Ntgcn1 gene and application thereof in regulating chloridion content of tobacco leaf

By constructing the NtGCN1 gene vector to regulate the chloride ion content in tobacco, the problem of difficulty in reducing the chloride ion content in tobacco in existing technologies has been solved, thereby improving the quality and combustibility of tobacco leaves.

CN120944912BActive Publication Date: 2026-05-08TOBACCO RES INST HENAN ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511326696.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2026-05-08
Estimated Expiration
2045-09-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce the chloride ion content in tobacco, leading to a decline in tobacco leaf quality and poor combustibility. Current measures, such as selecting soils with low chloride background and applying potassium sulfate fertilizer, are not very effective and are limited by geographical location.

Method used

By screening and utilizing the NtGCN1 gene and its encoded amino acid sequence, an expression vector was constructed and introduced into tobacco to regulate chloride ion content and cultivate tobacco germplasm with low chloride ion content.

Benefits of technology

It significantly reduces the chloride ion content in tobacco, improves the quality of tobacco leaves, solves problems such as thick and brittle tobacco leaves, curled leaf edges, and dark green leaf color, and improves combustibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944912B_ABST
    Figure CN120944912B_ABST
Patent Text Reader

Abstract

The application discloses an NtGCN1 gene and application thereof in regulating chlorion content in tobacco leaves, relates to the field of biotechnology, and the amino acid sequence coded by the NtGCN1 gene is shown as SEQ ID NO.2.The application obtains a mutant material and an overexpression material of the NtGCN1 gene by constructing a plant transformation vector and introducing the NtGCN1 gene into Zhanyan 100.Analysis finds that the increase of the expression amount of the NtGCN1 gene can significantly increase the chlorion content in tobacco, and the decrease of the expression amount of the NtGCN1 gene can significantly reduce the chlorion content in tobacco.Taking the gene as a target, cultivating tobacco germplasm with low chlorion content and improving tobacco quality have important significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to the NtGCN1 gene and its application in regulating chloride ion content in tobacco leaves. Background Technology

[0002] Chloride ions are an important micronutrient that accumulates in large quantities in many plants. Tobacco is a chlorine-rich plant, with chloride ion concentrations in its leaves reaching up to 50 mg / g. -1 However, its underlying physiological mechanisms are still unclear.

[0003] The chlorine content in tobacco plays a crucial role in the growth of tobacco and the quality of its products. Excessive chlorine content can cause leaves to become thick and brittle, with curled edges and a dark green color (lower leaves lose their chlorophyll). Increased hygroscopicity leads to a darker color and unpleasant odor during storage. It can also cause increased starch accumulation and decreased reducing sugar content in tobacco leaves, resulting in strange off-flavors. Chlorine ions in tobacco leaves can also significantly reduce combustibility, causing black ash and flameout.

[0004] Currently, the main measures to reduce the chlorine content in tobacco leaves include selecting soils with low chlorine background and applying potassium sulfate fertilizer instead of potassium chloride, but these measures are not very effective and are limited by soil and geographical location.

[0005] Therefore, how to reduce the chlorine content in tobacco is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides the NtGCN1 gene and its application in regulating the chloride ion content of tobacco leaves.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The NtGCN1 gene, whose encoded amino acid sequence is shown in SEQ ID NO.2.

[0009] As a preferred technical solution, the nucleotide sequence of the NtGCN1 gene is shown in SEQ ID NO.1.

[0010] Another object of the present invention is to provide an NtGCN1 protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0011] Another object of the present invention is to provide the application of the above-mentioned NtGCN1 gene or the above-mentioned NtGCN1 protein in regulating the chloride ion content in tobacco.

[0012] Another object of the present invention is to provide a biomaterial for reducing the expression level of the NtGCN1 gene, wherein the biomaterial is an expression cassette, a vector, or a host cell.

[0013] The vector includes expression vectors and cloning vectors. The host cell includes microbial cells or plant cells (preferably non-reproductive plant cells).

[0014] Another object of the present invention is to provide the application of the above-mentioned biomaterials in regulating the chloride ion content of tobacco.

[0015] Another object of the present invention is to provide the application of the above-mentioned biological materials in tobacco breeding, wherein the breeding direction is to cultivate germplasm with low chloride ion content.

[0016] Another objective of this invention is to provide a method for improving tobacco quality by constructing tobacco germplasm with low chloride ion content using the aforementioned biological materials.

[0017] Beneficial Effects: This invention screened and obtained the NtGCN1 gene, NtGCN1 protein, and their application in regulating chloride ion content in tobacco leaves. A plant transformation vector was constructed and introduced into Zhongyan 100, yielding mutant and overexpression materials of the NtGCN1 gene. Analysis revealed that increased NtGCN1 gene expression significantly increased chloride ion content in tobacco, while decreased NtGCN1 gene expression significantly decreased chloride ion content. Targeting this gene to cultivate low-chlorine-content tobacco germplasm and improve tobacco quality is of great significance. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 When tobacco plants were cultured with high concentrations of chloride ions, wilting and root rot occurred.

[0020] Figure 2 Tobacco phenotypes were cultured with 0-45 mM chloride ions, where T0-T5 corresponded to concentrations of 0, 5, 15, 25, 35, and 45 mM, respectively.

[0021] Figure 3 The tobacco phenotypes were cultured to produce chloride ions ranging from 0 to 25 mM, where T0-T3 corresponded to concentrations of 0, 5, 15, and 25 mM, respectively.

[0022] Figure 4The chloride ion content in tobacco tissues under culture with exogenous chloride ions of 0, 5, 15, 25, 35 and 45 mM, where T0-T5 correspond to 0, 5, 15, 25, 35 and 45 mM, respectively.

[0023] Figure 5 The chloride ion content in tobacco leaves was measured after culturing with exogenous chloride ions at 0, 5, 15, and 25 mM for 4 weeks, with T0-T3 corresponding to 0, 5, 15, and 25 mM, respectively.

[0024] Figure 6 To validate the transcriptome results using qPT-PCR, the left ordinate represents the FPKM value of the transcriptome results, and the right ordinate represents the FC value of the qPT-PCR results.

[0025] Figure 7 This is a clustering dendrogram of WGCNA analysis results, with the colors of the thirteen modules highlighted at the bottom.

[0026] Figure 8 The correlation between 12 specified co-expression modules and 1 unassigned module and exogenous chloride ion gradient and leaf chloride ion concentration was determined.

[0027] Figure 9 The correlation between gene expression levels (FPKM) in the red module and chloride ion concentration in tobacco leaves is shown in Figure (A), and the heatmap of expression levels of the top 25 genes in the module is shown in Figure (B).

[0028] Figure 10 The results of GO analysis are for the red module genes.

[0029] Figure 11 This diagram illustrates the increased chloride ion content in plants overexpressing the NtGCN1 gene.

[0030] Figure 12 This diagram illustrates the decrease in chloride ion content in plants with the NtGCN1 gene silenced. Detailed Implementation

[0031] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Example 1: Localization of Tobacco Chloride Ion Regulation Genes

[0033] 1. Relationship between exogenous chloride ion hydroponic system culture and chloride ion content in tobacco leaves

[0034] Using "China Tobacco 100" as the research material, tobacco seedlings were obtained using a floating seedling raising method. After being transferred to flowerpots and cultured in a chlorine-free nutrient solution for one week, exogenous chloride ion gradient culture was carried out.

[0035] Initially, NaCl gradients of 0, 50, 100, 150, 200, 250, and 300 mM were established for cultivation. After one week, it was found that tobacco plants exhibited wilting and root rot under gradients ranging from 50 to 300 mM (see Appendix). Figure 1 ).

[0036] Then, the chloride ion gradients were adjusted to 0, 5, 15, 25, 35, and 45 mM to further cultivate "Zhongyan 100" tobacco seedlings. Chloride ions were provided by CaCl2, MgCl2, and KCl, with CaCl2:MgCl2:KCl = 0.75:0.75:1.50. After one week, the tobacco plants in each gradient treatment were able to grow normally (see Appendix). Figure 2 The chloride ion content in the roots, stems, and leaves of treated tobacco was measured. The chloride ion content in the roots, stems, and leaves initially increased gradually along the chloride ion gradient and then remained basically constant, reaching its highest point at a gradient of 25 mM (see Appendix). Figure 4 ).

[0037] Furthermore, the 0, 5, 15, and 25 mM chloride ion gradients (CaCl2:MgCl2:KCl = 0.75:0.75:1.50) from the above gradients were used to cultivate the transplanted "Zhongyan 100" tobacco seedlings for up to 4 weeks (see Appendix). Figure 3 ), to obtain tobacco leaf samples with significantly different chloride ion content (see Appendix) Figure 5 To conduct further research.

[0038] 2. Transcriptome qRT-PCR validation and WGCNA analysis

[0039] Transcriptome analysis was performed on tobacco leaf samples obtained under chloride ion gradients of 0, 5, 15, and 25 mM (refer to the genome at https: / / zenodo.org / records / 82562(2023)), and the accuracy of the transcriptome results was verified using qRT-PCR (see Appendix). Figure 6 ).

[0040] The WGCNA method was used to analyze the chloride ion content and gene expression data of tobacco leaves, and 177 red module genes that were significantly associated with the chloride ion content of tobacco leaves were obtained (see appendix). Figure 7 and attached Figure 8 )

[0041] 3. GO analysis was performed on the 177 genes in the red module. From the top 25 genes most strongly correlated with chloride ion content in tobacco leaves, genes consistent with the changing trend of chloride ion content in tobacco leaves were selected (see appendix). Figure 9 Furthermore, the NtGCN1 gene (Ntab22g013620.1) with the strongest correlation in the red module and possessing transport activity (see Appendix) Figure 10 ), which is a key candidate gene for regulating chloride ion accumulation in tobacco leaves.

[0042] NtGCN1 gene CDS sequence:

[0043] ATGAAAGCGGCGGCGGCTGCCACAGCTTCTCCAGCGGAGAGCAACAGTGTCGATGATTTAACGAATGGTGTAGGGGAAATTCAGTTATCTGATCGGACTTGTACCGGTGTTTTGTGTTCACATCCACTTTCCAGAGATATTCGGATAGAATCTTTATCACTTACTTTCCATGGGCATGATCTAATAGTTGATTCTGAACTGGAGCTCAACTATGGAAGACGTTATGGTTTGCTTGGGCTTAATGGCTGTGGAAAGTCTACTCTTCTTGCCTCTATAGGATGTCGTGAACTTCCCATCCCAGATCATATGGATATCTTTCATCTAACACGTGAGATTGAAGCGTCTGACATGTCCTCACTTCAAGCTGTTATTAGTTGCGATGAAGAGAGGTTGAGATTGGAGAAAGAAGTTGAAGTCCTGGCTGCACAGGATGATGGTGGCGGAGAGCAGCTTGAACGAATCTATGAGCGTTTGGAAGCTTTGGATGCATCAACCGCTGAGAAGCGTGCAGCTGAGATCTTGTTTGGTCTTGGATTTACCAAGCAAATGCAAGAAAAGAAAACACGAGATTTTTCTGGTGGGTGGAGGATGAGGATTGCTCTTGCTCGAGCCTTGTTTATGAATCCGACCATTTTGTTGCTTGATGAACCCACCAATCATCTTGACCTAGAGGCTTGCGTGTGGTTAGAAGAAACCCTGAAGAAGTTTGACCGCATTCTGGTGGTTGTTTCACACTCACAAGATTTTCTAAATGGTGTGTGTACTAACATCATCCATATGCAAAATAAGAAGTTGAAGCTCTATACGGGTAATTATGATCAATATGTCCAAACCCGTGAGGAGCTGGAAGAGAATCAGATGAAACAGTACAGATGGGAGCAGGAGCAGATTGCTTCAATGAAGGAGTACATTGCTCGTTTTGGA CATGGATCAGCCAAACTAGCCCGTCAAGCACAAAGCAAAGAGAAAACACTGGCTAA GATGGAGCGTGGAGGGCTTACAGAGAAGGTGGTGAAGGACAAGGTCCTGGTCTTCCGGTTTCCTGATGTTGGCAAA CTTCCACCTCCTGTTCTGCAGTTTGTGGAAGTGACATTTGGCTACACACCTGATAATTCTCATTTACAAGAGCCTTG ATTTTGTGTGTAGACCTTGATTCAAGGGTAGCACTGGTGGGACCTAACGGAGCTGGAAAGAGCACGCTGCTTAAGCT GATGACAGGGGATTTAGTTCCCCTTGATGGCATGGTTAGGCGGCATAATCACCTGCGGATTGCACAGTTCCACCAG CATTTGGCTGAGAAGCTTGACATGGAAATGTCTGCTCTCCAATATATGATAAAAGAGTATCCTGGAAATGAGGAGGAGAAGATGAGAGCAGCAATTGGGAGGTTTGGTCTTACTGGTAAAGCTCAAGTTATGCCTATGAAGAACTTGTCAGATGGTCAACGAAGCAGGGTAATATTCGGGTGGTTAGCTTTTAGGCAACCTCACATGCTGCTGTTGGATGAGCCGACCAACCATCTTGATATTGAGACTATTGACTCACTTGCCGAGGCTTTGAATGAATGGGATGGTGGCATGGTTCTTGTTAGTCATGATTTCAGGCTCATAAACCAGGTTGCCCACGAGATATGGGTATGTGAAAATCAAACTGTGACACGGTGGGAGGGTGACATTATGGACTTCAAGCTACATTTGAAGTTGAGGGCCGGATTAGGTGATTAA, SEQ ID NO.1。

[0044] NtGCN1 protein sequence,

[0045] MKAAAAATASPAESNSVDDLTNGVGEIQLSDRTCTGVLCSHPLSRDIRIESLSLTFHGHDLIVDSELELNYGRRYGLLGLNGCGKSTLLASIGCRELPIPDHMDIFHLTREIEASDMSSLQAVISCDEERLRLEKEVEVLAAQDDGGGEQLERIYERLEALDASTAEKRAAEILFGLGFTKQMQEKKTRDFSGGWRMRIALARALFMNPTILLLDEPTNHLDLEACVWLEETLKKFDRILVVVSHSQDFLNGVCTNIIHMQNKKLKLYTGNYDQYVQTREELEENQMKQYRWEQEQIASMKEYIARFGHGSAKLARQAQSKEKTLAKMERGGLTEKVVKDKVLVFRFPDVGKLPPPVLQFVEVTFGYTPDNLIYKSLDFGVDLDSRVALVGPNGAGKSTLLKLMTGDLVPLDGMVRRHNHLRIAQFHQHLAEKLDMEMSALQYMIKEYPGNEEEKMRAAIGRFGLTGKAQVMPMKNLSDGQRSRVIFGWLAFRQPHMLLLDEPTNHLDIETIDSLAEALNEWDGGMVLVSHDFRLINQVAHEIWVCENQTVTRWEGDIMDFKLHLKLRAGLGD, SEQ ID NO.2。

[0046] Verification of Chloride Ion-Regulating Genes in Example 2

[0047] 1. Construction of NtGCN1 Gene Overexpression Plants

[0048] The full-length CDS of the NtGCN1 gene was constructed into the pCAMBIA1302 overexpression vector (hyg-seq-F2,5′-TACATGGCGTGATTTCATATGCG-3′, SEQ ID NO.3; hyg-seq-R2,5′-TTTCCACTATCGGCGAGTACTTC-3′, SEQ ID NO.4) at the Spe I restriction site. After successful vector construction, the vector was transiently transformed into 'Nicotiana benthamiana' leaves via Agrobacterium-mediated transformation. After 24 h of dark culture, the leaves were cultured for 5 days under a 25 mM chloride gradient (T3) and a 16 / 8 h light / dark cycle. Wild-type and empty vectors were used as controls. The expression level of the NtGCN1 gene (F-5′-ATGTCCAAACCCGTGAGGAG-3′, SEQ ID NO.5, R-5′-TGTGCTTGACGGGCTAGTTT-3′, SEQ ID NO.6) (amplified product 133 bp) in the overexpressing tobacco plants was analyzed (see Appendix). Figure 11 (A) and chloride ion content in tobacco leaves (see Appendix) Figure 11 (B)

[0049] The results showed that increased expression of the NtGCN1 gene significantly increased the chloride ion content in tobacco, and the two were positively correlated.

[0050] 2. Using VIGS technology, the species-specific fragment (underlined portion in SEQ ID NO.1, 368 bp) from the NtGCN1 gene CDS was constructed into the NcoI+XmaI restriction site of the multiple cloning site in the pTRV2 silencing vector (pTRV2-F, 5′-GGTCAAGGTACGTAGTAGAG-3′, SEQ ID NO.7; pTRV2-R, 5′-CGAGAATGTCAATCTCGTAG-3′, SEQ ID NO.8). After successful vector construction, the vector was transformed into 'Nicotiana benthamiana' leaves via Agrobacterium-mediated transformation. After 24 h of dark culture, the leaves were cultured for 5 days under a 25 mM (T3) chloride gradient and a 16 / 8 h light / dark cycle. The expression level of the NtGCN1 gene in VIGS-silenced tobacco plants was analyzed using wild-type and empty vector as controls (see Appendix). Figure 12 (A) and chloride ion content in tobacco leaves (see Appendix) Figure 12 (B)

[0051] The results showed that the expression level of the NtGCN1 gene was reduced in VIGS-silenced tobacco plants, and the chloride ion content in the tobacco was also significantly reduced.

[0052] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0053] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. NtGCN1 The application of the gene or NtGCN1 protein in regulating chloride ion content in tobacco, characterized by: The NtGCN1 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2, and the amino acid sequence of the NtGCN1 protein is shown in SEQ ID NO.2; The regulation mentioned is a positive regulation.

2. The application of the NtGCN1 gene or NtGCN1 protein according to claim 1 in regulating chloride ion content in tobacco, characterized in that, The nucleotide sequence of the NtGCN1 gene is shown in SEQ ID NO.

1.

3. The application of biomaterials that reduce NtGCN1 gene expression in regulating chloride ion content in tobacco, characterized in that... The biological material is an expression cassette, vector, or host cell; the regulation is negative regulation; the amino acid sequence encoded by the NtGCN1 gene is shown in SEQ ID NO.

2.

4. The application of the biomaterial described in claim 3, which reduces NtGCN1 gene expression, in regulating chloride ion content in tobacco, is characterized in that... The nucleotide sequence of the NtGCN1 gene is shown in SEQ ID NO.

1.

5. The application of biomaterials that reduce NtGCN1 gene expression in tobacco breeding, characterized in that, The breeding direction is to cultivate germplasm with low chloride ion content; the biological material is an expression cassette, vector or host cell; the amino acid sequence encoded by the NtGCN1 gene is shown in SEQ ID NO.

2.

6. The application of the biomaterial for reducing NtGCN1 gene expression according to claim 5 in tobacco breeding, characterized in that, The nucleotide sequence of the NtGCN1 gene is shown in SEQ ID NO.

1.

7. A method for improving tobacco quality, characterized in that, Tobacco germplasm with low chloride ion content was constructed using biological materials that reduced the expression level of the NtGCN1 gene. The biological material is an expression cassette, vector, or host cell; the amino acid sequence encoded by the NtGCN1 gene is shown in SEQ ID NO.

2.

8. The method for improving tobacco quality according to claim 7, characterized in that, The nucleotide sequence of the NtGCN1 gene is shown in SEQ ID NO.1.