KASP molecular marker for identifying occurrence of pepper mosaic and application thereof
By developing a KASP molecular marker at the 122883926bp site on chromosome 12 of pepper, and combining it with a specific primer set and the KASP platform, the problem of early screening of pepper flowers and leaves was solved, enabling efficient pepper breeding screening and germplasm identification, and improving breeding efficiency.
Patent Information
- Application Number
- CN202311727225.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2043-12-14
AI Technical Summary
Existing technologies make it difficult to screen for chili flower and leaf occurrence in advance, resulting in long breeding cycles and low screening accuracy, which affects chili yield and ornamental value.
A KASP molecular marker was developed, located at the 122883926bp site on chromosome 12 of pepper. Using a competitive allele-specific PCR (KASP) marker platform and a specific primer set, a linkage genetic map of pepper mosaic traits was constructed to achieve typing and screening of different leaf types in pepper.
This technology enables convenient identification of chili flower and leaf occurrence in the laboratory, shortens breeding screening time, improves screening accuracy, provides more superior chili germplasm resources, and provides technical support for chili germplasm identification and strain selection.
Smart Images

Figure CN120158538B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker breeding technology. More specifically, it relates to a KASP molecular marker for identifying flower and leaf occurrence in peppers and its application. Background Technology
[0002] Chili pepper (Capsicum annuum L.) is an annual herbaceous plant belonging to the genus Capsicum in the Solanaceae family. Chili peppers are an important vegetable crop and can also be used as ornamental plants. Identifying and screening superior chili pepper germplasm materials is of great significance for breeding leaf-producing and ornamental chili pepper varieties, as well as improving chili pepper yield and resistance. However, chili peppers exhibit mottled leaf phenomenon, where the leaves of the germplasm-producing chili pepper plants show irregular white chlorosis, also known as chili pepper mosaic. This phenomenon is mainly caused by mutations in chloroplast-related genes, ultimately affecting the plant's photosynthesis, leading to mosaic symptoms, reduced yield, and decreased ornamental value of the leaves, seriously hindering the breeding of superior chili pepper germplasm resources.
[0003] Currently, it is difficult to detect and screen for chili pepper mosaic patterns in advance. Traditional field identification of chili pepper mosaic patterns has a long breeding cycle and low accuracy. However, with the advancement of modern molecular biotechnology, molecular marker-assisted selection breeding has been applied to the selection of superior traits in chili pepper germplasm resources. Single nucleotide polymorphisms (SNPs) are distributed on chromosomes and have advantages such as rich polymorphism and good genetic stability. They are widely used in research such as species genetic diversity analysis, core germplasm bank construction, genetic map construction, and variety identification, and are important markers for molecular breeding applications. Existing technologies have only disclosed molecular markers linked to chili pepper leaf yellowing genes and SNP molecular markers related to the yellow-green trait of chili pepper leaves, which are used to screen and identify chili pepper plants with yellow-green leaves. To date, there are few research reports on molecular markers related to the occurrence of mosaic (the appearance of irregular white chlorosis) in peppers and genes related to the cause of mosaic chlorosis. In order to reduce the occurrence of mosaic in peppers and screen out pepper plants with normal leaves in advance, more molecular markers need to be developed for the breeding of superior pepper germplasm resources, so as to provide technical support and more means for pepper germplasm identification and healthy line breeding. Summary of the Invention
[0004] The technical problem to be solved by this invention is to overcome the defects and shortcomings of existing pepper breeding methods that cannot screen for pepper mottled leaves in advance and avoid the occurrence of mottled leaves, and to provide a KASP molecular marker for identifying pepper mottled leaves and its application.
[0005] The purpose of this invention is to provide a KASP molecular marker for identifying the occurrence of flower and leaf development in peppers.
[0006] Another object of the present invention is a specific primer set for detecting KASP molecular markers.
[0007] Another object of the present invention is to provide the application of the KASP molecular marker for identifying pepper flower and leaf occurrence and its detection primer set.
[0008] Another object of the present invention is to provide a kit for detecting different leaf shapes of chili peppers.
[0009] Another object of the present invention is to provide a method for screening or identifying the occurrence of pepper flowers and leaves.
[0010] Another object of the present invention is to provide a method for differentiating pepper flower and leaf types or selecting pepper plants with normal leaves.
[0011] The above-mentioned objective of this invention is achieved through the following technical solution:
[0012] This invention provides a KASP molecular marker for identifying the occurrence of flower buds in peppers. The KASP molecular marker is located at the 122883926bp site on chromosome 12 of pepper. The base at this site is T in normal leaves and A in flower buds.
[0013] This invention constructs a linkage genetic map of the mosaic trait in chili peppers based on segregating populations of different leaf types (normal leaves and mosaic leaves), locates the strongest candidate gene controlling the mosaic trait, develops a KASP molecular marker for identifying mosaic occurrence in chili peppers, and conducts marker-assisted breeding based on a competitive allele-specific PCR (KASP) marker platform. It provides a method for differentiating chili pepper mosaic types or selecting normal-leaf plants. Detection using KASP marker primers allows for the differentiation of different leaf types in chili pepper plants, identifying both mosaic and normal-leaf plants in both parent and offspring populations. Combined with field phenotypic analysis, the concordance rate reaches 84.21%, demonstrating significant application value for chili pepper germplasm identification and healthy line selection.
[0014] This invention provides a specific primer set for detecting and identifying KASP molecular markers for the occurrence of flower and leaf development in peppers. The primer set contains primer 1: 5-'GAAGGTGACCAAGTTCATGCTACATCGCCTCGT TTTACCACAT-3', primer 2: 5-'GAAGGTCGGAGTCAACGGATTACATCGCCT CGTTTTACCACAA-3', and primer 3: 5-'TGGGAATGATTGAGGAAACTAGCA-3'.
[0015] This invention provides the application of KASP molecular markers for identifying pepper mosaicism, or their detection primer sets, in detecting different leaf types of pepper, screening or identifying pepper mosaicism, pepper mosaicism classification, or in breeding pepper plants with normal leaves, or in preparing kits for detecting different leaf types of pepper.
[0016] This invention provides a kit for detecting different leaf types in chili peppers, the kit containing a specific primer set for detecting and identifying KASP molecular markers for chili pepper flower and leaf development.
[0017] Preferably, the primer set contains primer 1: 5-'GAAGGTGACCAAGTTCATGCTACATCGCCTCGTTTTACCACAT-3', primer 2: 5-'GAAGGTCGGAGTCAACGGATTACATCGCCTCGTTTTACCACAA-3', and primer 3: 5-'TGGGAATGATTGAGGAAACTAGCA-3'.
[0018] Preferably, the kit further contains reagents for extracting DNA from the sample to be tested.
[0019] This invention provides a method for screening or identifying the occurrence of chili pepper mosaic, which involves detecting the 122883926bp site on chromosome 12 of the plant to be tested. Plants with an A base at this site are chili pepper mosaics, while plants with a T base at this site are normal leaves.
[0020] This invention also provides a method for differentiating pepper flower and leaf types or selecting pepper plants with normal leaves, comprising the following steps:
[0021] S1. Extract DNA from the sample to be tested;
[0022] S2. Using the sample extracted in step S1 as a template, qPCR detection was performed using a specific primer set for the KASP molecular marker used to detect and identify pepper mosaicism.
[0023] S3. Analyze the detection results of step S2 using qPCR genotyping software; if the genotyping result is close to the x-axis, mark it as X; if the genotyping result is in the middle of the x-axis and y-axis, mark it as XY; if the genotyping result is close to the y-axis, mark it as Y.
[0024] Furthermore, in step S3, the plants identified as Y are chili pepper plants with mosaic leaves, while the plants identified as XY and X are chili pepper plants with normal leaves.
[0025] Preferably, the qPCR detection system is as follows: 5 μL of 2×PARMS Pro SNP Gentyping PCR Mix, 0.075 μL of F-Primer 1, 0.075 μL of F-Primer 2, 0.2 μL of R-Primer 3, 2 μL of DNA, and 5 μL of ddH2OTo.
[0026] Preferably, the qPCR reaction program is as follows: 94℃, 15 min; 94℃, 20 s; 78℃, 10 s; 62℃, 1 min; 10 cycles; 94℃, 20 s; 57℃, 1 min; 30 cycles; 25℃, 1 min.
[0027] More preferably, in step S3, the qPCR built-in typing software BioRadCFXmanager is used for typing and the results are viewed.
[0028] The present invention has the following beneficial effects:
[0029] This invention provides a KASP molecular marker for identifying mosaicism in chili peppers and its application. Based on segregating populations of different chili pepper leaf types (normal leaves, mosaic), a linkage genetic map of the mosaic trait was constructed, locating the strongest candidate gene controlling this trait. A KASP molecular marker and its primers for identifying chili pepper mosaicism were obtained. Using this marker and primers, the mosaicism status of chili pepper germplasm can be identified in advance, healthy chili pepper plants with normal leaves can be screened, and differentiating leaf types in selected chili pepper germplasm can be performed. Simultaneously, this invention provides a method for chili pepper mosaicism classification or for selecting chili pepper plants with normal leaves. Different leaf types of chili pepper plants can be identified and distinguished through routine laboratory amplification testing. The method is convenient, easy to operate, and can be used in advance for screening and identifying chili pepper mosaicism, shortening the breeding screening time. It also provides more superior chili pepper germplasm resources, providing technical support for chili pepper germplasm identification and strain selection. Attached Figure Description
[0030] Figure 1 The genetic diagram of leaf morphology for the 59×Z81 hybrid combination is shown in Figure a (a) is the hybridization diagram of the normal leaf "59" (mother parent) and the mosaic leaf "Z81" (father parent), and Figure b is the phenotypic diagram of the hybridization of peppers with different leaf types.
[0031] Figure 2 The distribution of G-values across chromosome sets is shown in diagrams (a is the distribution of Δ(SNP-index), and b is the linkage candidate interval for the mosaic trait on chromosome 12).
[0032] Figure 3 Genetic linkage map of leaf color mutation in chili peppers.
[0033] Figure 4 The results show the genotyping of the ILITYHIA gene in the parents and the F1 (a) and F2 (b) populations. Detailed Implementation
[0034] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0035] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0036] The parent chili peppers “59” (mother P1) and “Z81” (father P2) used in this invention, as well as the offspring F1 and F2 chili peppers, were all grown at South China Agricultural University.
[0037] Example 1: Phenotypic Analysis and Genetic Linkage Map Construction of Pepper Mosaic Development
[0038] 1. Phenotypic Analysis
[0039] Field statistics revealed that the F1 generation of pepper plants obtained by crossing the normal-leaved "59" (female parent) and the variegated "Z81" (male parent) peppers with bagged leaves all exhibited normal-leaved leaves, indicating that normal leaves are a dominant trait in peppers. Figure 1 a). In the F2 segregating population (466 plants) obtained by self-pollination of F1 generation plants with bags, 362 plants had normal leaves and 104 plants had mosaic leaves. Figure 1 b) The chi-square test showed that the segregation ratio basically followed the normal leaf:floral leaf = 3:1, with a P value of 0.32 > 0.05, which is consistent with the genetic law of single gene control.
[0040] 2. Genome resequencing
[0041] Genome resequencing was performed on two parental pools of peppers, No. 59 (sequencing completed) and No. Z81, as well as on two extreme F2 generation plants with "mottled" and "normal" leaves. The sequencing depth of the parental pools was 20x, and the sequencing depth of the extreme F2 generation pools was 50x (approximately 10% of the F2 generation population). Using the MGI-seq 2000 high-throughput sequencing platform (manufactured by Shenzhen BGI Genomics Co., Ltd.), a total of 392.79 Gb of data was generated, with an average Q20 of 97.1% and an average Q30 of 90.6%. GC content was normal, as shown in Table 1 below. This indicates that the amount of data obtained through sequencing is sufficient and the data quality is high, suitable for subsequent experimental analysis.
[0042] Table 1 Summary of Genome Resequencing Data
[0043]
[0044] 3. Initial localization results of BSA-seq for pepper leaf color
[0045] Using the "CA59" pepper genome from our research group as the reference genome, we detected single nucleotide polymorphisms (SNPs) and short insertion / deletion (InDel) variations using genome retesting data from two mixed pools of leaves with extreme leaf colors from both parents and the F2 generation. We calculated SNP-index and Gprime values using high-quality SNP data from mixed pools of "mosaic" and "normal" leaves. Then, we calculated the difference to obtain the Δ(SNP-index) value, and plotted the Δ(SNP-index) distribution and the distribution of Gprime on chromosomes based on the results. Using the Δ(SNP-index) as the screening threshold at a 95% confidence level, we found a significant peak on chromosome 12. Figure 2 a) Located at 7.29 Mb-256.84 Mb, with a length of 251.2 Mb. This peak is used as a candidate region for the gene controlling leaf color mutation in this population for further research.
[0046] 4. Linkage genetic map of pepper flower and leaf traits
[0047] Based on the preliminary mapping results of the above-mentioned pepper mosaic gene, the linkage candidate region for the mosaic trait is located at position 7.29Mb-256.84Mb (251.2Mb) on chromosome 12. Figure 2 (b) To further narrow down the candidate regions, molecular markers were developed using DNA from P1, P2, F1, and 466 F2 plants as templates. Based on the genotyping of polymorphic InDels in the F2 population, linkage genetic maps were constructed using QTL IicMapping software.
[0048] Twenty-three polymorphic markers were screened from candidate regions on chromosome 12 for the construction of linkage genetic maps. The results showed that the regions linked to the mosaic trait of pepper were located between KASP2 and KASP3. Figure 3 The physical location of the marker is 122883926bp-122949130bp, the physical distance is 65.204Kb, the genetic distance is 1.21cM, the LOD value is 40.15, and the contribution rate is 29.55%.
[0049] Example 2: Analysis of candidate genes within the genetic candidate interval for pepper mosaic
[0050] 1. Sequence analysis and functional annotation of candidate genes
[0051] Seven candidate genes were located in the candidate regions screened in Example 1 using Diamond and BLAST software. The CDS sequences of these seven candidate genes were then aligned to the NT, NR, and Swissprot databases for functional annotation. The results showed that all seven genes within the candidate regions were annotated, as shown in Table 2. A search for genes related to pepper mosaic patterns revealed an ILITYHIA (Capann_ca59V2g38035) gene within the region located in this invention, which may be an important candidate gene for the mosaic trait in this population of peppers.
[0052] Table 2 Gene function annotations within candidate regions for pepper mosaic patterns
[0053]
[0054] 2. Expression analysis of candidate genes
[0055] To identify the strongest candidate gene controlling the flower and leaf traits of pepper, CDS sequences of all candidate genes within the candidate region were extracted. Specific primers were set for each candidate gene, and the expression levels of different candidate genes in both parents were detected. The ubiquitin extension protein gene CA12g20490 of pepper was used as an internal reference gene, and quantitative real-time PCR was performed using ChamQUniversal SYBR qPCR Master Mix from Nanjing Novizan Biotechnology Co., Ltd.
[0056] Quantitative real-time PCR experiments revealed that only ILITYHIA (Capann_ca59V2g38035) showed a significant difference in expression levels between the two parents, suggesting that ILITYHIA is a key candidate gene controlling the mosaic trait of peppers in this population.
[0057] Example 3: Development and Validation of KASP Molecular Markers for Identifying Flower and Leaf Development in Peppers
[0058] Analysis in Example 2 showed that the ILITYHIA gene is considered a key gene controlling the mosaic trait in peppers in this population, located at positions 122862093bp-122885329bp on chromosome 12. Resequencing of the parent genomes revealed five SNPs in the full-length ILITYHIA gene. Using genomic sequence and variation information, the sequences before and after the variant sites within a 200bp range were extracted. Primers were designed using SNPWay (http: / / www.snpway.com / ), and BLAST was performed on the SolGenomics Network (https: / / solgenomics.net / tools / blast / ) to detect the uniqueness of the sequences in the pepper genome. Only the KASP2 locus at position 122883926 was found to be unique.
[0059] Subsequently, primers for this site were designed and synthesized (Table 3), and the polymorphism was detected by real-time PCR in both parents and F1 cells. The real-time PCR reaction system is shown in Table 4 below. The real-time PCR reaction program was as follows: 94℃, 15 min; 94℃, 20 s; 78℃, 10 s; 62℃, 1 min; 10 cycles; 94℃, 20 s; 57℃, 1 min; 30 cycles; 25℃, 1 min. Genotyping analysis was performed using the BioRadCFXmanager software built into the real-time PCR instrument.
[0060] Table 3 Primer information for KASP markers
[0061]
[0062] Table 4. Real-time PCR reaction system
[0063]
[0064] Using BioRad CFXmanager software to view the quantitative phenotyping results, it was found that the KASP2 primers were polymorphic in both parents and the F1 generation. The results are as follows: Figure 4 As shown in Figure a, Z81 (P2) clusters near the Y-axis with blue squares (Allele 2), and the peppers exhibit mottled leaves; F1 clusters near the diagonals of the X and Y axes (located in the middle of the horizontal and vertical axes) with green triangles (Heterozygote), and the peppers exhibit normal leaves; and 59 (P1) clusters near the X-axis with orange dots (Allele 1), and the peppers exhibit normal leaves. This cluster can be used for genotyping detection in the subsequent F2 generation population.
[0065] Further genotyping analysis was performed on 384 F2 generation plants using the same methods as above, and the results are as follows: Figure 4 As shown in b, 82 F2 plants were found to be identical to the P1 phenotype; 93 were identical to the P2 phenotype; and 197 were identical to the F1 phenotype. Combined with field phenotypes, it was found that among the 384 F2 generation plants, 380 had known phenotypes, and 320 plants had phenotypes consistent with the phenotype, resulting in a concordance rate of 84.21%. This concordance rate can be used for detecting, screening, and identifying pepper mosaic patterns, and for genotyping pepper plants with different leaf types, thereby obtaining superior pepper germplasm resources.
[0066] In summary, this invention constructs a linkage genetic map of chili pepper mosaic traits based on segregating populations of different chili pepper leaf types (normal leaves and mosaic), identifies the strongest candidate gene controlling chili pepper mosaic traits, develops a KASP molecular marker for identifying chili pepper mosaic occurrence, and provides a method for chili pepper mosaic typing or selecting normal leaf plants for chili pepper breeding. Using KASP markers and primers, different chili pepper leaf types can be typified, and both mosaic and normal leaf plants can be identified in both parent and offspring populations. Combined with field phenotypic analysis, the consistency rate reaches 84.21%. This allows for earlier screening and identification of chili pepper mosaic occurrence, shortening the breeding screening time, and also provides more superior chili pepper germplasm resources, offering technical support for chili pepper germplasm identification and strain selection.
[0067] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a specific primer set of KASP molecular markers for detecting pepper mosaicism in screening or identifying pepper mosaicism and pepper mosaic typing, characterized in that, The primer set includes primer 1: 5'-GAAGGTGACCAAGTTCATGCTACATCGCCTCGTTTTACCACAT-3', primer 2: 5'-GAAGGTCGGAGTCAACGGATTACATCGCCTCGTTTTACCACAA-3', and primer 3: 5'-TGGGAATGATTGAGGAAACTAGCA-3'; the pepper mosaic typing is used to identify and distinguish between normal leaves and mosaic characteristics of peppers.
2. The application of a specific primer set for detecting KASP molecular markers in pepper mosaic in the selection of pepper plants with normal leaves and pepper mosaic traits, characterized in that, The primer set includes primer 1: 5'-GAAGGTGACCAAGTTCATGCTACATCGCCTCGTTTTACCACAT-3', primer 2: 5'-GAAGGTCGGAGTCAACGGATTACATCGCCTCGTTTTACCACAA-3', and primer 3: 5'-TGGGAATGATTGAGGAAACTAGCA-3'.
3. The application of a specific primer set of KASP molecular markers for detecting flower and leaf development in the preparation of a kit for detecting different leaf types in peppers, characterized in that... The primer set includes primer 1: 5'-GAAGGTGACCAAGTTCATGCTACATCGCCTCGTTTTACCACAT-3', primer 2: 5'-GAAGGTCGGAGTCAACGGATTACATCGCCTCGTTTTACCACAA-3', and primer 3: 5'-TGGGAATGATTGAGGAAACTAGCA-3'; the different leaf types of the chili pepper are normal leaves and flower-shaped leaves.
4. A method for differentiating pepper flower and leaf types or selecting pepper plants with normal leaves, characterized in that, Includes the following steps: S1. Extract DNA from the sample to be tested; S2. Using the sample extracted in step S1 as a template, qPCR detection is performed using the specific primer set; the primer set contains primer 1: 5'-GAAGGTGACCAAGTTCATGCTACATCGCCTCGTTTTACCACAT-3', primer 2: 5'-GAAGGTCGGAGTCAACGGATTACATCGCCTCGTTTTACCACAA-3', and primer 3: 5'-TGGGAATGATTGAGGAAACTAGCA-3'; S3. Analyze the detection results of step S2 using qPCR genotyping software; set the Y-axis to pepper mosaic leaves; set the X-axis to normal pepper leaves. If the genotyping result is close to the x-axis, mark it as X. If the typing result is located in the middle of the horizontal and vertical axes, it is marked as XY; if the typing result is close to the vertical axis, it is marked as Y; the identification result of Y is a chili pepper mosaic plant, and the identification results of XY and X are chili pepper normal leaf plants.
Citation Information
Patent Citations
Molecular marker interlocked with pepper cucumber mosaic virus disease resistance gene qcmv-2-1 and application of molecular marker
CN105296475A
Chili whole genome SNP-Panel and application thereof
CN115679012A