Combined primer and detection method for simultaneously detecting two geminiviruses on solanaceae plants

Abstract

The invention provides a combined primer and a detection method for simultaneously detecting two geminiviruses on solanaceae plants, and belongs to the technical field of plant virus detection. The combined primer comprises a first primer pair aiming at a ToLCNDV-A coat protein gene, a second primer pair aiming at a ToLCNDV-B mobile protein gene and a third primer pair aiming at a TYLCV coat protein gene. Compared with a single PCR detection method, the method can simultaneously detect the tomato yellow leaf curl virus (TYLCV) and the New Delhi tomato leaf curl virus (ToLCNDV), so that the detection efficiency of the two viruses is greatly improved, the detection cost is reduced, and the detection sensitivity and accuracy are equivalent to those of the single PCR detection method. Therefore, the method is applicable to simultaneous detection of the two viruses in the solanaceae plants in the field.

Description

Technical Field

[0001] The invention belongs to the technical field of plant virus detection, and particularly relates to a combination primer for simultaneously detecting two geminiviruses on Solanaceae plants and a detection method. Background Art

[0002] Solanaceae plants such as tomatoes and peppers have an important position and economic value in the global daily diet. In 2023, about 192.3 million tons of tomato fruits and 38.3 million tons of pepper fruits were produced on 5.41 million hectares and 2.06 million hectares of land, respectively. However, these two Solanaceae crops are susceptible to many viruses, and the yield and quality of crops are seriously reduced after virus infection. At present, tomato yellow leaf curl virus (TYLCV) and tomato leaf curl New Delhi virus (ToLCNDV), which belong to the genus Bean golden mosaic virus of the family Geminiviridae, are important pathogens that cause leaf curl disease in Solanaceae plants. Among them, TYLCV is a single-component geminivirus that can infect hosts such as tomatoes, peppers, and tobacco, causing the leaves at the top of the plant to curl upward, shrink, turn yellow, and the plant to dwarf. The disease caused is spread by whiteflies, which is difficult to prevent and control, has a wide range, and is highly harmful. ToLCNDV is a newly discovered alien invasive agricultural organism in recent years. It is a two-component twin virus with a genome of DNA-A and DNA-B. It mainly harms Solanaceae crops such as tomatoes and peppers and Cucurbitaceae crops. Its infection of Cucurbitaceae crops mainly causes leaf curling and dwarfing, while tomatoes will show leaf curling, wrinkling, bright veins, yellow spots and other symptoms after infection. The spread of the above two viruses has seriously hindered the healthy development of related industries. Establishing a rapid and effective detection method for them is of great significance for the scientific prevention and control of related viral diseases.

[0003] At present, the detection methods of ToLCNDV and TYLCV include serological detection, DNA polymerase rolling circle amplification (RCA), recombinase polymerase amplification (RPA), conventional PCR, fluorescence quantitative PCR, loop-mediated isothermal amplification (LAMP), etc. Among them, conventional PCR is a common method for virus detection, but this method has problems such as high cost and low efficiency when facing the simultaneous detection of multiple viruses. Multiplex PCR is a technology that adds multiple pairs of primers to a PCR reaction system to amplify multiple templates, thereby detecting different viruses at the same time. Primer design is a key factor affecting the effect of multiplex PCR amplification, which not only requires good specificity of primer amplification and avoids nonspecific amplification, but also does not require too many complementary bases between different primer pairs to avoid the formation of primer dimers, the primer annealing temperature should also be similar, and the size of the amplified fragment is required to distinguish different viruses. Compared with traditional PCR detection technology, multiplex PCR can detect multiple viruses at one time, eliminating the cumbersome operation of single PCR for multiple virus detection, thereby improving the efficiency of virus detection and reducing the detection cost, providing an economical and time-saving method for detecting plant viruses, and has good application prospects. Summary of the invention

[0004] The present invention aims to solve the problem that it is difficult to detect ToLCNDV and TYLCV simultaneously and quickly and effectively, and to provide a combination of primers and a detection method for simultaneously detecting two geminiviruses on Solanaceae plants. The present invention can reduce the workload of detecting two viruses with a single PCR technology, improve detection efficiency, and save detection costs.

[0005] The technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides a combination of primers for simultaneously detecting two Geminiviruses on Solanaceae plants, comprising a first primer pair for ToLCNDV-A coat protein gene, a second primer pair for ToLCNDV-B mobile protein gene, and a third primer pair for TYLCV coat protein gene;

[0007] The first primer pair consists of a first upstream primer as described in SEQ ID No.1 and a first downstream primer as described in SEQ ID No.2;

[0008] The second primer pair consists of a second upstream primer as described in SEQ ID No.3 and a second downstream primer as described in SEQ ID No.4;

[0009] The third primer pair consists of a third upstream primer as described in SEQ ID No.5 and a third downstream primer as described in SEQ ID No.6.

[0010] As a preference for the first aspect above, the size of the fragment amplified by the first primer pair is 651 bp, the size of the fragment amplified by the second primer pair is 305 bp, and the size of the fragment amplified by the third primer pair is 442 bp.

[0011] In a second aspect, the present invention provides a multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants, comprising:

[0012] S1. Using the genome extracted from the sample of the Solanaceae plant to be tested as a DNA template, multiple PCR amplification is performed using the combination of primers for simultaneously detecting two geminiviruses on the Solanaceae plant as described in the first aspect above to obtain PCR products;

[0013] S2. Detect the PCR product by agarose gel electrophoresis, and place the agarose gel after the electrophoresis on a gel imager for interpretation. If bands of 651 bp and 305 bp appear on the agarose gel after the electrophoresis, it is determined that ToLCNDV virus is present in the Solanaceae plant sample to be tested; if a band of 442 bp appears on the agarose gel after the electrophoresis, it is determined that TYLCV virus is present in the Solanaceae plant sample to be tested; if bands of 651 bp and 305 bp do not appear on the agarose gel after the electrophoresis, and no band of 442 bp appears, it is determined that ToLCNDV and TYLCV viruses are not present in the Solanaceae plant sample to be tested.

[0014] As a preferred embodiment of the second aspect, the components of the reaction system used for the multiplex PCR amplification include: a DNA template, 2×Rapid Taq Master Mix, a first primer pair, a second primer pair, a third primer pair and ultrapure water.

[0015] As a preferred embodiment of the second aspect, in the reaction system, the final concentrations of the two primers in the first primer pair are both 0.05-0.25 μM, the final concentrations of the two primers in the second primer pair are both 0.25-0.50 μM, and the final concentrations of the two primers in the third primer pair are both 0.25 μM.

[0016] As a preference for the second aspect, in the reaction system, the final concentrations of the two primers in the first primer pair are both 0.15 μM, the final concentrations of the two primers in the second primer pair are both 0.50 μM, and the final concentrations of the two primers in the third primer pair are both 0.25 μM.

[0017] As a preferred embodiment of the second aspect above, the reaction conditions adopted for the multiplex PCR amplification are: first pre-denaturation at 95°C for 3 min, then denaturation at 95°C for 15 s, annealing at 53-60°C for 15 s, extension at 72°C for 15 s, and the number of cycles of denaturation, annealing and extension program is 32, and finally extension at 72°C for 5 min.

[0018] As a preferred embodiment of the second aspect above, the reaction conditions adopted for the multiplex PCR amplification are: first pre-denaturation at 95°C for 3 min, then denaturation at 95°C for 15 s, annealing at 57.2°C for 15 s, extension at 72°C for 15 s, and the number of cycles of denaturation, annealing and extension program is 32, and finally extension at 72°C for 5 min.

[0019] As a preferred embodiment of the second aspect, when the PCR product is detected by agarose gel electrophoresis, a negative control needs to be set, and the negative control needs to use a genome extracted from healthy tomatoes that are not infected with ToLCNDV and TYLCV viruses as a DNA template.

[0020] As a preferred embodiment of the second aspect, the Solanaceae plant samples to be tested are plant leaves.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The present invention establishes a multiplex PCR method for simultaneously detecting two Solanaceae viruses. Compared with single PCR, the multiplex PCR detection method of the present invention improves detection efficiency, reduces detection cost, and the detection sensitivity is also equivalent to that of single PCR, and can be applied to the detection of Solanaceae viruses in the field. In addition, the present invention also optimizes the primer concentration and annealing temperature of the multiplex PCR reaction system. After optimization, when the final concentrations of ToLCNDV-AF / R, TYLCV-F / R, and ToLCNDV-BF / R primers (using a concentration of 10 μM) are 0.15 μM / 0.15 μM, 0.25 μM / 0.25 μM, and 0.50 μM / 0.50 μM, respectively, and the annealing temperature is 57.2°C, the amplification effect is best. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the steps of the multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants;

[0024] Figure 2 To analyze the effectiveness of multiplex PCR primers for detecting ToLCNDV and TYLCV;

[0025] Figure 3 To screen the optimal primer concentrations for multiplex PCR detection of ToLCNDV and TYLCV;

[0026] Figure 4To screen the optimal annealing temperature for multiplex PCR detection of ToLCNDV and TYLCV;

[0027] Figure 5 To analyze the specificity of multiplex PCR detection of ToLCNDV and TYLCV;

[0028] Figure 6 To analyze the sensitivity of multiplex PCR for detecting ToLCNDV;

[0029] Figure 7 To analyze the sensitivity of single PCR for TYLCV detection;

[0030] Figure 8 To analyze the sensitivity of multiplex PCR for simultaneous detection of ToLCNDV and TYLCV;

[0031] Fig. 9 To simultaneously detect ToLCNDV and TYLCV in field samples using multiplex PCR. DETAILED DESCRIPTION

[0032] In order to make the above-mentioned purpose, features and advantages of the present invention more obvious and easy to understand, the specific implementation mode of the present invention is described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The technical features in each embodiment of the present invention can be combined accordingly without conflicting with each other.

[0033] The invention provides a combination of primers for simultaneously detecting two geminiviruses on Solanaceae plants. The combination of primers comprises a first primer pair targeting a ToLCNDV-A coat protein (CP) gene, a second primer pair targeting a ToLCNDV-B movement protein (MP) gene, and a third primer pair targeting a TYLCV coat protein (CP).

[0034] The first primer pair is composed of a first upstream primer and a first downstream primer, and the sequences of the two primers are as follows:

[0035] ToLCNDV-AF (SEQ ID No. 1): 5'-CTATGGAGCTCGTGCAGTTGTC -3';

[0036] ToLCNDV-AR (SEQ ID No. 2): 5'-GTAGCATATACAGGATTTGATGCGTGAG-3';

[0037] The second primer pair is composed of a second upstream primer and a second downstream primer, and the sequences of the two primers are as follows:

[0038] ToLCNDV-BF (SEQ ID No.3): 5'- CGTTCGGACCTATAGCCAGATAGG -3';

[0039] ToLCNDV-BR (SEQ ID No. 4): 5'-CTTCCTCTCAAGGATAAGAATCCTTGG -3';

[0040] The third primer pair is composed of a third upstream primer and a third downstream primer, and the sequences of the two primers are as follows:

[0041] TYLCV-F (SEQ ID No.5): 5'- AATATTTCCACGCCCGTCTC -3';

[0042] TYLCV-R (SEQ ID No. 6): 5'-TCCAAAATCCATTGGGCTGTTTCC -3';

[0043] The size of the fragment amplified by the first primer pair is 651 bp, the size of the fragment amplified by the second primer pair is 305 bp, and the size of the fragment amplified by the third primer pair is 442 bp.

[0044] In addition, if Figure 1 As shown, the present invention also provides a multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants, which comprises:

[0045] S1. Using the genome extracted from the sample of the Solanaceae plant to be tested as a DNA template, multiple PCR amplification was performed using the above-mentioned combination of primers for simultaneously detecting two geminiviruses on the Solanaceae plant to obtain PCR products;

[0046] S2. Detect the PCR product by agarose gel electrophoresis, and place the agarose gel after the electrophoresis on a gel imager for interpretation. If bands of 651 bp and 305 bp appear on the agarose gel after the electrophoresis, it is determined that ToLCNDV virus is present in the Solanaceae plant sample to be tested; if a band of 442 bp appears on the agarose gel after the electrophoresis, it is determined that TYLCV virus is present in the Solanaceae plant sample to be tested; if bands of 651 bp and 305 bp do not appear on the agarose gel after the electrophoresis, and no band of 442 bp appears, it is determined that ToLCNDV and TYLCV viruses are not present in the Solanaceae plant sample to be tested.

[0047] In the above-mentioned multiplex PCR detection method, the Solanaceae plant sample to be detected can be the leaves, stems or roots of the plant, and preferably the leaves are used as the detection sample to extract DNA.

[0048] In addition, in the above-mentioned multiplex PCR detection method, the specific detection system, detection conditions, and reagents used can be designed according to the general practice of multiplex PCR detection, and specific operations can also be performed referring to the instructions for use of the reagents used.

[0049] In the embodiment of the present invention, the components of the reaction system used for multiplex PCR amplification include: DNA template, 2×Rapid Taq Master Mix, a first primer pair, a second primer pair, a third primer pair and ultrapure water. In the reaction system, the final concentration of the upstream primer / downstream primer of the three primer pairs is n 1 / n 2 It can be optimized according to actual conditions. The final concentration of the two primers in the first primer pair is preferably 0.05-0.25 μM, the final concentration of the two primers in the second primer pair is preferably 0.25-0.50 μM, and the final concentration of the two primers in the third primer pair is preferably 0.25 μM. Furthermore, the final concentration of the two primers in the first primer pair is preferably 0.15 μM (i.e., n 1 / n 2 The final concentration of the two primers in the second primer pair is preferably 0.15 μM / 0.15 μM, and the final concentration of the two primers in the second primer pair is preferably 0.50 μM (i.e., n 1 / n 2 The final concentration of the two primers in the third primer pair is preferably 0.25 μM (i.e., n 1 / n 2 Preferably, the concentration of the two primers in the first primer pair, the second primer pair, and the third primer pair can be optimized to 10 μM. The concentration defined in the present invention is 10 μM before the primers are added to the system.

[0050] In an embodiment of the present invention, the reaction conditions used for multiplex PCR amplification are preferably: first, pre-denaturation at 95°C for 3 min, then denaturation at 95°C for 15 s, annealing at 53-60°C for 15 s, extension at 72°C for 15 s, and the number of cycles of denaturation, annealing and extension is 32, and finally extension at 72°C for 5 min. Further, the reaction conditions used for multiplex PCR amplification are preferably: first, pre-denaturation at 95°C for 3 min, then denaturation at 95°C for 15 s, annealing at 57.2°C for 15 s, extension at 72°C for 15 s, and the number of cycles of denaturation, annealing and extension is 32, and finally extension at 72°C for 5 min.

[0051] In addition, in order to exclude false positive results and improve the accuracy of detection, it is best to set up a negative control when detecting the PCR product by agarose gel electrophoresis, and the negative control needs to use the genome extracted from healthy tomatoes without ToLCNDV and TYLCV virus infection as the DNA template, and the rest of the procedures are the same as the normal experimental group. If the negative control has no bands, but the experimental group samples have bands, it means that the bands in the experimental group samples may be the amplification products of the target DNA, and the test results are reliable. If the negative control has bands, and the bands of the experimental group samples are at the same or similar positions as the negative control bands, this indicates that the test results may be false positive, and further inspection is needed to see if the experimental system or operation process is contaminated.

[0052] The technical effects of the present invention are demonstrated below through multiple embodiments. In the following examples, unless otherwise specified, the reagents and materials used can all be commercially available products. In the following examples, where specific conditions are not specified, specific experiments can be carried out according to conventional methods and conditions in the art, or in accordance with the product instructions.

[0053] Example 1: Sample preparation and design and synthesis of multiplex PCR primer combinations

[0054] In this embodiment, the positive virus samples, DNA of the samples to be tested and the virus plasmids used in other embodiments were first prepared, and multiple PCR combination primers were designed and synthesized.

[0055] 1. Experimental Materials

[0056] In this example, tomato and pepper samples suspected of being infected with New Delhi Tomato Leaf Curl Virus or Tomato Yellow Leaf Curl Virus were collected from Zhejiang Province, and the symptoms were curling and shrinking of leaves. After sampling, the samples were stored in a -80°C refrigerator.

[0057] The reagents used in this example are as follows: FastPure® Plant DNA Isolation Mini Kit, FastPure Gel DNA Extraction Mini Kit, Ultra-Universal TOPO Cloning Kit, FastPure Plasmid Mini Kit-BOX 2 and 2×Rapid Taq Master Mix were purchased from Nanjing Novozyme Biotechnology Co., Ltd. 2×TOROBlue® Flash KOD Dye Mix was purchased from TOBOYO.

[0058] 2. Design and synthesis of multiplex PCR primer combinations

[0059] The DNA-A (ToLCNDV-A) and DNA-B (ToLCNDV-B) sequences of different isolates of ToLCNDV and DNA-A sequences of different isolates of TYLCV were downloaded from NCBI, and primers were designed according to the conserved regions of their coat protein (CP) and movement protein (MP). Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0060] In this example, the specific primers for multiplex PCR detection of ToLCNDV and TYLCV are shown in Table 1.

[0061] Table 1 Specific primers for multiplex PCR detection of ToLCNDV and TYLCV

[0062]

[0063] As shown in Table 1, the size of the fragment amplified by the primers for the ToLCNDV-A gene is 651 bp, the size of the fragment amplified by the primers for the ToLCNDV-B gene is 305 bp, and the size of the fragment amplified by the primers for the TYLCV gene is 442 bp.

[0064] In addition, primers for preparing specific viral plasmids were designed and synthesized in this example, as shown in Table 2.

[0065] Table 2 Primers used to prepare specific viral plasmids

[0066]

[0067] As shown in Table 2, the size of the fragment amplified for ToLCNDV-CP was 768 bp, the size of the fragment amplified for ToLCNDV-MP was 837 bp, and the size of the fragment amplified for TYLCV-CP was 733 bp.

[0068] 3. DNA extraction and viral plasmid preparation of positive virus samples and samples to be tested

[0069] The positive virus samples used in this example are as follows:

[0070] The virus-positive plant samples used for specific detection include the following viruses: tomato leaf curl China virus ToLCCNV, tomato leaf curl my country virus ToLCTWV, tomato golden mosaic virus TGMV, ramie mosaic virus RAMV, tomato yellow leaf curl Yunnan virus TYLCYnV, tobacco curly shoot virus TbCSV, and tomato yellow leaf curl China virus TYLCCNV.

[0071] The method for extracting genomic DNA from plant samples used in the following examples is as follows:

[0072] Take fresh plant tissue, add liquid nitrogen and grind it into sample powder, transfer the sample powder to a centrifuge tube, and then use the FastPure® Plant DNA Isolation Mini Kit to extract plant DNA. The specific extraction process is as follows:

[0073] Step 1.1: Take about 100 mg of fresh plant tissue, add liquid nitrogen and grind it into sample powder. Transfer the sample powder to a 1.5 ml centrifuge tube.

[0074] Step 1.2: Immediately add 400 μl of lysis buffer and 4 μl of 10 mg / ml RNase A to the sample powder obtained in step 1.1, vortex and mix thoroughly to aid lysis;

[0075] Step 1.3, remove protein impurities: add 130 μl Buffer A2 to the sample obtained in step 1.2, put on ice for 5 min, centrifuge at 14000 rpm for 5-10 min, and take the supernatant;

[0076] Step 1.4, adjust the column environment: add 1.5 times the volume of Buffer A3 to the supernatant obtained in step 1.3, and mix immediately by pipetting;

[0077] Step 1.5, genome adsorption: transfer the mixed solution obtained in step 1.4 to the adsorption column, centrifuge at 12000 rpm for 30-60 seconds, and remove the liquid portion;

[0078] Step 1.6, remove salt ion residues: add 600 μl of elution solution to the adsorption column treated in step 1.5, centrifuge at 12000 rpm for 30 s, then remove the liquid part, repeat the elution and centrifugation process, remove the liquid part again to obtain an empty column;

[0079] Step 1.7, remove residual ethanol: centrifuge the empty column obtained in step 1.6 at 12000 rpm for 2 min;

[0080] Step 1.8, genome elution: add 50-100 μl preheated Elution Buffer to the empty column obtained in step 1.7, place at room temperature for 2 min, centrifuge at 12000 rpm for 1 min to elute the DNA, measure the concentration of the obtained DNA solution by UV spectrophotometer and store in a -20℃ refrigerator for later use;

[0081] In some of the following examples, it is also necessary to prepare viral plasmids for detecting the sensitivity of this method. The specific method for preparing viral plasmids is as follows:

[0082] Step 2.1. Using plant genomic DNA containing ToLCNDV and TYLCV as templates, 2XTOROBlue® Flash KOD Dye Mix from TOBOYO was used to amplify the CP (768 bp), MP (837 bp) of ToLCNDV and the CP (733 bp) of TYLCV. The reaction system used for amplification was: 1 μl DNA template, 25 μl 2XTOROBlue@FlashKODDyeMix, the final concentration of primers F / R in Table 2 (used at a concentration of 10 μM) was 0.30 μM, and the reaction system was finally heated with ddH 2 The reaction conditions used for amplification were: pre-denaturation at 98°C for 1 min, denaturation at 98°C for 10 s, annealing at (Tm-5)°C for 5 s, extension at 68°C for 5 s, 32 cycles of denaturation-annealing-extension, and extension at 68°C for 5 min.

[0083] The selection of primers F / R is determined according to the target viral fragment to be amplified. Specifically, when amplifying the CP sequence of ToLCNDV, DNA extracted from plant leaves infected with ToLCNDV was used as a template, and the added primers F / R were ToLCNDV-CP-F / R primers shown in SEQ ID No.7 and SEQ ID No.8 in Table 2, and the final concentration of each was 0.30 μM; when amplifying the MP sequence of ToLCNDV, DNA extracted from plant leaves infected with ToLCNDV was also used as a template, and the added primers F / R were ToLCNDV-MP-F / R primers shown in SEQ ID No.9 and SEQ ID No.10 in Table 2, and the final concentration of each was 0.30 μM; when amplifying the CP sequence of TYLCV, DNA extracted from plant leaves infected with TYLCV was used as a template, and the added primers F / R were TYLCV-CP-F / R primers shown in SEQ ID No.11 and SEQ ID No.12 in Table 2, and the final concentration of each was 0.30 μM.

[0084] Step 2.2: Load all the PCR stock solution after the reaction onto 1% agarose gel, and use FastPure Gel DNA Extraction Mini Kit to extract the gel after electrophoresis.

[0085] Step 2.3: Use the Ultra-Universal TOPO Cloning Kit from Nanjing Vazyme to connect the recovered product to the pCE3 vector: 5× Ultra-Universal TOPO Cloning Mix 2 μl, PCR recovered product 1-8 μl, ddH 2 O to 10 μl; reaction conditions were 25°C, 5 min.

[0086] Step 2.4, add all the ligation products to DH5α E. coli competent cells, incubate on ice for 30 min, then in a 42°C water bath for 50 s, incubate on ice for 2-3 min, add 500 μl of LB recovery medium, shake the cells at 37°C, 350 rpm for 45 min, take 200 μl of the bacterial solution and evenly spread it on the ampicillin medium, and culture for 12 h.

[0087] Step 2.5: Screen positive clones by PCR: 2×Rapid Taq Master Mix 10 μl, M13 PrimerMix 2 μl, bacterial solution 1 μl, ddH 2O to 20 μl; reaction conditions: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, cycle number 32, 72℃ extension for 5 min.

[0088] Step 2.6: Pick positive colonies and culture them in a 37°C incubator for 6-7 h.

[0089] Step 2.7, extract plasmid according to FastPure Plasmid Mini Kit-BOX 2 kit: 1) Centrifuge the bacterial solution for 1 min, pour out the culture medium, add 250 μl of Buffer P1 to resuspend the bacterial solution, then add 250 μl of Buffer P2 to lyse the bacteria and gently invert 7-8 times, finally add 350 μl of Buffer P3 and gently invert 7-8 times, centrifuge at 12000 rpm for 10 min; 2) Transfer the supernatant after centrifugation to the adsorption column and centrifuge for 30 s, discard the filtrate and add 500 μl of Buffer PW1, centrifuge for 30 s, discard the filtrate; 3) Add 600 μl of Buffer PW2 and centrifuge for 30 s, discard the filtrate and repeat the operation once; 4) Centrifuge the empty column for 1 min, transfer the adsorption column to a new EP tube, add 35 μl of preheated Elution Buffer, let stand for 2 min, centrifuge for 1 min, and the collected filtrate is the viral plasmid.

[0090] The above-mentioned experimental materials, prepared positive virus samples, DNA and virus plasmids of the samples to be tested, and the primers shown in Tables 1 and 2 of this embodiment are further applied to the following embodiments to demonstrate the technical effects of the present invention.

[0091] Example 2: Analysis of the effectiveness of multiplex PCR primer combinations

[0092] (1) Multiplex PCR for detection of ToLCNDV alone

[0093] Healthy tomatoes were used as negative controls, and tomato genomic DNA carrying ToLCNDV was used as a template to perform PCR amplification using ToLCNDV-AF / R shown in SEQ ID No.1 and SEQ ID No.2, and ToLCNDV-BF / R shown in SEQ ID No.3 and SEQ ID No.4 in Table 1. The 20 μl reaction system used for PCR amplification was as follows: 2 μl DNA template, 10 μl 2×RapidTaq Master Mix, and the final concentrations of ToLCNDV-AF / R and ToLCNDV-BF / R primers (used at a concentration of 10 μM) were 0.15 μM / 0.15 μM and 0.50 μM / 0.50 μM, respectively. The reaction system was finally heated with ddH2 O to 20 μl. The reaction conditions used for PCR amplification are as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 15 s, 32 cycles (referring to the number of cycles of denaturation-annealing-extension, the same below), and finally 72℃ extension for 5 min. After the amplification, 5 μl was taken and detected by electrophoresis on 1.3% agarose gel.

[0094] (2) Single PCR detection of TYLCV

[0095] Healthy tomatoes were used as negative controls, and tomato genomic DNA carrying TYLCV was used as a template to perform single PCR amplification using TYLCV-F / R shown in SEQ ID No. 5 and SEQ ID No. 6 in Table 1. The 20 μl reaction system used for PCR amplification was as follows: 2 μl DNA template, 10 μl 2× Rapid Taq Master Mix, the final concentrations of upstream and downstream primers (used at a concentration of 10 μM) were both 0.25 μM, and ddH 2 O to 20 μl. The reaction conditions used for PCR amplification are as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 15 s, 32 cycles, 72℃ extension for 5 min. After amplification, 5 μl was taken and tested on 1.3% agarose gel electrophoresis.

[0096] (3) Multiplex PCR for simultaneous detection of ToLCNDV and TYLCV

[0097] Healthy tomatoes were used as negative controls, and the tomato genomic DNA with ToLCNDV and the tomato genomic DNA with TYLCV were mixed as templates for PCR amplification using ToLCNDV-AF / R, TYLCV-F / R and ToLCNDV-BF / R shown in SEQ ID No.1 to SEQ ID No.6 in Table 1. The 20 μl reaction system used for PCR amplification was as follows: 2 μl DNA template, 10 μl 2×Rapid Taq Master Mix, and the final concentrations of ToLCNDV-AF / R, TYLCV-F / R and ToLCNDV-BF / R primers (used at a concentration of 10 μM) were 0.15 μM / 0.15 μM, 0.25 μM / 0.25 μM and 0.50 μM / 0.50 μM, respectively. The reaction system was finally heated with ddH 2O to 20 μl. The reaction conditions used for PCR amplification are as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 15 s, 32 cycles, 72℃ extension for 5 min. After amplification, 5 μl was taken and tested on 1.3% agarose gel electrophoresis.

[0098] The test results of this example are shown in Figure 2 , the description of each lane is as follows: Lane M: GeneRuler 1 kb PlusDNA Ladder, Lane 1: Simultaneous detection of ToLCNDV and TYLCV, Lane 2: Detection of ToLCNDV alone, Lane 3: Detection of TYLCV alone, Lane CK - : Negative control. Figure 2 It can be seen that the primers designed by the present invention can amplify the target fragments of ToLCNDV-A, ToLCNDV-B and TYLCV, and the negative has no bands, proving that the primers can be used for multiplex PCR detection. And the sequencing results are 99.39% similar to ToLCNDV-A China Hefei isolate PP937118.1, 98.53% similar to TYLCV China isolate MH703582.1, and 99.65% similar to ToLCNDV-B China Hefei isolate PP937119.1, proving that the gene fragments amplified by multiplex PCR are indeed from ToLCNDV and TYLCV.

[0099] Example 3: Multiplex PCR detection method design and condition optimization

[0100] In this embodiment, a multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants is designed, and the specific detection steps are as follows:

[0101] First, using the genome extracted from the sample of the Solanaceae plant to be tested as a DNA template, multiple PCR amplification was performed using the combination of primers shown in SEQ ID No. 1 to SEQ ID No. 6 in Table 1 to obtain PCR products;

[0102] Then, the PCR product is detected by agarose gel electrophoresis, and the agarose gel after the electrophoresis is placed on a gel imager for interpretation. If bands of 651 bp and 305 bp appear on the agarose gel after the electrophoresis, it is determined that ToLCNDV virus is present in the Solanaceae plant sample to be tested; if a band of 442 bp appears on the agarose gel after the electrophoresis, it is determined that TYLCV virus is present in the Solanaceae plant sample to be tested; if bands of 651 bp and 305 bp do not appear on the agarose gel after the electrophoresis, and no band of 442 bp appears, it is determined that ToLCNDV and TYLCV viruses are not present in the Solanaceae plant sample to be tested.

[0103] In this embodiment, the reaction system of the above-mentioned multiple PCR detection is: 2 μl of DNA template, 10 μl of 2×Rapid TaqMaster Mix, the final concentration of primers TYLCV-F / R is 0.25 μM, the final concentration of primers ToLCNDV-AF / R is set in multiple gradients in the range of 0.05~0.25 μM, and the final concentration of primers ToLCNDV-BF / R is set in multiple gradients in the range of 0.25~0.50 μM. The reaction system is finally heated with ddH 2 The concentration of each primer before adding into the system was 10 μM.

[0104] In this embodiment, the reaction conditions of the above multiplex PCR detection are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 53-60°C annealing for 15 s, 72°C extension for 15 s, 32 cycles of denaturation-annealing-extension, and 72°C extension for 5 min. The temperature range of the annealing program is 53-60°C. In order to explore the optimal annealing temperature, multiple temperature gradients are set within this range. Each gradient is set to an experimental group for multiplex PCR detection experiments, and the other reaction condition parameters remain unchanged.

[0105] Finally, the amplified PCR products were detected by 1.3% agarose gel electrophoresis, and the agarose gel after electrophoresis was placed on a gel imager for interpretation. If the 651 bp and 305 bp bands appeared on the agarose gel after electrophoresis, it was determined that the ToLCNDV virus was present in the Solanaceae plant sample to be tested. If the 651 bp and 305 bp bands did not appear at the same time, it was determined that the ToLCNDV virus was not present in the Solanaceae plant sample to be tested. If the 442 bp band appeared on the agarose gel after electrophoresis, it was determined that the TYLCV virus was present in the Solanaceae plant sample to be tested. If the 442 bp band did not appear, it was determined that the TYLCV virus was not present in the Solanaceae plant sample to be tested. Therefore, if the 651 bp and 305 bp bands did not appear on the agarose gel after electrophoresis, and the 442 bp band did not appear, it could be determined that the Solanaceae plant sample to be tested did not have ToLCNDV and TYLCV viruses.

[0106] The test results of this embodiment are as follows Figure 3 and Figure 4 shown. Figure 3 The results of multiplex PCR under different primer concentrations are shown in Figure 2. Figure 3 The relationship between the lanes is as follows: Lane M: GeneRuler 1 kb Plus DNA Ladder, Lane 1: ToLCNDV-AF / R, TYLCV-F / R and ToLCNDV-BF / R primers (used at a concentration of 10 μM) with final concentrations of 0.25 μM / 0.25 μM, 0.25 μM / 0.25 μM and 0.25 μM / 0.25 μM, Lane 2: 0.25 μM / 0.25 μM, 0.25 μM / 0.25 μM and 0.30μM / 0.30 μM, Lane 3: 0.25 μM / 0.25 μM, 0.25 μM / 0.25 μM and 0.40 μM / 0.40 μM, Lane 4: 0.25μM / 0.25 μM, 0.25 μM / 0.25 μM and 0.50 μM / 0.50 μM. μM, lane 5: 0.20 μM / 0.20 μM, 0.25 μM / 0.25 μM, and 0.50 μM / 0.50 μM, lane 6: 0.15 μM / 0.15 μM, 0.25 μM / 0.25 μM, and 0.50 μM / 0.50 μM, lane 7: 0.10 μM / 0.10 μM, 0.25 μM / 0.25 μM and 0.50 μM / 0.50 μM, lane 8: 0.05 μM / 0.05 μM, 0.25 μM / 0.25 μM, and 0.50 μM / 0.50 μM, lane CK - : Negative control. Figure 4The results of multiplex PCR detection at different annealing temperatures are shown in Figure 2. Figure 4 The relationship between the lanes in the figure: Lane M: GeneRuler 1 kb Plus DNA Ladder, Lane 1: annealing temperature 53.0℃, Lane 2: 53.3℃, ​​Lane 3: 54.2℃, Lane 4: 55.8℃, Lane 5: 57.2℃, Lane 6: 58.8℃, Lane 7: 59.6℃, Lane 8: 60℃, Lane CK - : Negative control. The test results of this example show that the gene fragments of ToLCNDV and TYLCV can be amplified simultaneously, and the annealing temperature and primer concentration of the multiplex PCR are optimized. The optimized optimal annealing temperature is 57.2°C, and the final concentrations of ToLCNDV-AF / R, TYLCV-F / R and ToLCNDV-BF / R primers (used at a concentration of 10 μM) after optimization are 0.15 μM / 0.15 μM, 0.25 μM / 0.25 μM and 0.50 μM / 0.50 μM, respectively.

[0107] It should be noted that in the expression method of the present invention, the final concentration of ToLCNDV-AF / R is 0.15 μM / 0.15 μM, which means that the final concentration of ToLCNDV-AF is 0.15 μM, the final concentration of ToLCNDV-AR is 0.15 μM, and the other primers are the same.

[0108] Example 4: Specificity analysis of multiplex PCR detection of ToLCNDV and TYLCV

[0109] In this example, plant genomic DNA containing ToLCCNV, ToLCTWV, TGMV, RAMV, TYLCYnV, TbCSV, TYLCCNV, ToLCNDV, and TYLCV was used as a template, and ddH 2 O was used as a blank control, and the multiplex PCR detection method designed in Example 3 (where the annealing temperature and primer concentration were all based on the optimized values ​​in Example 3) was analyzed for the detection specificity of ToLCNDV and TYLCV. The detection results are shown in Figure 5 As shown, the relationship between the lanes is as follows: Lane M: GeneRuler 1 kb Plus DNA Ladder, Lane 1: Mixture of ToLCNDV and TYLCV, Lane 2: ToLCNDV, Lane 3: TYLCV, Lanes 4 to 10: ToLCCNV, ToLCTWV, TGMV, RAMV, TYLCCNV, TbCSV and TYLCYnV, respectively; Lane CK - : Negative control. Figure 5It can be seen that this method can be used to detect viruses ToLCNDV and TYLCV, and will not produce non-specific amplification for the other 7 geminiviruses, indicating that this method has good specificity.

[0110] Example 5: Determination of sensitivity of multiplex PCR detection of ToLCNDV and TYLCV

[0111] 10 10 The viral plasmids with 10 copies / μl were diluted 10 times in sequence, and single PCR and multiple PCR amplification were performed respectively (according to the multiple PCR detection method designed in Example 3 above, and the annealing temperature and primer concentration were all in accordance with the optimized values ​​in Example 3). The results of multiple PCR amplification of ToLCNDV and the results of single PCR amplification of TYLCV are shown in Figure 6 and Figure 7 The results of multiplex PCR amplification for simultaneous detection of ToLCNDV and TYLCV are shown in Figure 8 shown. Figure 6 , Figure 7 , Figure 8 The relationship between the lanes is as follows: Lane M: GeneRuler 1 kb Plus DNA Ladder, Lane 1: 10 10 copies / μl, lane 2: 10 9 copies / μl, lane 3: 10 8 copies / μl, lane 4: 10 7 copies / μl, lane 5: 10 6 copies / μl, lane 6: 10 5 copies / μl, lane 7: 10 4 copies / μl, lane CK - :Negative control. From the above test results, it can be seen that the minimum limit of single PCR detection of ToLCNDV and TYLCV is 10 4 copies / μl, the minimum detection limit of multiplex PCR is 10 4 copies / μl, indicating that the sensitivity of multiplex PCR detection is equivalent to that of single PCR.

[0112] Example 6: Detection of ToLCNDV and TYLCV in the field using multiplex PCR

[0113] Using the multiplex PCR detection method designed in Example 3 of the present invention (wherein the annealing temperature and primer concentration are both in accordance with the optimized values ​​in Example 3), 10 suspected samples of field virus diseases were tested, and the test results are as follows: Fig. 9 As shown, Fig. 9The relationship between the lanes is as follows: Lane M: GeneRuler 1 kb Plus DNA Ladder, Lanes 1-10: Field samples, Lanes CK - :Negative control. The results showed that 3 samples were infected with TYLCV, 3 samples were infected with ToLCNDV, and 4 samples were not infected. Currently, no combined infection of ToLCNDV and TYLCV has been found. The results show that the multiplex PCR detection method for these two viruses established in the present invention is feasible for field sample detection, providing technical support for the detection of Solanaceae viruses.

[0114] The above-mentioned embodiment is only a preferred solution of the present invention and does not limit the implementation of the present invention. Relevant technicians can make some appropriate adjustments and changes to facilitate their own understanding and use without departing from the spirit and principle of the present invention. Therefore, all technical solutions obtained by equivalent replacement or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A combination of primers for simultaneously detecting two Geminiviruses on Solanaceae plants, characterized in that: comprising a first primer pair for the ToLCNDV-A coat protein gene, a second primer pair for the ToLCNDV-B mobile protein gene, and a third primer pair for the TYLCV coat protein gene; The first primer pair consists of a first upstream primer as described in SEQ ID No.1 and a first downstream primer as described in SEQ ID No.2; The second primer pair consists of a second upstream primer as described in SEQ ID No.3 and a second downstream primer as described in SEQ ID No.4; The third primer pair consists of a third upstream primer as described in SEQ ID No.5 and a third downstream primer as described in SEQ ID No.

6.

2. The combined primers for simultaneously detecting two Geminiviruses on Solanaceae plants according to claim 1, characterized in that: The size of the fragment amplified by the first primer pair is 651 bp, the size of the fragment amplified by the second primer pair is 305 bp, and the size of the fragment amplified by the third primer pair is 442 bp.

3. A multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants, characterized in that: include: S1. Using the genome extracted from the sample of the Solanaceae plant to be tested as a DNA template, multiple PCR amplification is performed using the combined primers for simultaneously detecting two geminiviruses on the Solanaceae plant as claimed in claim 1 to obtain PCR products; S2. Detect the PCR product by agarose gel electrophoresis, and place the agarose gel after the electrophoresis on a gel imager for interpretation. If bands of 651 bp and 305 bp appear on the agarose gel after the electrophoresis, it is determined that ToLCNDV virus is present in the Solanaceae plant sample to be tested; if a band of 442 bp appears on the agarose gel after the electrophoresis, it is determined that TYLCV virus is present in the Solanaceae plant sample to be tested; if bands of 651 bp and 305 bp do not appear on the agarose gel after the electrophoresis, and no band of 442 bp appears, it is determined that ToLCNDV and TYLCV viruses are not present in the Solanaceae plant sample to be tested.

4. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 3, characterized in that: The components of the reaction system used in the multiplex PCR amplification include: DNA template, 2×Rapid Taq MasterMix, a first primer pair, a second primer pair, a third primer pair and ultrapure water.

5. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 4, characterized in that: In the reaction system, the final concentrations of the two primers in the first primer pair are both 0.05-0.25 μM, the final concentrations of the two primers in the second primer pair are both 0.25-0.50 μM, and the final concentrations of the two primers in the third primer pair are both 0.25 μM.

6. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 4, characterized in that: In the reaction system, the final concentrations of the two primers in the first primer pair are both 0.15 μM, the final concentrations of the two primers in the second primer pair are both 0.50 μM, and the final concentrations of the two primers in the third primer pair are both 0.25 μM.

7. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 3, characterized in that: The reaction conditions used for the multiplex PCR amplification are: first, pre-denaturation at 95°C for 3 min, then denaturation at 95°C for 15 s, annealing at 53-60°C for 15 s, extension at 72°C for 15 s, and 32 cycles of denaturation, annealing and extension, and finally extension at 72°C for 5 min.

8. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 3, characterized in that: The reaction conditions used for the multiplex PCR amplification were: first, pre-denaturation at 95°C for 3 min, then denaturation at 95°C for 15 s, annealing at 57.2°C for 15 s, and extension at 72°C for 15 s, with 32 cycles of denaturation, annealing, and extension, and finally extension at 72°C for 5 min.

9. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 3, characterized in that: When the PCR product is detected by agarose gel electrophoresis, a negative control needs to be set, and the negative control needs to use the genome extracted from healthy tomatoes without ToLCNDV and TYLCV virus infection as a DNA template.

10. The multiplex PCR detection method for simultaneously detecting two viruses on Solanaceae plants as claimed in claim 3, characterized in that: The Solanaceae plant samples to be tested are plant leaves.

Images