Protease for improving resistance of potato to late blight, and coding gene and application thereof

By overexpressing the protease StRD21 and its encoding gene in potatoes, the problem of potato late blight resistance has been solved, achieving durable and broad-spectrum resistance enhancement, reducing the use of chemical pesticides, and conforming to sustainable agricultural development.

CN121574966BActive Publication Date: 2026-05-08YUNNAN NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610107039.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-27
Publication Date
2026-05-08
Estimated Expiration
2046-01-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient to provide durable and broad-spectrum resistance to potato late blight. Traditional breeding methods rely on the NBS-LRR resistance gene, which is prone to loss of resistance. The use of chemical pesticides increases costs and pollutes the environment.

Method used

By identifying and overexpressing the protease StRD21 and its encoding gene, we can enhance resistance in potatoes using genetic engineering techniques. We can also achieve protease overexpression by combining recombinant expression vectors and transgenic host cells.

Benefits of technology

It significantly enhances the resistance of potatoes to late blight, reduces reliance on chemical pesticides, and meets the requirements of sustainable agricultural development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574966B_ABST
    Figure CN121574966B_ABST
Patent Text Reader

Abstract

The application discloses a proteinase and coding gene and application for improving the resistance of potato to late blight, and belongs to the technical field of genetic engineering and plant disease-resistant breeding. The amino acid sequence of the proteinase StRD21 is shown as SEQ ID NO. 2, or a derivative sequence with the same disease-resistant function. The nucleotide sequence of the coding gene is shown as SEQ ID NO. 1. The application further provides a specific primer pair for cloning the gene, a potato recombinant overexpression vector containing the gene and a transgenic host cell. By introducing the StRD21 gene into potato and making the StRD21 gene overexpress, the resistance of potato to late blight can be significantly enhanced. The application provides an effective gene resource and a biotechnological means for cultivating a new variety of disease-resistant potato.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a protease that enhances potato resistance to late blight, its encoding gene, and its application. Background Technology

[0002] Potatoes are a globally important crop used for food, vegetables, and feed, and the stability and security of their yield are crucial to ensuring global food security. However, potato production is chronically threatened by late blight, a disease caused by Phytophthora blight. This disease is characterized by its high susceptibility, rapid spread, and severe damage, causing foliage and tuber rot within a short period, resulting in devastating yield losses. The historically infamous Irish Famine was a severe consequence of potato late blight. To this day, late blight remains considered the "number one killer" of potato production.

[0003] Currently, the control of potato late blight mainly relies on chemical pesticides. However, the long-term and large-scale use of chemical agents not only increases production costs and leads to pesticide resistance in pathogens, but also causes environmental pollution and pesticide residues, which runs counter to the concept of sustainable agricultural development. Therefore, breeding and utilizing disease-resistant varieties is widely recognized as the most economical, effective, and environmentally friendly strategy for controlling late blight.

[0004] During the long-term co-evolution of plants and pathogenic microorganisms, a two-tiered defense system has been formed to resist pathogen infection. For a long time, the plant immune system has been mainly divided into two categories: (1) Plants directly recognize pathogen-associated molecular patterns (PAMPs) of pathogens through cell membrane-localized pattern recognition receptors (PRRs), thereby triggering the plant's first-layer immune system (pattern-triggered immunity, PTI) to resist pathogen infection. (2) Pathogens secrete effector factors into plant cells, thereby attacking the plant's immune system to further infect the plant. Plants have evolved NBS-LRR disease-resistant proteins that directly or indirectly recognize the effector factors of pathogens, thereby triggering the plant's second-layer immune system (effector-triggered immunity, ETI) and activating a stronger immune response to resist pathogen infection.

[0005] Potato late blight resistance breeding mainly relies on the discovery and utilization of resistance genes from wild or cultivated germplasm resources. Traditional breeding has achieved some success by aggregating known NBS-LRR resistance genes in cultivars. However, while this resistance mechanism is highly efficient, it is often race-specific and easily lost due to variations in the pathogenic Phytophthora population or the emergence of new races, making it difficult to provide lasting and stable protection in production.

[0006] To achieve durable and broad-spectrum resistance, the discovery of new gene families with broad-spectrum disease resistance potential has become a research hotspot. PTI immunity is a defense pathway independent of NBS-LRR resistance genes, exhibiting no species specificity when targeting pathogens and thus possessing broad-spectrum resistance. Cysteine ​​proteases play a crucial role in plant PTI immune responses, but their specific functions and applications in potato resistance to late blight remain limited.

[0007] Therefore, there is an urgent need in this field to identify new, clearly functional genes related to potato late blight resistance, especially those that may participate in basic immune pathways and have the potential to provide durable resistance. Verifying their functions through genetic engineering and applying them to potato breeding practices will provide entirely new genetic resources and effective approaches for solving the problem of potato late blight control and cultivating superior new varieties with durable resistance. Summary of the Invention

[0008] The purpose of this invention is to provide a protease StRD21 that can effectively improve potato resistance to late blight, its encoding gene, and its applications.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] In a first aspect, the present invention provides a protease StRD21 for improving resistance of potatoes to late blight, which is any one of a)-b) below:

[0011] a) A protease consisting of an amino acid sequence as shown in SEQ ID NO.2;

[0012] b) A derivative protein that has the same anti-late blight function as the protease shown in SEQ ID NO.2, obtained by substituting, deleting or inserting 1 to 20 amino acids (e.g., 1, 2, 3, 5, 8, 10, 15, 20) of the amino acid sequence shown in SEQ ID NO.2.

[0013] The term "same function" means that when the derived protein is expressed in potatoes, it can confer or enhance resistance to late blight in potatoes, with a resistance level comparable to that of a protease composed of the amino acid sequence shown in SEQ ID NO.2.

[0014] Secondly, the present invention provides a gene encoding the above-mentioned protease StRD21, which is any one of 1)-3) below:

[0015] 1) A DNA molecule having the nucleotide sequence shown in SEQ ID NO.1;

[0016] 2) Possesses a polynucleotide encoding a protease as shown in SEQ ID NO.2;

[0017] 3) A DNA molecule that has 80% or more (e.g., 85%, 90%, 95%, 98%, 99% or higher) homology with the nucleotide sequence defined in 1) or 2), and that encodes a protease that has the same anti-late blight function as the protease shown in SEQ ID NO.2.

[0018] Thirdly, the present invention provides primer pairs for cloning the aforementioned gene. The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer being shown in SEQ ID NO.4. This primer pair can be used to specifically amplify the StRD21 gene from potato cDNA or genomic DNA.

[0019] Fourthly, the present invention provides a recombinant expression vector comprising the StRD21 gene described in the second aspect of the present invention.

[0020] Preferably, the expression vector is pART27-GFP. Those skilled in the art can also select other suitable expression vectors based on the host cell type, such as the pCAMBIA series, pBI121, and other plant expression vectors.

[0021] Fifthly, the present invention provides a transgenic host cell comprising the StRD21 gene as described in the second aspect of the present invention or comprising the recombinant expression vector as described in the fourth aspect of the present invention.

[0022] Preferably, the host cell is a plant cell or Agrobacterium. More preferably, the plant cell is a potato cell.

[0023] In a sixth aspect, the present invention provides the use of the above-mentioned protease StRD21, its encoding gene, the recombinant expression vector, or the transgenic host cell in the cultivation of potatoes resistant to late blight.

[0024] Preferably, the application is achieved by overexpressing the StRD21 protease in potatoes. Overexpression means that the expression level of StRD21 protein in potatoes is higher than its endogenous level or that it is expressed in potatoes that do not express it, thereby conferring or enhancing the disease resistance of potatoes.

[0025] In a seventh aspect, the present invention provides the application of the above-mentioned protease StRD21, its encoding gene, the recombinant expression vector, or the transgenic host cell in regulating potato resistance to late blight.

[0026] Compared with the prior art, the present invention has the following significant advantages:

[0027] This invention is the first to discover and confirm the function of the protease StRD21 in enhancing potato (especially potato) resistance to late blight. By introducing the StRD21 gene into potato and overexpressing it, resistance to late blight fungus can be significantly enhanced, providing a new gene resource for potato disease-resistant breeding.

[0028] The primer pairs, recombinant expression vectors, and transgenic host cells provided by this invention offer effective tools and methods for genetic improvement of potatoes using the StRD21 gene.

[0029] By using the genetic engineering method of this invention to breed disease-resistant varieties, we can reduce our dependence on chemical pesticides, which meets the requirements of sustainable agricultural development. Attached Figure Description

[0030] Figure 1 StRD21 Identification of potato overexpression lines, with Figure A showing qRT-PCR identification. StRD21 The transcriptional level of the gene in the overexpression material was determined using wild-type potato Desiree (Des) as a control. The results identified two lines in the overexpression material. StRD21 Gene transcription levels were significantly upregulated in StRD21-OE-3 and StRD21-OE-4, respectively; Figure B shows the results of Western blot analysis of total overexpressed potato protein extracted from the two lines, StRD21-OE-3 and StRD21-OE-4.

[0031] Figure 2 potato StRD21 The results of late blight resistance identification of overexpression materials (including two transgenic lines, StRD21-OE-3 and StRD21-OE-4) are shown in Figure A, which is a comparison of leaves 7 days after late blight inoculation; Figure B shows the relative lesion area of ​​the leaves in Figure A 7 days after late blight inoculation; and Figure C shows the average relative lesion area of ​​all leaves (23 leaves each from wild-type potato Des, overexpressing StRD21-OE-3, and overexpressing StRD21-OE-4) 7 days after late blight inoculation.

[0032] Figure 3 flg22 induces the production of ROS;

[0033] Figure 4 Disease resistance marker genes in potatoes StRD21 The expression level in the overexpression material, where A is StPR3 Gene expression level, B is StWRKY1 Gene expression levels. Detailed Implementation

[0034] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0035] The processes, conditions, reagents, and experimental methods used in implementing this invention, except as specifically mentioned below, are all common knowledge and general knowledge in the field, and this invention does not have any particular limitations. Experimental methods in the embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.

[0036] Unless otherwise stated, all technical terms and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. However, in the event of any conflict, the specification containing the definitions shall prevail.

[0037] The following is information on the source and specifications of some of the main raw materials and reagents used in the examples:

[0038] Wild-type potato (Des) was provided by Wuhan Boyuan Biotechnology Co., Ltd.; Late blight pathotype 88069 was donated by Associate Professor Wang Hongyang of Yunnan Normal University; pART27-GFP vector was provided by Professor Du Yu of Northwest A&F University; flg22 was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; spectinomycin was purchased from Solarbio, with a specification of 100 mg / mL.

[0039] Example 1: Cloning of the potato disease resistance gene StRD21

[0040] RNA was extracted from leaves of wild-type potato Desiree (DES), reverse transcribed into cDNA, and used as a template for PCR amplification. The primers used are as follows:

[0041] StRD21-F:TCATTTGGAGAGGACACGCTCGAGATGGCAGCTCACAGCTC (SEQ ID NO.3);

[0042] StRD21-R: CTCCTCGCCCTTCGACATAAGCTTAGAACTGCCTCTTCTTTCCTCC (SEQ ID NO. 4).

[0043] Specifically, the following steps are included:

[0044] RNA was extracted from the leaves of 2-week-old wild-type potato (Des) using the Trizol (Invitrogen) extraction method. The procedure was described in the instructions for the Novizan Polysaccharide and Polyphenol Plant RNA Extraction Kit. The RNA was then reverse transcribed into cDNA using the Trans Script II One-Step RT-PCR Super Mix kit. The procedure was described in the instructions for the Trans Script All-in-One First-Strand cDNA Synthesis Super Mix for qPCR kit.

[0045] Using SEQ ID NO.3 and SEQ ID NO.4 as primers and cDNA as a template, PCR was performed according to the amplification system. The PCR system was 50 μL. StRD21 PCR reaction system for the gene: 1 μL cDNA template, 25 μL 2×KOD PCR Master Mix polymerase, 1 μL StRD21-F primer, 1 μL StRD21-R primer, and 23 μL deionized water.

[0046] The reaction program was as follows: 98℃ pre-denaturation for 3 min (1 cycle), 98℃ denaturation for 20 s → 57℃ annealing for 20 s → 68℃ extension for 1 min 30 s (33 cycles), 68℃ for 7 min (1 cycle), and 16℃ permanent holding.

[0047] After the procedure, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified.

[0048] Example 2: Potato Disease Resistance Gene StRD21 Obtaining overexpression materials

[0049] (1) The result obtained in Example 1 StRD21 The gene was ligated into the pART27-GFP vector, specifically including the following steps: the pART27-GFP vector was double-digested with restriction endonucleases Hind III and Xho I, reacted at 37°C for 3 h, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The PCR product obtained in Example 1 was then used... StRD21The gene was ligated into the pART27-GFP vector, which had been digested with Hind III and Xho I, using the Novizan recombinant kit to obtain the overexpression vector pART27-StRD21-GFP. This vector was transformed into E. coli DH5α and screened on LB agar plates supplemented with spectinomycin (100 μg / mL). The plates were incubated overnight at 37°C until single colonies grew. Single colonies were picked and verified by PCR and enzyme digestion. Positive clones were sent to Qingke Biotechnology (Kunming) Co., Ltd. for DNA sequencing verification.

[0050] Sequencing results showed that potatoes StRD21 The full-length CDS of the gene is 1401 bp, and its nucleic acid sequence is shown in SEQ ID NO.1, encoding a protein of 466 amino acids, the amino acid sequence of which is shown in SEQ ID NO.2. The expression vector pART27-StRD21-GFP encoding the potato cysteine ​​protease StRD21 was successfully constructed, and subsequent extraction of positive plasmids and transformation into Agrobacterium GV3101 was performed.

[0051] The sequencing primers used were Pkan-F and Pkan-R, and their sequences are as follows:

[0052] Pkan-F: CAATCCCACTATCCTTCGCA (SEQ ID NO.13)

[0053] Pkan-R: CGGTAAGGATCTGAGCTAC (SEQ ID NO.14)

[0054] (2) The positive vector pART27-StRD21-GFP was transformed into wild-type potato Des using Agrobacterium-mediated transformation to obtain stably expressed overexpression. StRD21 Genetically modified plants.

[0055] The specific steps are as follows:

[0056] After aseptically preserving the shoot tips of wild-type potato (Des) as donor material, cultured on basal medium for 3 weeks, stem segments were taken as explants and pre-cultured on pre-medium for 2 days to activate Agrobacterium tumefaciens GV3101 positive transformant strain, and cultured to OD200. 600nmApproximately 0.5 g of mycelium was used to suspend the bacteria in liquid culture medium. The pre-cultured explants were then immersed in the liquid medium for 10 min. The explants were then spread evenly on the medium and cultured in the dark at 24°C for 2 days. After 2 days, the explants were evenly transferred to the new medium for callus induction. The medium was changed every two weeks until sprouting. After sprouting, when the sprouts reached about 1 cm in length, they were cut and inserted into rooting medium for rooting treatment. Successfully rooted seedlings were cultured at 28°C under light until most adventitious roots had developed. Finally, the rooted seedlings were removed, the medium was washed off, and the seedlings were planted in plug trays and placed in a greenhouse for 3-7 days of growth before being transplanted into the field to obtain potatoes. StRD21 The genetically modified material will be used for subsequent leaf sampling and identification.

[0057] Example 3: Potato Disease Resistance Gene StRD21 Identification of overexpression materials

[0058] 1. Transcription level identification

[0059] Wild-type potato Des, overexpression StRD21 RNA was extracted from transgenic potato leaves (obtained in Example 2) using the Trizol (Invitrogen) extraction method. The procedure was described in the instructions for the Novizan Polysaccharide and Polyphenol Plant RNA Extraction Kit. The RNA was then reverse transcribed into cDNA using the TransScript II One-Step RT-PCR SuperMix kit. The procedure was described in the instructions for the TransScript All-in-One First-Strand cDNA Synthesis Super Mix for qPCR kit. The expression level of StRD21 was identified by qRT-PCR using a premixed reagent based on the full-gold dye method. The reaction system consisted of: 2 μL cDNA, 0.4 μL upstream primer qp-StActin-F / qp-StRD21-F, 0.4 μL downstream primer qp-StActin-R / qp-StRD21-R, 10 μL 2×Perfect Start® Green qPCR Super Mix, 0.4 μL Universal Passive Reference Dye (50×), and 6.8 μL Nuclease-free Water.

[0060] The primer sequences used for qRT-PCR are shown below:

[0061] qp-StActin-F:GCTTCCCGATGGTCAAGTCA (SEQ ID NO.5);

[0062] qp-StActin-R: GGATTCCAGCTGCTTCCATT (SEQ ID NO. 6);

[0063] qp-StRD21-F: CGCCGATCTGACTAATGAGGA (SEQ ID NO.7);

[0064] qp-StRD21-R: GGTCACCGGAACTCTTAGTGC (SEQ ID NO. 8).

[0065] See results Figure 1 A, two lineages were identified in the overexpressed material. StRD21 Gene transcription levels were significantly upregulated, significantly higher than those in wild-type potatoes, specifically StRD21-OE-3 and StRD21-OE-4.

[0066] 2. Protein level identification

[0067] Total protein extraction: Wild-type potato leaves (Des), transgenic potato leaves (StRD21-OE-3, StRD21-OE-4) were extracted, ground in liquid nitrogen, and the powder was placed in a 1.5 mL centrifuge tube. 200 μL of protein extraction buffer was added, the mixture was vortexed, and the mixture was placed on ice for 30 min. Then, it was centrifuged at 12,000 rpm and 4 °C for 10 min. The supernatant was transferred to a new centrifuge tube, and an equal volume of 2×SDS loading buffer was added. The tube was then incubated in a 98 °C metal bath for 10 min as the sample for subsequent Western blotting.

[0068] Western blot hybridization: After sample loading, protein electrophoresis was performed at 80 V for 30 min, then the voltage was adjusted to 120 V for 1 h. After protein electrophoresis, membrane transfer was performed at 100 V for 90 min. After transfer, the PVDF membrane was removed and blocked with 5% skim milk for 2 h. After blocking, the primary antibody GFP was diluted 1:5000 with 3% skim milk and incubated at room temperature for 2 h. After primary antibody incubation, the membrane was washed 3 times with PBST for 5 min each time. After washing, the secondary antibody (mouse antibody) was diluted 1:5000 with 3% skim milk and incubated at room temperature for 1 hour and 30 min. After secondary antibody incubation, the membrane was washed 3 times with PBST for 5 min each time, and then chemiluminescence detection was performed.

[0069] See results Figure 1 B. The results showed that the overexpression materials StRD21-OE-3 and StRD21-OE-4 contained obvious GFP fusion protein. StRD21The gene size is 1401 bp, the protein size is 51.37 kDa, and the constructed overexpression vector pART27 tag protein GFP has a size of 26.9 kDa. Therefore, overexpression... StRD21 In the potato material, the target protein size is approximately 78.27 kDa.

[0070] Example 4 Overexpression StRD21 Late blight resistance testing of genetically modified potatoes

[0071] The overexpressing plants StRD21-OE-3, StRD21-OE-4, and wild-type potato Des identified as positive in Example 3 were grown for one month.

[0072] Used P. infestans The late blight pathogen strain was 88069, which was grown on rye agar medium under a 24-hour dark-light cycle in an incubator at 4°C for long-term preservation. For infection assays, strain 88069 was grown on rye agar medium at 18°C ​​for 14 days for inoculation experiments.

[0073] The 88069 strain, grown for 14 days, was scraped with 4 ml of 0.05% Tween water to release sporangia. The sporangia suspension was filtered through a magic filter cloth. The number of sporangia was counted under a microscope and adjusted to 100 sporangia per microliter. The suspension was then placed on ice for two hours to release spores.

[0074] Ten microliters of spores were inoculated onto the back of detached potato leaves (inoculating both sides of each leaf), placed in a dish with moist filter paper, and sealed with plastic wrap to keep moist. Seven days after inoculation, the disease incidence was observed and recorded, and the lesion area of ​​the transgenic material was compared with that of the control leaf.

[0075] like Figure 2 Figure A shows the leaf disease incidence of wild-type potato and transgenic overexpression potato lines 7 days after in vitro inoculation with late blight. Seven days after inoculation with late blight, overexpression was observed. StRD21 Potato leaf lesions are significantly smaller than those of wild-type potatoes.

[0076] The lesion areas after in vitro inoculation of all wild-type and overexpression materials were statistically analyzed, and graphs were plotted using GraphPad Prism 8.0.1 to obtain the relative lesion area and the average relative lesion area, as shown below. Figure 2 As shown in B-2C, the results indicate overexpression StRD21 The overall area of ​​potato lesions was smaller than that of wild-type potatoes, further proving that... StRD21 Gene overexpression significantly improved potato resistance to late blight.

[0077] Example 5 Overexpression StRD21ROS outbreak level detection in genetically modified potatoes

[0078] Wild-type potato Des, overexpression StRD21 The ROS levels of transgenic potatoes (obtained in Example 2) were measured after treatment with flg22 (a 22-amino acid peptide segment on bacterial flagellar protein with a specific function that can be recognized by pattern recognition receptors on the surface of plant cells, thereby triggering an immune response in plants).

[0079] Leaves from wild-type and transgenic potatoes were taken separately using a punch, avoiding the veins and leaf edges. The round leaves were placed in opaque 96-well microplates with 100 μL of deionized water added to each well. After standing in the dark for 16 hours, the deionized water was aspirated, and reaction solution (Luminol, HRP, flg22) was added. The ROS burst level was measured using a microplate reader.

[0080] The results are as follows Figure 3 As shown in the figure, the results indicate that after flg22 treatment, overexpression StRD21 The ROS burst level in potatoes was significantly higher than in wild-type potatoes, indicating overexpression. StRD21 This triggers a ROS burst, thereby enhancing the potato's resistance to pathogen invasion.

[0081] Example 6: Known potato disease resistance genes StPR3 , StWRKY1 In overexpression StRD21 Detection of expression levels in potato plants

[0082] The specific steps are as follows: Take wild-type potato Des, overexpress... StRD21 RNA was extracted from transgenic potato leaves (obtained in Example 2) using the Trizol (Invitrogen) extraction method, following the instructions for the Novizan Polysaccharide and Polyphenol Plant RNA Extraction Kit. RNA was then reverse transcribed into cDNA using the TransScript II One-Step RT-PCR Super Mix kit, following the instructions for the TransScript All-in-One First-Strand cDNA Synthesis Super Mix for qPCR kit. cDNA was then identified using qRT-PCR with a transgold dye-based quantitative PCR premix. StRD21 Disease resistance marker genes in overexpressed materials StWRKY1 and StPR3The expression level was determined using the following reaction system: 2 μL cDNA, 0.4 μL upstream primer qp-StActin-F / qp-StWRKY1-F / qp-StPR3-F, 0.4 μL downstream primer qp-StActin-R / qp-StWRKY1-R / qp-StPR3-R, 10 μL 2×PerfectStart Green qPCR Super Mix, 0.4 μL Universal Passive Reference Dye (50×), and 6.8 μL Nuclease-free Water.

[0083] The primer sequences used for qRT-PCR are shown below:

[0084] qp-StActin-F:GCTTCCCGATGGTCAAGTCA (SEQ ID NO.5);

[0085] qp-StActin-R: GGATTCCAGCTGCTTCCATTC (SEQ ID NO. 6);

[0086] qp-StWRKY1-F: GAAGAATAAAGCCGGGTCTTGG (SEQ ID NO.9);

[0087] qp-StWRKY1-R:CTTACACGATTTGATCACCTCATCC (SEQ ID NO.10);

[0088] qp-StPR3-F: GCAAATTCGGCTGGTGTGGTA (SEQ ID NO. 11);

[0089] qp-StPR3-R: CTGGAGAACCGCCAGGACAC (SEQ ID NO. 12).

[0090] See results Figure 4 The results showed that overexpression in StRD21-OE-3 and StRD21-OE-4 plants... StPR3 , StWRKY1 Upregulation of gene transcription levels further illustrates StRD21 Gene overexpression enhances the disease resistance of potatoes.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of protease StRD21, the gene encoding protease StRD21, or a recombinant expression vector containing the gene encoding protease StRD21 in the cultivation of potatoes resistant to late blight, characterized in that, The application is achieved by overexpressing the protease StRD21 in potatoes. The amino acid sequence of the protease StRD21 is shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the protease StRD21 is shown in SEQ ID NO.

1.

2. The application of protease StRD21, the gene encoding protease StRD21, or a recombinant expression vector containing the gene encoding protease StRD21 in improving potato resistance to late blight, characterized in that, The application is achieved by overexpressing the protease StRD21 in potatoes. The amino acid sequence of the protease StRD21 is shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the protease StRD21 is shown in SEQ ID NO.1.