Recombinant plasmid based on nuclear localization signal and PP7 RNA stem-loop structure and vector system and application thereof

Abstract

The invention discloses a recombinant plasmid based on a nuclear localization signal and a PP7 RNA (Ribonucleic Acid) stem-loop structure, the recombinant plasmid comprises NLS-cas9-NLS + 6 * PP7 RNA, and the gene sequence of the NLS-cas9-NLS + 6 * PP7 RNA is as shown in SEQ ID NO. 2. The invention also discloses an application of the recombinant plasmid in VLP, exosome, lentivirus or AAV delivery vectors. The invention also discloses an efficient VLP carrier system, which comprises the recombinant plasmid, and also comprises a plasmid for fusion expression of PP7 bacteriophage capsid protein and gag structural protein, a plasmid for expression of membrane protein, an auxiliary plasmid, a shuttle plasmid carrying gRNA and an integrase mutated pMDLg-pRRE plasmid. The invention also discloses application of the vector system in treatment of clinical diseases. The vector system can improve the gene editing efficiency.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to a recombinant plasmid based on a nuclear localization signal and a PP7 RNA stem-loop structure and a vector system and application thereof. Background Art

[0002] VLP (virus like particle) technology is derived from the lentiviral system, which can use the high affinity of the virus to achieve effective intracellular delivery. The delivery object can be nucleic acids, proteins or ribonucleoproteins (RNPs), etc. Most traditional lentiviral vectors deliver target genes in the form of DNA integration, which is continuously translated into Cas9 protein, resulting in a high probability of "off-target" effects (gene shearing that is unrelated to the original designed gene shearing effect). In actual applications, VLP can deliver Cas9 to the human body in the form of mRNA instantly, so as to achieve the purpose of treatment while greatly reducing off-target effects.

[0003] Nuclear Localization Signal (NLS) is a specific amino acid sequence in protein molecules that can guide the transfer of proteins from the cytoplasm to the nucleus. NLS usually contains positively charged amino acid residues, such as lysine and arginine, which interact with nuclear importin to promote the nuclear localization of proteins. Adding NLS sequences to both sides of the Cas9 gene can increase the nuclear entry of Cas9 protein and enhance the gene editing effect.

[0004] In the prior art, the MS2 bacteriophage capsid protein (MS2C) and the lentiviral GagPol protein are fused and expressed in the core of the VLP. Based on the principle that the stem loop structure can specifically recognize and bind to the MS2C protein, the Cas9 protein mRNA and the stem loop are fused, and then the stem loop specifically binds to the MS2C in the VLP core, and the Cas9 protein mRNA is introduced into the VLP core; at the same time, the gRNA targeting a specific gene is cloned into the lentiviral shuttle plasmid, and finally a VLP with a lentiviral structure similar to that carrying Cas9mRNA and gRNA is assembled. The VLP delivers the Cas9 mRNA and gRNA to the cytoplasm of the target cell, and by translating the cas9 protein, the gene editing effect of the CRISPR-Cas9 system is exerted in the target cell.

[0005] However, the specific binding efficiency of MS2C and stem loop in the existing lentiviral vector RNA delivery technology is low, resulting in low CRISPR-Cas9 editing efficiency. Cas9 mRNA is expressed as protein in the cytoplasm, and only a small amount enters the cell nucleus to exert the CRISPR-Cas9 editing effect, resulting in low editing efficiency.

[0006] PP7 phage capsid protein (PP7 coat protein, PCP) is a small protein that can specifically recognize and bind to certain stem-loop RNA molecules (PP7 RNA). The VLP delivery technology used in the present invention uses lentivirus as a vector skeleton, and the PCP protein and the lentivirus GagPol protein are fused and expressed in the inner core of the VLP. The principle that the stem-loop structure PP7RNA can specifically recognize and bind to the PCP protein is used to fuse the Cas9 (NLS-Cas9-NLS) mRNA with NLS and the stem-loop structure PP7 RNA, and the NLS-Cas9-NLS mRNA is introduced into the inner core of the VLP through the specific binding of PP7 RNA to the PCP in the inner core of the VLP; at the same time, the gRNA for a specific gene is cloned into the lentivirus shuttle plasmid, and finally a VLP with a lentivirus-like structure carrying NLS-Cas9-NLS mRNA and gRNA is assembled. VLP delivers NLS-Cas9-NLS mRNA and gRNA to the cytoplasm of target cells, and through the translation of NLS-Cas9-NLS protein, exerts the "transient" gene editing effect of the CRISPR-Cas9 system in the target cells. Summary of the invention

[0007] The purpose of the present invention is to provide an efficient VLP vector based on a nuclear localization signal and a PP7 RNA stem-loop structure. By replacing the stem-loop combination MS2C-Stem loop with PCP-PP7 RNA, increasing the NLS significantly improves the delivery efficiency of the VLP vector, and developing a more efficient transiently expressed VLP delivery vector.

[0008] The objective of the present invention is achieved through the following technical solutions:

[0009] <First aspect>

[0010] The invention provides a recombinant plasmid based on a nuclear localization signal and a PP7 RNA stem-loop structure. The recombinant plasmid comprises NLS-cas9-NLS+6×PP7 RNA, and the gene sequence of the NLS-cas9-NLS+6×PP7 RNA is shown in SEQ ID NO.2.

[0011] As some specific embodiments of the present invention, the recombinant plasmid is pCMV-2NLS-Cas9-6×PP7 RNA, which is constructed by replacing the sequence from GFP to poly (A) in the pCMV-GFP plasmid with NLS-cas9-NLS+6×PP7 RNA;

[0012] And / or, the gene sequence of the recombinant plasmid pCMV-2NLS-Cas9-6×PP7 RNA is shown in SEQ ID NO.8.

[0013] As some specific embodiments of the present invention, the construction method of the recombinant plasmid pCMV-2NLS-Cas9-6×PP7 RNA is: first insert the Cas9 sequence into the pCMV-GFP plasmid, then insert the 6×PP7 RNA sequence, and finally add NLS at both ends of the Cas9 gene to replace the GFP sequence.

[0014] As some specific embodiments of the present invention, the nuclear localization sequence NLS on the recombinant plasmid is located at both ends of the Cas9 gene, the gene sequence of the NLS upstream of Cas is shown in SEQ ID NO.11, and the gene sequence of the NLS downstream of Cas is shown in SEQ ID NO.12.

[0015] As some specific embodiments of the present invention, the recombinant plasmid is provided with 6 PP7 stem-loop structure RNA sequences, and the PP7 stem-loop structure RNA sequence is shown as SEQ ID NO.13.

[0016] <Second Aspect>

[0017] The present invention provides an application of the above-mentioned recombinant plasmid in a VLP, exosome, lentivirus or AAV delivery vector.

[0018] <Third Aspect>

[0019] The present invention provides a high-efficiency VLP vector system, comprising the recombinant plasmid described above, and also comprising a plasmid for fusion expression of PP7 phage capsid protein and gag structural protein, a plasmid for expressing membrane protein, an auxiliary plasmid, a shuttle plasmid carrying gRNA, and a pMDLg-pRRE plasmid with an integrase mutation.

[0020] As some specific embodiments of the present invention, the mass ratios of the membrane protein expressing plasmid, auxiliary plasmid, recombinant plasmid (pCMV-2NLS-Cas9-6×PP7 RNA), shuttle plasmid carrying gRNA, plasmid fusion expressing PP7 phage capsid protein and gag structural protein, and integrase mutated pMDLg-pRRE plasmid are (6-8):(4-9):(20-30):(20-30):(10-15):(10-15).

[0021] As some specific embodiments of the present invention, the plasmid for fusion expression of PP7 phage capsid protein and gag structural protein carries a PCP gene, the sequence of the PCP gene is shown in SEQ ID NO.1, and the PCP gene is used to express the PP7 phage capsid protein, which can specifically recognize and bind to the PP7 stem-loop structure.

[0022] As some specific embodiments of the present invention, the plasmid for fusion expression of PP7 phage capsid protein and gag structural protein is PCP-PH-Gag-Pol-D64V plasmid, which is constructed by replacing the MS2C gene in the pMS2M-PH-Gag-Pol-D64V plasmid with the PCP gene;

[0023] And / or, the gene sequence of the PCP-PH-Gag-Pol-D64V plasmid is shown in SEQ ID NO.10.

[0024] As some specific embodiments of the present invention, the shuttle plasmid carrying gRNA is a pLV-egfp-U3-AAVS1-sp.gRNA plasmid, which is constructed by inserting the EGFP gene into the pLV lentiviral shuttle plasmid and then inserting the AAVS1 gRNA.

[0025] As some specific embodiments of the present invention, the gene sequence of AAVS1gRNA on the pLV-egfp-U3-AAVS1-sp.gRNA plasmid is shown as SEQ ID NO.5, and the gene sequence of the pLV-egfp-U3-AAVS1-sp.gRNA plasmid is shown as SEQ ID NO.9.

[0026] As some specific embodiments of the present invention, the pLV-egfp-U3-AAVS1-sp.gRNA plasmid is obtained by inserting the EGFP gene into the pLV lentiviral shuttle plasmid, and inserting the sequence U6 promoter sequence into the U3 region of 3'LTR to obtain the pLV-egfp plasmid; then AAVS1 gRNA-F (sequence as shown in SEQ ID NO.3) and AAVS1gRNA-R (sequence as shown in SEQ ID NO.4) are annealed to obtain a double-stranded AAVS1 gRNA; and the pLV-egfp plasmid is then digested with Aar I enzyme, and the double-stranded AAVS1 gRNA is cloned into the pLV-egfp plasmid to obtain.

[0027] As some specific embodiments of the present invention, the pMDLg-pRRE plasmid with integrase mutation is PMDlg / pRRE-D64V plasmid, which is constructed by mutating the 64-position amino acid GAT (D) of the Integrase gene in the pol region of the pMDLg-pRRE plasmid to GTT (V).

[0028] As some specific embodiments of the present invention, the plasmid expressing membrane protein is PMD.2G plasmid, and the auxiliary plasmid is pRSV-REV.

[0029] As some specific embodiments of the present invention, the mass ratios of the plasmids PMD.2G, pRSV-REV, pCMV-2NLS-Cas9-6×PP7RNA, pLV-egfp-U3-sp.gRNA, PCP-PH-Gag-Pol-D64V and pMDlg / pRRE-D64V are (6-8):(4-9):(20-30):(20-30):(10-15):(10-15).

[0030] <Fourth Aspect>

[0031] The present invention provides an application of any of the above-mentioned VLP vector systems in the treatment and prevention of diseases.

[0032] <Fifth Aspect>

[0033] The present invention provides a use of any of the above-mentioned VLP carrier systems for delivery in animals or humans.

[0034] The present invention provides a use of any of the above-mentioned VLP carrier systems in in vitro cell delivery.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1) Replace the MS2C-stem loop combination with the PCP-PP7 RNA protein-stem loop combination to improve the mRNA delivery efficiency of the VLP vector and the CRISPR-Cas9 editing efficiency;

[0037] 2) Adding NLS at both ends of the Cas9 gene can increase the nuclear entry of Cas9 protein and the gene editing efficiency of VLP. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0039] Figure 1 Electrophoresis diagram to detect the effect of removing residual plasmid (lanes from left to right are Marker, VLP-2NLS-PCP-PP7 RNA supernatant without nuclease digestion supernatant, VLP-2NLS-PCP-PP7 RNA supernatant with nuclease digestion supernatant, VLP-MS2C-Stem loop supernatant without nuclease digestion supernatant, VLP-MS2C-Stem loop supernatant with nuclease digestion supernatant);

[0040] Figure 2 The results of fluorescence observation of the NC group, VLP-2NLS-PCP-PP7 RNA group and VLP-MS2C-Stem loop group at 96 hours after infection;

[0041] Figure 3 Figure 1 shows the flow cytometry results of the VLP-2NLS-PCP-PP7 RNA group (from left to right, the main cell population sorting diagram, the single cell sorting diagram, and the single EGFP-positive cell sorting diagram);

[0042] Figure 4 The flow cytometry results of the VLP-MS2C-Stem loop group (from left to right, the main cell population sorting diagram, the single cell sorting diagram, and the single EGFP-positive cell sorting diagram);

[0043] Figure 5 Figure 1 shows the flow cytometry results of the NC group (from left to right, the main cell population sorting diagram, the single cell sorting diagram, and the single EGFP-positive cell sorting diagram);

[0044] Figure 6 Gel electrophoresis diagram of T7E1 detection of AAVS1 editing effect (lanes from left to right are Marker, VLP-2NLS-PCP-PP7 RNA, NC, VLP-MS2C-Stem loop);

[0045] Figure 7This is the result diagram of AAVS1 gene editing efficiency in the VLP-2NLS-PCP-PP7 RNA group;

[0046] Figure 8 This is the result diagram of AAVS1 gene editing efficiency in the VLP-MS2C-Stem loop group;

[0047] Fig. 9 This is a graph showing the results of the significant difference analysis of AAVS1 gene editing efficiency between the VLP-2NLS-PCP-PP7 RNA and VLP-MS2C-Stem loop groups;

[0048] Fig.10 The results of Cas9 protein expression detection in cells infected with VLP-2NLS-PCP-PP7 RNA and VLP-MS2C-Stem loop groups at different time periods;

[0049] Fig.11 This is the plasmid map of pCMV-2NLS-Cas9-6×PP7 RNA;

[0050] Fig.12 is the plasmid map of PCCL-PGK-EGFP;

[0051] Fig.13 This is the plasmid map of pLV-egfp-U3-AAVS1-sp.gRNA;

[0052] Fig.14 is the plasmid map of PMD1g / pRRE-D64V;

[0053] Fig.15 This is the plasmid map of PCP-PH-Gag-Pol-D64V. DETAILED DESCRIPTION

[0054] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0055] Example 1 - Plasmid Construction

[0056] 1. pCMV-2NLS-Cas9-6×PP7 RNA plasmid

[0057] Replace the sequence from GFP to poly(A) in the pCMV-GFP (manufacturer: Miaoling Plasmid Platform, catalog number: P20780) plasmid with the NLS-cas9-NLS+6×PP7 RNA sequence. This was done in three steps: first insert the Cas9 sequence, then insert the 6×PP7 RNA sequence, and finally add NLS at both ends of the Cas9 gene to obtain the pCMV-2NLS-Cas9-6×PP7 RNA plasmid. The pCMV-2NLS-Cas9-6×PP7 RNA plasmid map is shown below. Fig.11 As shown, the sequence is shown in SEQ ID NO.8.

[0058] The gene sequence of NLS-Cas9-NLS+6×PP7 RNA on the constructed pCMV-2NLS-Cas9-6×PP7 RNA plasmid is shown in SEQ ID NO.2.

[0059] 2. pLV-egfp-U3-AAVS1-sp.gRNA plasmid

[0060] Insert the U6 promoter sequence into the U3 region of 3'LTR of the lentiviral shuttle plasmid PCCL-PGK-EGFP to obtain the pLV-egfp-U3 plasmid. The plasmid map of PCCL-PGK-EGFP is shown in Fig.12 shown.

[0061] Then, AAVS1 gRNA-F (sequence: CACCGGGGCCACTAGGGACAGGAT, SEQ ID NO.3) and AAVS1gRNA-R (sequence: AAACATCCTGTCCCTAGTGGCCCC, SEQ ID NO.4) were annealed to obtain a double-stranded AAVS1gRNA. The pLV-egfp plasmid was then digested with Aar I enzyme (manufacturer: ThermoFisher Scientific, catalog number: ER1581), and the AAVS1 gRNA double-stranded was cloned into the pLV-egfp-U3 plasmid to obtain the pLV-egfp-U3-AAVS1-sp.gRNA plasmid. The pLV-egfp-U3-AAVS1-sp.gRNA plasmid map is shown in FIG. Fig.13 As shown, the sequence is shown in SEQ ID NO.9.

[0062] The sequence of AAVS1 gRNA in the constructed pLV-egfp-U3-AAVS1-sp.gRNA plasmid is: GGGGCCACTAGGGACAGGAT (SEQ ID NO.5).

[0063] 3. PMDlg / pRRE-D64V plasmid transformation

[0064] The amino acid GAT (D) at position 64 of the Integrase gene in the pol region of the pMDLg-pRRE plasmid (manufacturer: addgeen, catalog number: #12251) was mutated to GTT (V). The amino acid at position 64 of the integrase of the PMDlg / pRRE plasmid was mutated. Adding this plasmid can maintain the stability of the overall structure of the VLP. The constructed PMDlg / pRRE-D64V plasmid map is shown in the figure. Fig.14 shown.

[0065] 4. PCP-PH-Gag-Pol-D64V plasmid transformation

[0066] The pMS2M-PH-Gag-Pol-D64V plasmid was purchased from Miaoling Plasmid Platform, catalog number: P37491. The MS2C gene in the plasmid was replaced with the PCP gene. The map of the PCP-PH-Gag-Pol-D64V plasmid is shown in Fig.15 As shown, the sequence is shown in SEQ ID NO.10.

[0067] The gene sequence of PCP on the constructed PCP-PH-Gag-Pol-D64V plasmid is shown in SEQ ID NO.1.

[0068] 5. PMD.2G (sequence from Addgeen (catalog number: #12259), synthesized by GenScript Biotech Co., Ltd.) and pRSV-REV (sequence from Addgeen (catalog number: #12253), synthesized by GenScript Biotech Co., Ltd.) plasmids are from the third-generation lentiviral plasmids.

[0069] Example 2 - Transfection and infection

[0070] 1. Plate cells in a 15 cm cell culture dish, adding 1.6E5 cells / cm2 to each well. 2 HEK-293T cells, cultured for 24h.

[0071] 2. After 24 h, replace the cell culture medium in the 15 cm well plate with 1 mL of 2% FBSDMEM and incubate at 37°C.

[0072] 3. Transfection was performed in a 15 cm cell culture dish at a ratio of 1 μg DNA (total): PEI (polyplus) to 2 μl. The transfection dose is shown in Table 1.

[0073] Table 1 Transfection dosage table

[0074]

[0075]

[0076] 10% FBSDMEM was replaced at 6 h after transfection, and 30 mL of supernatant was collected at 72 h and recorded as the VLP-2NLS-PCP-PP7 RNA experimental group.

[0077] 4. Removal of residual plasmids:

[0078] Nuclease was added to the collected supernatant for digestion. After 1 hour of reaction, the nucleic acid was tested for the removal of residual plasmid. Figure 1 As shown, the residual plasmid was completely removed.

[0079] 5. VLP Concentration:

[0080] The supernatant after the removal of nucleic acid was centrifuged at 4°C and 25,000 rpm for 2 h. After the supernatant was discarded, PBS with a volume of 1 / 50 of the original supernatant was added, and the supernatant was dissolved and resuspended overnight. The volume after concentration was 600 μL.

[0081] 6. Transduction titer detection (flow cytometry):

[0082] About 12 hours in advance, the plate was spread on a 24-well plate with 1E5 cells per well. For infection experiments, three groups were set up. One group of cells was added with DMEM as the NC group, one group of cells was added with VLPs based on the reported MS2C-Stem loop structure as the control, and the last group of cells was added with VLPs based on the 2NLS-PCP-PP7 RNA structure. Cells were collected 96 hours after infection, and the proportion of green fluorescence positive cells was detected by flow cytometry to calculate the transduction titer.

[0083] The fluorescence observation results are as follows Figure 2 As shown. Figure 2 It can be seen that both the VLP based on the MS2C-Stem loop structure and the VLP based on the 2NLS-PCP-PP7 RNA structure were successfully delivered, and the delivery efficiency of the two vectors was further detected by flow cytometry.

[0084] Flow cytometry: Take 100 μL of VLP suspension and infect 1E5 293T cells. Detect the proportion of green light positive cells by flow cytometry. The group with DMEM was used as negative control (NC). Figure 3-Figure 5 As shown, Figure 3 This is the flow cytometry result of VLP-2NLS-PCP-PP7RNA group. Figure 4 The flow cytometry results of the VLP-MS2C-Stem loop group (the VLP-MS2C-Stem loop used in this example comes from the prior patent 201810533437.X) are shown in Figure 2. Figure 5The results of flow cytometry in the NC group are shown in Table 2. The transduction titer of the VLP-PCP-PP7 RNA group was 3.415E7 TU / mL, and the transduction titer of the VLP-MS2C-Stem loop group was 7.06E7 TU / mL.

[0085] Table 2 Transduction titer results

[0086] Grouping Transduction titer (green fluorescence positive) VLP-2NLS-PCP-PP7 RNA group 3.415E7 TU / mL VLP-MS2C-Stem loop group 7.06E7 TU / mL

[0087] 7. AAVS1 editing efficiency detection:

[0088] The transfected and concentrated VLP supernatant was used to infect 293T cells. The cells were collected 5 days after infection. T7E1 was used to detect whether the AAVS1 gene was edited, and the grayscale was scanned to calculate the editing efficiency. The detection primers are shown in Table 3 below:

[0089] Table 3 Primer sequence list

[0090] Primer name Primer sequences T7E1-AAVS1 F CCAGACAGCCGGTCAGA(SEQ ID NO.6) T7E1-AAVS1 R CCTGCCGCCTCCTTCAGG(SEQ ID NO.7)

[0091] Figure 6 This is a gel electrophoresis diagram of the AAVS1 editing effect detected by T7E1. The results show that the degree of cleavage of the AAVS1 gene in the VLP-2NLS-PCP-PP7RNA group is higher than that in the VLP-MS2C-Stem loop group. Therefore, under the condition of the same VLP infection dose, the editing effect of the VLP-2NLS-PCP-PP7 RNA group is stronger than that of the VLP-MS2C-Stem loop group.

[0092] The transfected and concentrated VLP supernatant was used to infect 293T cells. After 5 days of infection, the cells were collected and the cell DNA was extracted. After amplification with T7E1-AAVS1 F primers, Sanger sequencing was performed, and the AAVS1 gene editing efficiency was detected by TIDE. The TIDE test results also showed that under the same VLP infection dose, the editing efficiency of the VLP-2NLS-PCP-PP7 RNA group was significantly higher than that of the VLP-MS2C-Stem loop group. The editing efficiency of the VLP-2NLS-PCP-PP7 RNA group is shown in Figure 2. Figure 7 As shown; the editing efficiency of the VLP-MS2C-Stem loop group is shown Figure 8 shown.

[0093] The editing efficiency of the VLP-2NLS-PCP-PP7 RNA group and the VLP-MS2C-Stem loop group was analyzed for significant differences. Fig. 9 As shown. Fig. 9It can also be clearly seen from the results that the editing efficiency of VLP-2NLS-PCP-PP7RNA in the present application is significantly higher than that of VLP-MS2C-Stem loop in the prior art.

[0094] 8. Cas9 WB detection

[0095] 12 hours before infection, cells were plated in 6-well cell culture plates with 1E6 cells per well. After cells adhered to the wall, VLP-2NLS-PCP-PP7 RNA group and VLP-MS2C-Stem loop group VLPs were added to the cells. Cells were collected 24h, 48h and 72h after infection for WB detection of Cas9 expression.

[0096] The expression of Cas9 protein in cells infected with VLP-2NLS-PCP-PP7 RNA and VLP-MS2C-Stem loop groups at different time periods was detected. Fig.10 shown.

[0097] After testing, the expression of Cas9 protein in both the VLP-2NLS-PCP-PP7 RNA group and the VLP-MS2C-Stem loop group could be detected at 24h and 48h after infection, while no expression of Cas9 protein was detected at 72h, indicating that Cas9 protein would be degraded at 72h, greatly reducing the risk of "off-target effect" of traditional lentiviral delivery.

[0098] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A recombinant plasmid based on a nuclear localization signal and a PP7 RNA stem-loop structure, characterized in that: The recombinant plasmid includes NLS-cas9-NLS+6×PP7 RNA, and the gene sequence of the NLS-cas9-NLS+6×PP7 RNA is shown in SEQ ID NO.

2.

2. The recombinant plasmid according to claim 1, characterized in that The recombinant plasmid is pCMV-2NLS-Cas9-6×PP7 RNA, which is constructed by replacing the sequence from GFP to poly(A) in the pCMV-GFP plasmid with NLS-cas9-NLS+6×PP7 RNA; And / or, the recombinant plasmid is pCMV-2NLS-Cas9-6×PP7 RNA, and its gene sequence is shown in SEQ ID NO.

8.

3. Use of the recombinant plasmid as claimed in claim 1 or 2 in a VLP, exosome, lentivirus or AAV delivery vector.

4. A highly efficient VLP carrier system, characterized in that: The invention comprises the recombinant plasmid as claimed in claim 1 or 2, and also comprises a plasmid fusion-expressing PP7 phage capsid protein and gag structural protein, a plasmid expressing membrane protein, an auxiliary plasmid, a shuttle plasmid carrying gRNA, and a pMDLg-pRRE plasmid with integrase mutation.

5. The high-efficiency VLP carrier system according to claim 4, characterized in that: The mass ratios of the membrane protein expressing plasmid, auxiliary plasmid, recombinant plasmid, shuttle plasmid carrying gRNA, plasmid fusion expressing PP7 phage capsid protein and gag structural protein, and integrase mutated pMDLg-pRRE plasmid are (6-8):(4-9):(20-30):(20-30):(10-15):(10-15).

6. The VLP vector system according to claim 4, characterized in that The plasmid for fusion expression of PP7 phage capsid protein and gag structural protein carries the PCP gene, and the sequence of the PCP gene is shown in SEQ ID NO.

1.

7. The VLP vector system according to claim 6, characterized in that The plasmid for fusion expression of PP7 phage capsid protein and gag structural protein is PCP-PH-Gag-Pol-D64V plasmid, which is constructed by replacing the MS2C gene in the pMS2M-PH-Gag-Pol-D64V plasmid with the PCP gene; And / or, the gene sequence of the plasmid for fusion expression of PP7 phage capsid protein and gag structural protein is shown as SEQ ID NO.

10.

8. The VLP vector system according to claim 4, characterized in that The shuttle plasmid carrying gRNA is pLV-egfp-U3-AAVS1-sp.gRNA plasmid, which is constructed by inserting the EGFP gene into the pLV lentiviral shuttle plasmid and then inserting the AAVS1gRNA; The gene sequence of AAVS1 gRNA on the pLV-egfp-U3-AAVS1-sp.gRNA plasmid is shown as SEQ ID NO.5, and the gene sequence of the pLV-egfp-U3-AAVS1-sp.gRNA plasmid is shown as SEQ ID NO.

9.

9. The VLP vector system according to claim 4, characterized in that The pMDLg-pRRE plasmid with integrase mutation is PMDlg / pRRE-D64V plasmid, which is constructed by mutating the 64-position amino acid GAT (D) of the Integrase gene in the pol region of the pMDLg-pRRE plasmid to GTT (V); And / or, the plasmid expressing membrane protein is PMD.2G plasmid, and the auxiliary plasmid is pRSV-REV.

10. Use of the VLP vector system according to any one of claims 4 to 9 in the treatment and prevention of diseases.

11. Use of the VLP carrier system as described in any one of claims 4 to 9 for delivery in animals or humans.

12. Use of the VLP carrier system as described in any one of claims 4 to 9 in in vitro cell delivery.

Images