CD24 knockout lung cancer cell line as well as construction method and application thereof

Abstract

The invention discloses a CD24-knockout lung cancer cell line as well as a construction method and application thereof. According to the invention, sgRNA specifically targeting human CD24 is firstly designed, and CD24 genes in human lung cancer cell lines PC-9, HCC827 and H1975 cells are successfully knocked out through a CRISPR-Cas9 gene editing technology. Protein expression is detected through Western blot, and Sanger sequencing is carried out, so that the success of knockout cell construction is proved. The lung cancer cell line can be used for researching the action mechanism of CD24 in lung cancer; and an anti-lung cancer drug for screening the targeted CD24. Therefore, the cell line can be widely applied to scientific research and clinical related basic research.

Description

Technical Field

[0001] The invention relates to a CD24 knockout lung cancer cell line and a construction method and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Non-small cell lung cancer is one of the most common malignant tumors in the world, with high morbidity and mortality. Research on non-small cell lung cancer has become the key to treating the disease. Among them, the establishment and application of non-small cell lung cancer cell lines are of great significance for studying the pathophysiological mechanism of lung cancer, screening effective drugs and treatment methods, and evaluating the effectiveness of treatment plans. HCC827, H1975 and PC9 are relatively important cell lines.

[0003] CD24 is a cell surface antigen that is highly expressed in many tumors, including lung cancer. Studies have shown that high expression of CD24 is associated with drug resistance and poor prognosis in tumor patients. CD24 promotes the growth, proliferation, metastasis and invasion of tumor cells by participating in related signal transduction pathways that mediate the occurrence and development of tumors, such as the Wnt signaling pathway and the MAPK signaling pathway. In addition, CD24 is an important signal molecule against macrophage phagocytosis of "don't eat me". CD24 can bind to Siglec-10 on macrophages and release signals that inhibit macrophage phagocytosis of tumor cells, thereby escaping immune surveillance. Lung cancer cells with CD24 knockout are of great significance for in-depth research on the role and mechanism of CD24.

[0004] Currently, the development of targeted drugs for CD24, especially antibody drugs, is in an active stage, including monoclonal antibodies, bispecific antibodies, antibody-drug conjugates and other forms. These drugs are designed to restore the anti-tumor function of macrophages by blocking the interaction between CD24 and Siglec-10, thereby achieving the purpose of treating tumors. For example, ATG-031, IMM47 and IMM4701 are all CD24 antibody drugs, which have shown strong anti-tumor efficacy in preclinical studies.

[0005] As a highly glycosylated protein, CD24 presents special challenges in the development of antibodies against it. Glycosylation of CD24 is essential to its structure and function. The addition of sugar chains not only affects the protein folding of CD24, but also directly participates in its interaction with receptors (such as Siglec-10), thereby regulating biological functions such as immune escape. In order to develop antibodies that can effectively block the function of CD24, it is necessary to ensure that the antibody targets the correctly glycosylated CD24 epitope, while incorrect glycosylation or lack of glycosylation may result in the antibody being unable to recognize or bind to the target protein. CD24 proteins directly synthesized in vitro often cannot obtain the same glycosylation modifications as in vivo, which may result in the inability of the prepared antibodies to specifically recognize or bind to glycosylated CD24 in its native state.

[0006] By immunizing mice with cells that normally express CD24, it is possible to ensure that the antibodies produced in the mice are directed against CD24 that is correctly glycosylated and in its native conformation. This approach helps to obtain antibodies with high specificity and affinity. Using cells that knock out CD24 as a control ensures that the antibodies obtained are indeed directed against CD24, rather than against other unrelated proteins or cell components. By comparing the binding of antibodies to cells that normally express CD24 and cells that knock out CD24, specific antibodies against CD24 can be accurately identified, eliminating interference from nonspecific antibodies.

[0007] However, there is currently no suitable lung cancer cell line that can be used to study the mechanism of action of CD24 or to develop anti-lung cancer drugs targeting CD24. Summary of the invention

[0008] The purpose of the present invention is to construct a lung cancer cell line with CD24 knocked out, so as to study the role and mechanism of CD24 in lung cancer and develop anti-tumor drugs or antibodies targeting CD24.

[0009] In order to achieve the above object, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a CD24 knockout lung cancer cell line, wherein the CD24 knockout lung cancer cell line comprises CD24 knockout PC-9, HCC827, or H1975 cells;

[0011] Wherein, the PC-9 cells with CD24 knockout have both copies of CD24 lacking 7 bases GGGCTGG;

[0012] The CD24 knockout HCC827 cells have one copy of CD24 lacking 7 bases GGGCTGG, and the other copy lacking 17 bases GCTCGGGCTGGGGCTGC;

[0013] The CD24 knockout H1975 cells have one copy of CD24 lacking 17 bases GCTCGGGCTGGGGCTGC, and the other copy lacking 22 bases ATGGTGGCCAGGCTCGGGCTGG.

[0014] Preferably, the CD24 knockout lung cancer cell line is a lung cancer cell line PC-9, HCC827, or H1975 cell in which CD24 is knocked out by CRISPR / Cas9 gene editing under the combined action of sgRNA and Cas9 protein; the sequence of the sgRNA is shown in SEQ ID NO: 1

[0015] In a second aspect, the present invention provides an sgRNA for constructing a CD24 knockout lung cancer cell line, wherein the synthetic primers of the sgRNA include a forward primer having a sequence as shown in SEQ ID NO: 1 and a reverse primer as shown in SEQ ID NO: 2.

[0016] In a third aspect, the present invention provides a biological material comprising the sgRNA described in the second aspect, characterized in that the biological material is one or more of a vector, an expression cassette or a transgenic cell.

[0017] In a fourth aspect, the present invention provides use of the sgRNA described in the second aspect or the biomaterial described in the third aspect in the preparation of a reagent or a kit for constructing a CD24 knockout lung cancer cell line.

[0018] In a fifth aspect, the present invention provides a kit for constructing a lung cancer cell line with CD24 knockout, the kit comprising: the sgRNA described in the second aspect or the biological material described in the third aspect, and a detection reagent for verifying CD24 gene knockout.

[0019] Preferably, the detection reagent is a reagent for detecting whether the CD24 gene is knocked out by Western blot and / or Sanger sequencing.

[0020] Preferably, the reagent for detecting whether the CD24 gene is knocked out by Sanger sequencing comprises a sequencing primer, and the sequence of the sequencing primer is shown in SEQ ID NOs: 4-5.

[0021] In a sixth aspect, the present invention provides a method for constructing a lung cancer cell line with CD24 knockout according to the first aspect, comprising: using a CRISPR / Cas9 gene editing method to transfect a lentivirus encoding CD24 sgRNA and Cas9 into a lung cancer cell line, followed by puromycin selection; thereafter, performing monoclonal isolation, and verifying the successful knockout of the CD24 gene by Western blot and / or Sanger sequencing, wherein the lung cancer cell line is PC-9, HCC827, or H1975 cells.

[0022] In a seventh aspect, the present invention provides a use of the lung cancer cell line with CD24 knockout according to the first aspect, wherein the use is selected from the following group:

[0023] a) for studying the mechanism of action of CD24 in lung cancer; and / or,

[0024] b) Used to screen anti-lung cancer drugs targeting CD24.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention successfully constructs a CD24-knockout lung cancer cell line, which can be widely used in basic research on the interaction between lung adenocarcinoma and its target CD24, and can also be used for the development of anti-tumor drugs. The lung cancer cell line constructed by the present invention is of great significance for screening effective anti-lung cancer drugs and treatment methods and evaluating the effectiveness of treatment plans. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The results of CD24 expression in PC-9, HCC827, and H1975 cell lines with normal CD24 expression and CD24 knockout (ΔCD24) are shown.

[0028] Figure 2 These are the Sangon sequencing results of CD24 in PC-9, HCC827, and H1975 cell lines in which CD24 was knocked out (ΔCD24). DETAILED DESCRIPTION

[0029] In order to make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0030] Example

[0031] In this example, the CRISPR / Cas9 method was used to construct a lung cancer cell line with CD24 knockout, and the specific steps were as follows:

[0032] 1) Design the corresponding sgRNA (5'-ATGGTGGCCAGGCTCGGGCT-3', SEQ ID NO: 1) according to the CD24 exon sequence. Synthesize the double-stranded DNA sequence corresponding to the sgRNA, which includes a coding strand (SEQ ID NO: 1) and a complementary strand (5'-ATGGTGGCCAGGCTCGGGCT-3', SEQ ID NO: 2). The sgRNA coding strand and the complementary strand are annealed to form a sgRNA double-stranded DNA, which is inserted into the GV371 plasmid vector under the control of the U6 promoter to construct a U6-sgRNA-SV40-EGFP plasmid vector and encapsulate the lentivirus.

[0033] 2) Transfect Cas9 lentivirus into lung cancer cell lines (PC-9, HCC827 or H1975 cells), and use it for subsequent transfection of sgRNA lentivirus to knock out CD24 after successful monoclonal screening;

[0034] 3) The lentivirus in step 1) was transfected into the Cas9 lung cancer cell line in step 2), followed by puromycin selection. Monoclonal isolation was then performed and Western blot was performed ( Figure 1 ) and Sanger sequencing ( Figure 2 ) verified the successful knockout of CD24 gene. The primers used for sequencing were: upstream primer 5'-CGGCTATTGTGGCTTTCCTGGTAT-3' (SEQ ID NO: 3), downstream primer 5'-GCAGCACGCAAGGGAATGGA-3' (SEQ ID NO: 4). Sanger sequencing results showed that both copies of CD24 of PC-9 were missing 7 bases (GGGCTGG). One copy of CD24 of HCC827 was missing 7 bases (GGGCTGG), and the other copy was missing 17 bases (GCTCGGGCTGGGGCTGC, SEQ ID NO: 5). One copy of CD24 of H1975 was missing 17 bases (GCTCGGGCTGGGGCTGC, SEQ ID NO: 6), and the other copy was missing 22 bases (ATGGTGGCCAGGCTCGGGCTGG, SEQ ID NO: 7).

[0035] The CD24 knockout lung cancer cell line constructed by the present invention can be used to study the role and mechanism of CD24 in lung cancer, and to develop anti-lung cancer drugs and treatment methods targeting CD24. The anti-cancer drugs include but are not limited to antibodies that specifically target CD24.

[0036] The above description is only a preferred embodiment of the present invention and is not any formal or substantial limitation of the present invention. It should be pointed out that a person skilled in the art can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the protection scope of the present invention.

Claims

1. A CD24 knockout lung cancer cell line, characterized in that: The lung cancer cell lines with CD24 knockout include CD24 knockout PC-9, HCC827, or H1975 cells; Wherein, the PC-9 cells with CD24 knockout have both copies of CD24 lacking 7 bases GGGCTGG; The CD24 knockout HCC827 cells have one copy of CD24 lacking 7 bases GGGCTGG, and the other copy lacking 17 bases GCTCGGGCTGGGGCTGC; The CD24 knockout H1975 cells have one copy of CD24 lacking 17 bases GCTCGGGCTGGGGCTGC, and the other copy lacking 22 bases ATGGTGGCCAGGCTCGGGCTGG.

2. The CD24 knockout lung cancer cell line according to claim 1, characterized in that: The CD24 knockout lung cancer cell line is obtained by knocking out CD24 in lung cancer cell lines PC-9, HCC827, or H1975 cells through CRISPR / Cas9 gene editing under the joint action of sgRNA and Cas9 protein; the sequence of the sgRNA is shown in SEQ ID NO:

1.

3. A sgRNA for constructing a lung cancer cell line for knocking out CD24, characterized in that: The synthetic primers for the sgRNA include a forward primer whose sequence is shown in SEQ ID NO: 2 and a reverse primer whose sequence is shown in SEQ ID NO:

3.

4. A biological material comprising the sgRNA according to claim 3, characterized in that The biological material is one or more of a vector, an expression cassette or a transgenic cell.

5. Use of the sgRNA according to claim 3 or the biomaterial according to claim 4 in preparing a reagent or a kit for constructing a lung cancer cell line with CD24 knockout.

6. A kit for knocking out CD24 or constructing a lung cancer cell line with knocked out CD24, characterized in that: The kit comprises: the sgRNA according to claim 3 or the biological material according to claim 4, and a detection reagent for verifying CD24 gene knockout.

7. The kit according to claim 6, characterized in that The detection reagent is a reagent for detecting whether the CD24 gene is knocked out by Western blot and / or Sanger sequencing.

8. The kit according to claim 7, characterized in that The reagent for detecting whether the CD24 gene is knocked out by Sanger sequencing comprises a sequencing primer, and the sequence of the sequencing primer is shown in SEQ ID NOs: 4-5.

9. The method for constructing a CD24 knockout lung cancer cell line according to claim 1 or 2, characterized in that: include: Using the CRISPR / Cas9 gene editing method, lentivirus encoding CD24 sgRNA and Cas9 was transfected into lung cancer cell lines, followed by puromycin selection; Then, monoclonal isolation is performed, and successful knockout of the CD24 gene is verified by Western blot and / or Sanger sequencing. The lung cancer cell line is PC-9, HCC827, or H1975 cells.

10. Use of the CD24 knockout lung cancer cell line according to claim 1 or 2, wherein the use is selected from the group consisting of: a) for studying the mechanism of action of CD24 in lung cancer; and / or, b) Used to screen anti-lung cancer drugs targeting CD24.

Images