHQ3; the fluorescent group of the RNA reporter probe is different from the fluorescent group of the DNA reporter probe.

4. The kit according to claim 1, characterized in that The kit also includes a transcription reagent and an extraction-free virus lysis solution; the transcription reagent includes T7 RNA polymerase, an RNA enzyme inhibitor and rNTP.

5. The kit according to claim 4, characterized in that The extraction-free virus lysis solution comprises Chelex-100, Tris, EDTA and DTT.

6. The kit according to claim 1, characterized in that The RPA reaction reagent also includes an RPA reagent, which includes an RPA lyophilized powder, an RPA resuspension and magnesium acetate; the concentration of the magnesium acetate is 5-50 mM.

7. The kit according to claim 1, characterized in that The concentrations of the raw materials in the kit are: Cas13a protein 12.5-100 nM, Cas12a protein 12.5-100 nM, RNA reporter probe 0.1-4 µM, DNA reporter probe 0.1-4 µM, Cas13 crRNA 10-100 nM, Cas12 crRNA 10-100 nM, HPV16 RPA amplification primer 50-250 nM, HPV18 RPA amplification primer 125-400 nM.

8. The kit according to claim 4, characterized in that The concentration of the T7 RNA polymerase is 0.05-0.5 U / µL; the concentration of the RNase inhibitor is 0.25-2 U / µL; and the concentration of the rNTP is 0.25-2 mM.

9. The kit according to claim 5, characterized in that The concentration of the Chelex-100 is 2.5 g / 100 mL-40 g / 100 mL; the concentration of the Tris is 1-100 mM; the concentration of the EDTA is 0.1-10 mM; and the concentration of the DTT is 10-200 mM.

10. The kit according to any one of claims 1 to 9, characterized in that The mean of the fluorescence intensity value of the negative control ddH2O and the sum of three times the standard deviation are used as a benchmark. If the fluorescence intensity value of the sample group to be tested is higher than the benchmark, it is determined that the sample to be tested contains HPV16 and / or HPV18.

Images