An antibody-bpa protein-nucleic acid tag complex, and methods of making and using the same

Abstract

This invention discloses an antibody-BPA protein-nucleic acid tag complex, its preparation method, and its applications. This invention combines recombinant protein A-bpa-SNAP-tag with O... 6 The protein-nucleic acid complex is obtained by binding to an oligonucleotide modified with benzylguanine; the protein-nucleic acid complex is then conjugated with an antibody, followed by ultraviolet irradiation to obtain an antibody-BPA protein-nucleic acid tag complex. This invention utilizes the high affinity and specific binding of Protein A in BPA protein to the Fc fragment of immunoglobulin (IgG) to pre-construct the protein-nucleic acid complex; in use, simply mixing the target antibody with this complex achieves targeted, rapid, and universal labeling of the antibody with a nucleic acid tag.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically to an antibody-BPA protein-nucleic acid tag complex, its preparation method, and its application. Background Technology

[0002] The spatial distribution and abundance variations of intracellular proteins are key clues for elucidating histopathological features and discovering biomarkers. Especially in medical research, post-genomic projects, and clinical testing, achieving high-sensitivity and high-specificity protein detection is crucial. Currently, in the fields of histopathology and in situ detection, immunohistochemistry (IHC) has long been considered the "gold standard" for in situ protein analysis due to its ability to preserve tissue morphology, relatively low cost, and ease of clinical application. However, despite continuous advancements in IHC technology, it still falls short in accurately quantifying or detecting low-abundance proteins. Traditional enzyme-catalyzed colorimetric (DAB) IHC has a narrow dynamic range and is prone to signal saturation (typically providing only semi-quantitative scores). This limitation makes it difficult to sensitively monitor trace amounts of cytokines expressed in biological samples or distinguish subtle differences in protein expression levels. More importantly, as a low-throughput method (usually only capable of detecting single indicators), traditional IHC cannot achieve in situ co-expression analysis of multiple targets, making it difficult to deeply reveal complex cellular phenotypic heterogeneity and cell-cell interactions within the microenvironment on the same tissue section.

[0003] To resolve the spatial distribution of proteins at the in situ level in tissues, antibody-labeled imaging techniques have emerged. In recent years, antibody-oligonucleotide conjugates (AOCs), as a novel type of chimeric biomolecule, have become powerful tools in multiplexing, super-resolution imaging, and targeted therapy by combining the targeting and recognition capabilities of antibodies with the high coding and amplification capabilities of oligonucleotides (DNA / RNA). However, existing AOC preparation techniques still have significant drawbacks: traditional chemical conjugation methods (such as using the primary amine of lysine or the thiol group of cysteine) often result in random conjugation sites, uncontrollable number of nucleic acid tags, and are prone to disrupting the antigen-binding activity of the antibody's Fab end due to steric hindrance or chemical modification, leading to large batch-to-batch variations and high product heterogeneity. Genetic engineering methods (such as HaloTags and SNAP-tags for direct antibody fusion) require gene recombination and expression for each antibody, posing a high technical barrier and making direct application to commercially available antibodies difficult. While non-covalent coupling methods based on affinity proteins (such as using Protein A / G to bind to the IgG Fc fragment) achieve site-specific labeling without affecting Fab-terminal activity, the bioaffinity interactions they rely on are reversible. Under multiple washes or harsh hybridization conditions, nucleic acid tags are prone to detachment, leading to signal loss or cross-contamination, which limits their application in high-throughput, high-sensitivity detection. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide an antibody-BPA protein-nucleic acid tag complex, its preparation method, and its application. This invention utilizes the high affinity and specific binding characteristic of Protein A in BPA protein to the Fc fragment of immunoglobulin (IgG) to pre-construct a protein-nucleic acid complex. In use, simply mixing the target antibody with this complex achieves targeted, rapid, and universal labeling of the antibody with a nucleic acid tag.

[0005] To achieve the above objectives, the technical solution designed by the present invention is as follows:

[0006] This invention provides a method for preparing an antibody-BPA protein-nucleic acid tag complex, comprising the following steps:

[0007] (1) The recombinant protein A-bpa-SNAP-tag was combined with O 6 The oligonucleotide modified with β-benzylguanine is combined to obtain a protein-nucleic acid complex;

[0008] (2) The protein-nucleic acid complex and the antibody are coupled together and then subjected to ultraviolet irradiation to obtain the antibody-BPA protein-nucleic acid tag complex.

[0009] Further, in step (1), the amino acid sequence of the recombinant protein protein A-bpa-SNAP-tag is as shown in SEQ ID NO: 2, and 4-benzoyl-L-phenylalanine (BPA) is inserted at the 12th amino acid position.

[0010] The O 6 The oligonucleotide modified with benzylguanine is any one of BG-PMS2, BG-MLH1, BG-MSH6, BG-MSH2 and BG-2PMS2;

[0011] The recombinant protein A-bpa-SNAP-tag and O 6 The molar ratio of β-benzylguanine-modified oligonucleotides is 1:1~2; the binding time is 15~20 minutes.

[0012] Furthermore, the nucleotide sequences of BG-PMS2, BG-MLH1, BG-MSH6, BG-MSH2 and BG-2PMS2 are shown in SEQ ID NO: 3 to SEQ ID NO: 7;

[0013] The recombinant protein A-bpa-SNAP-tag and O 6 The molar ratio of β-benzylguanine-modified oligonucleotides was 1:1; the binding time was 15 minutes.

[0014] Furthermore, the antibody is any one of PMS2, MLH1, MSH6, and MSH2;

[0015] The molar ratio of the antibody to the protein-nucleic acid complex is 1:2~5;

[0016] The coupling temperature is 4~8℃, and the coupling time is 2~3 h;

[0017] The wavelength of the ultraviolet irradiation is 350~365 nm, and the irradiation time is 60~90 min.

[0018] The O 6 When the oligonucleotides modified with benzylguanine are BG-PMS2 and BG-2PMS2, the corresponding antibody is PMS2.

[0019] The O 6 The oligonucleotide modified with β-benzylguanine is BG-MLH1, and the corresponding antibody is MLH1;

[0020] The O 6 The oligonucleotide modified with benzylguanine is BG-MSH6, and the corresponding antibody is MSH6;

[0021] The O 6 The oligonucleotide modified with benzylguanine is BG-MSH2, and the corresponding antibody is MSH2.

[0022] The present invention also provides an antibody-BPA protein-nucleic acid tag complex prepared by the preparation method described above.

[0023] The present invention also provides an application of the antibody-BPA protein-nucleic acid tag complex in in situ detection of cells in space.

[0024] The present invention also provides a method for in situ spatial detection of cells using the antibody-BPA protein-nucleic acid tag complex, comprising the following steps:

[0025] S1. Based on the sequence of oligonucleotides in the antibody-BPA protein-nucleic acid tag complex, design lock probes and initiation probes, and perform phosphorylation treatment;

[0026] S2. After in situ detection pretreatment of the cell samples to be tested, add the antibody-BPA protein-nucleic acid tag complex for antibody incubation;

[0027] S3. Add the phosphorylated lock probe and the initiation probe to the sample to be tested that binds to the antibody-BPA protein-nucleic acid tag complex for hybridization reaction;

[0028] S4. After the hybridization reaction is complete, T4 DNA ligase is added to the sample to be tested to carry out the ligation reaction.

[0029] S5. After the ligation reaction is complete, add phi29 DNA polymerase to the sample to be tested and perform rolling circle amplification reaction.

[0030] S6. After the rolling circle amplification reaction is completed, the fluorescent probe is added to the sample to be tested for in situ hybridization and color development; finally, the sample to be tested is subjected to imaging analysis.

[0031] Furthermore, in step S1, when the oligonucleotide is BG-PMS2, the designed lock-in probe and initiation probe are as follows:

[0032] Lock-on probe PMS2-PLP:

[0033] ACGCTTCGCTAACCCTAATGAGATCGTCATCGTGACCGTAGTCGCTGCTATA (SEQ ID NO: 13);

[0034] Initiation probe PMS2-RCA: ACGATGACGATCTCAT (SEQ ID NO: 14);

[0035] When the oligonucleotide is BG-MLH1, the designed lock-in probe and initiation probe are as follows:

[0036] Lock-on probe MLH1-PLP:

[0037] TTGCCGATCACATATGTGACCGGGTACAATATGTGACCGGGTACACCGAGAACCCT (SEQ ID NO: 15);

[0038] Initiating probe MLH1-RCA: CATATTAAGTGTACCCGGTCACA (SEQ ID NO: 16);

[0039] When the oligonucleotide is BG-MSH2, the designed lock-in probe and initiation probe are as follows:

[0040] Lock-on probe MSH2-PLP:

[0041] TGCCGATAACACCGTCTATTAGTGGAGCCAGTCTATTAGTGGAGCCTCACCGTACAACT (SEQ IDNO: 17);

[0042] Initiation probe MSH2-RCA: CGACAGGCTCCACTAATAG (SEQ ID NO: 18);

[0043] When the oligonucleotide is BG-MSH6, the designed lock-in probe and initiation probe are as follows:

[0044] Lock-on probe MSH6-PLP:

[0045] ACTCATAACACCGATAACGATCCCTCACAAATAACGATCCCTCACACACGACGACCT (SEQ ID NO: 19);

[0046] Initiation probe MSH6-RCA: ACATCAAACCCTGTGAGGGATCGTT (SEQ ID NO: 20);

[0047] When the oligonucleotide is BG-2PMS2, the designed lock-in probe and initiation probe are as follows:

[0048] Lock-on probe 2PMS2-PLP:

[0049] ACCTCGTCCTACTACCCGAGATAGAGTCATACCCGAGATAGAGTCGCAATTTAAGCCT (SEQ ID NO: 21);

[0050] Initiation probe 2PMS2-RCA: TGACTCTATCTCGGG (SEQ ID NO: 22).

[0051] Furthermore, in step S2, the samples to be tested are cell samples and paraffin samples;

[0052] When the sample to be tested is a cell sample, the cells are human colorectal cancer Lovo cells. The pretreatment process is as follows: the cultured cells are washed with PBST, fixed with paraformaldehyde, washed with gradient alcohol, punched with Triton and blocked with goat serum in sequence.

[0053] When the sample to be tested is a paraffin sample, the paraffin sample is a paraffin section of colorectal cancer PMMR type. The pretreatment process is as follows: the paraffin section is dewaxed, antigen retrieval is performed and proteinase K digestion is performed in sequence.

[0054] Furthermore, in step S6, when the oligonucleotide is BG-PMS2, the fluorescent probe is A-546 (SEQ ID NO: 8).

[0055] When the oligonucleotide is BG-MLH1, the fluorescent probe is B-488 (SEQ ID NO: 9).

[0056] When the oligonucleotide is BG-MSH6, the fluorescent probe is B-cy3 (SEQ ID NO: 10).

[0057] When the oligonucleotide is BG-MSH2, the fluorescent probe is B-cy7 (SEQ ID NO: 12).

[0058] When the oligonucleotide is BG-2PMS2, the fluorescent probe is B-cy5 (SEQ ID NO: 11).

[0059] The principle of this invention:

[0060] 1. This invention introduces BPA-mediated photoinduced covalent crosslinking technology. Initial directional anchoring is achieved using the natural affinity of Protein A for the IgG Fc fragment; subsequently, under 365 nm ultraviolet light excitation, free radicals generated by the BPA group undergo specific covalent crosslinking with the amino acid residues of the antibody Fc fragment. This transforms the originally "reversible physical binding" into "irreversible chemical locking," completely solving the stability problem of the probe under harsh experimental conditions and preventing detachment.

[0061] 2. This invention employs a dual strategy of Fc segment directional anchoring and SNAP-tag enzymatic modification. First, the Protein A domain ensures that the adapter binds only to the antibody tail (Fc region), completely avoiding the head Fab region; second, SNAP-tag and O...6 The highly efficient enzymatic reaction of DNA modified with benzylguanine (BG) enables site-specific conjugation of nucleic acid tags. This maximizes the preservation of the antibody's natural recognition activity and achieves precise, controllable conjugation of nucleic acid tags to antibodies at a ratio of "1:1" or "1:2", ensuring high batch-to-batch consistency.

[0062] 3. This invention utilizes antibody-carried DNA barcodes as anchors to design specific lock-lock probes for in situ rolling circle amplification (RCA). This not only amplifies weak protein signals thousands of times, breaking through the sensitivity limits of traditional immunofluorescence, but also enables the simultaneous detection of multiple proteins in a single sample by resolving different barcode sequences. This technology can efficiently, accurately, and sensitively resolve the spatial distribution and interactions of proteins and nucleic acids in cells and tissues. Especially in the analysis of highly heterogeneous samples such as the tumor immune microenvironment, this invention provides an unprecedented in situ visualization tool for proteomics, histopathology, companion diagnostics, and the development of novel therapeutics.

[0063] The beneficial effects of this invention are:

[0064] Compared with the prior art, the present invention has the following significant advantages:

[0065] 1. It solves the problems of antibody conjugate stability and easy detachment, significantly improving the reliability of detection.

[0066] Existing affinity labeling techniques based on Protein A / G primarily rely on non-covalent bonding, which is reversible and easily dissociates under multiple washes or harsh hybridization conditions. This invention introduces a recombinant linker containing the non-natural amino acid BPA, and achieves specific covalent cross-linking between the antibody Fc fragment and the linker through long-wave ultraviolet light (365 nm) excitation to induce a free radical reaction. This "photolocking" mechanism transforms the originally unstable physical adsorption into an irreversible chemical bond, completely solving the problem of probe detachment in complex experimental procedures and ensuring signal stability.

[0067] 2. Achieve targeted labeling of the antibody Fc fragment to maximize the preservation of antibody recognition activity.

[0068] Traditional chemical conjugation methods (targeting amino or thiol groups) often result in random site selection, leading to antibody inactivation due to occupancy of the Fab region or alteration of antibody conformation. This invention utilizes the Protein A domain to target the natural affinity of the IgG Fc fragment, ensuring the nucleic acid tag attaches only to the antibody tail, completely avoiding the antigen-binding site (Fab region) at the antibody head. This design maximizes the preservation of the antibody's natural recognition ability and affinity for the target antigen, significantly outperforming traditional random conjugation techniques.

[0069] 3. The coupling products are uniform and controllable, possessing extremely high versatility.

[0070] This invention utilizes SNAP-tag and O 6 The highly efficient enzymatic reaction of DNA modified with benzylguanine (BG) enables site-specific and quantitative (1:1 or 1:2) conjugation of nucleic acid tags to antibodies, effectively avoiding the problems of high product heterogeneity and large batch-to-batch variability in traditional chemical methods. Furthermore, this "universal adapter" strategy is applicable to IgG antibodies from the vast majority of species, eliminating the need for cumbersome genetic modification or chemical activation for each specific antibody, thus possessing extremely high commercial application potential and versatility.

[0071] 4. Breaking through the limits of detection sensitivity and throughput, achieving in-situ analysis at the single-cell level.

[0072] This invention converts antibody signals into amplifiable nucleic acid signals and combines MIP-seq locked probes with in situ rolling circle amplification (RCA) technology to achieve a thousand-fold amplification of the signal, successfully overcoming the sensitivity limitations of traditional immunofluorescence for detecting low-abundance proteins. Simultaneously, by utilizing massive amounts of nucleic acid barcode encoding, the limitations of fluorescence spectral overlap are overcome, enabling high-throughput simultaneous detection of dozens to hundreds of proteins in a single sample.

[0073] 5. Construct a spatial multi-omics co-examination platform to empower research on complex pathological mechanisms.

[0074] The solution provided by this invention has strong compatibility, enabling the simultaneous acquisition of spatial distribution information of proteins and nucleic acids at single-cell resolution on the same tissue slice. This provides an unprecedented visualization tool for analyzing highly heterogeneous samples such as the tumor immune microenvironment, helping to reveal the spatial regulatory relationship between gene transcription and protein expression, and has significant application value in disease diagnosis, drug screening, and precision medicine. Attached Figure Description

[0075] Figure 1 Electrophoresis diagram showing the results of antibody-oligonucleotide conjugation;

[0076] In the figure, 1 is the PMS2 Monoclonal Antibody; 2 is the recombinant protein protein A-bpa-SNAP-tag; 3 is the antibody-BPA protein-nucleic acid tag complex obtained by irradiating the antibody and recombinant protein at a molar ratio of 1:2 for 60 min under ultraviolet light; 4 is the antibody-BPA protein-nucleic acid tag complex obtained by irradiating the antibody and recombinant protein at a molar ratio of 1:5 for 60 min under ultraviolet light; 5 is the antibody-BPA protein-nucleic acid tag complex obtained by irradiating the antibody and recombinant protein at a molar ratio of 1:2 for 90 min under ultraviolet light; 6 is the antibody-BPA protein-nucleic acid tag complex obtained by irradiating the antibody and recombinant protein at a molar ratio of 1:5 for 90 min under ultraviolet light.

[0077] Figure 2 This image shows the results of in situ detection of PMS2 protein expression in the human colon cancer Lovo cell line.

[0078] In the figure, A shows the DAPI staining results of LOVO cells; B shows the FISH results of the PMS2 antibody-BPA protein-nucleic acid tag complex in LOVO cells; C shows the immunofluorescence staining results of PMS2 antibody in LOVO cells; D shows the FISH results of the PMS2 antibody-BPA protein-nucleic acid tag complex in CRFK cells; E shows the FISH results of the PMS2 antibody-BPA protein-nucleic acid tag complex in PK-15 cells; and F shows the FISH results of the PMS2 antibody-BPA protein-nucleic acid tag complex in HEK 293 cells.

[0079] Figure 3 This is a graph showing the sensitivity comparison between the method of the present invention and the conventional immunofluorescence method for detecting PMS2;

[0080] In the figure, IF represents conventional immunofluorescence assay; FISH represents BPA-antibody-nucleic acid conjugation assay; DAPI represents nuclear staining; 1:200, 1:500, 1:1000 and 1:2000 represent the dilution ratios of the antibody-BPA protein-nucleic acid tag complex.

[0081] Figure 4 This is a graph showing the results of multiplex detection of MMR proteins;

[0082] In the diagram, green represents BG-MLH1; red represents BG-MSH6; cyan represents BG-MSH2; and purple represents BG-2PMS2. Detailed Implementation

[0083] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0084] Example 1

[0085] Preparation of recombinant protein A-bpa-SNAP-tag

[0086] Computer-aided design of recombinant protein protein A-bpa-SNAP-tag (PyMOL and AlphaFold 3) was used to screen amino acid sites where protein A interacts with immunoglobulin (IgG) antibodies. The insertion site of BPA in recombinant protein protein A-bpa-SNAP-tag was found to be the 12th amino acid shown in SEQ ID NO: 2.

[0087] The non-natural amino acid Bpa was introduced into *E. coli* using a dual plasmid system and a dual induction strategy. The recombinant protein A-bpa-SNAP-tag was then expressed and purified. The specific steps are as follows:

[0088] 1. Prokaryotic expression of recombinant protein A-bpa-SNAP-tag

[0089] (1) The nucleotide sequence of protein A-SNAP-tag is the 1st to 906th bases shown in SEQ ID NO: 1. Protein A-SNAP-tag is linked to the prokaryotic expression vector PET32a+ (Shanghai Sangon Biotech Co., Ltd.) to obtain the vector PET32a+-protein A-SNAP-tag.

[0090] (2) Under the action of aminoacyl-TRNA synthetase, PEVOL-pbpf (Ubisoft Biotechnology Co., Ltd.) and the constructed vector PET32a+-protein A-SNAP-tag were co-transformed into Escherichia coli competent cells BL21(DE3). When OD600=0.6, BPA (4-benzoyl-L-phenylalanine) was added to a final concentration of 1mM. After induction at a final concentration of 0.5mM IPTG and a final concentration of 0.2% arabinose at low temperature of 25℃ for 8-12h, the cells were collected after high pressure disruption to obtain crude protein protein A-bpa-SNAP-tag. The amino acid sequence of protein A-bpa-SNAP-tag is shown in SEQ ID NO: 2, where BPA is inserted into the 12th amino acid of protein A-bpa-SNAP-tag.

[0091] 2. Purification of recombinant protein A-bpa-SNAP-tag

[0092] The crude protein protein A-bpa-SNAP-tag was purified by affinity chromatography and molecular sieve using an NTA-NI column to achieve a purity of over 90%, resulting in the purified recombinant protein protein A-bpa-SNAP-tag with a concentration of 1 mg / ml.

[0093] Example 2

[0094] Preparation of antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-PMS2

[0095] (1) The purified recombinant protein A-bpa-SNAP-tag was mixed with O 6 The β-benzylguanine (BG)-modified oligonucleotide BG-PMS2 was reacted at a molar ratio of 1:1 at room temperature for 15 min. After desalting to remove unbound oligonucleotides, the protein-nucleic acid complex BPA-BG-PMS2 was obtained. The sequence of oligonucleotide BG-PMS2 is shown in Table 1. The BG-modified oligonucleotide BG-PMS2 reacted with the recombinant protein protein A-bpa-SNAP-tag at room temperature to form a stable covalent bond.

[0096] (2) After dialysis, the PMS2 antibody (Miyuki Clone No. 1G4E6) was reacted with the protein-nucleic acid complex BPA-BG-PMS2 at a molar ratio of 1:2 or 1:5 at 4℃ for 2 h. Then, it was irradiated with 365 nm ultraviolet light for 60 min or 90 min, and purified by ultrafiltration to form a homogeneous and stable antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-PMS2. Figure 1 As shown, the recombinant protein protein A-bpa-SNAP-tag was used to achieve uniform and controllable conjugation of antibodies and oligonucleotides. The optimal conditions for constructing the antibody-BPA protein-nucleic acid tag complex were: a molar ratio of antibody to recombinant protein of 1:2 and an ultraviolet irradiation time of 60 min.

[0097] Table 1. Oligonucleotides and probes for detecting PMS2 protein expression in human colon cancer Lovo cell lines.

[0098]

[0099] Example 3

[0100] In situ detection of PMS2 protein expression in human colon cancer Lovo cell line using BPA-antibody-nucleic acid conjugation method

[0101] In this embodiment, the expression of PMS2 protein in the human colon cancer Lovo cell line was detected using the antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-PMS2 from Example 2.

[0102] 1. Design of hybridization probes

[0103] Based on the sequence of the oligonucleotide conjugated to the PMS2 antibody, hybridization probes with high hybridization efficiency and strong specificity containing specific barcodes were designed using the MIP-seq probe method. The probe sequences are shown in Table 1.

[0104] 2. Probe pretreatment

[0105] The 5' end of the lock-in probe PMS2-PLP was phosphorylated using T4 polynucleotide kinase. PMS2-RCA was then added to initiate the annealing process at 95℃ for 5 min, followed by a decrease in temperature to 25℃ at 0.1℃ / s, to obtain the phosphorylated probe PMS2-PLP-RCA.

[0106] 3. Primary antibody incubation

[0107] ① The positive cell line, human colorectal cancer Lovo cells, was seeded into a confocal microplate and cultured for 8-10 hours. A reaction chamber was prepared on the culture plate and washed twice with PBST solution (PBS solution containing 0.1% Tween 20) to remove residual culture medium and other impurities. At the same time, negative cell lines CRFK cells, PK-15 cells, or HEK-293 cells were used as negative controls.

[0108] ② Fix cells with 4% paraformaldehyde (PFA) for 15 min, aspirate the solution from the reaction chamber, and wash with PBST solution 3 times for 5 min each time to thoroughly remove excess PFA;

[0109] ③ Treat with gradient alcohols (70%, 85%, 100%) for 5 min each time, and wash with PBST solution 3 times for 5 min each time;

[0110] ④ Perforate with 0.5% Triton-X-100 at room temperature for 15 min, then wash three times with PBST solution for 5 min each time;

[0111] ⑤ Block with 5% goat serum at room temperature for 30 min, then wash three times with PBST solution for 5 min each time;

[0112] ⑥ Add diluted antibody-BPA protein-nucleic acid tag complex at a dilution ratio of 1:200-2000. The dilution solution consists of 0.1% Triton X-100, 2% nuclease-free BSA, 0.02%-0.1% dextran sulfate, and PBST solution containing 5 mM EDTA. Incubate overnight at 4°C (8-12 h).

[0113] 4. Sample hybridization

[0114] ① The primary antibody system binding the antibody-BPA protein-nucleic acid tag complex was recovered and washed three times with PBST solution for 5 minutes each time to thoroughly remove excess impurities;

[0115] ② Fix cells with 4% paraformaldehyde (PFA) for 15 min, aspirate the solution from the reaction chamber, and wash with PBST solution 3 times for 5 min each time to thoroughly remove excess PFA;

[0116] ③ Add the phosphorylated probe PMS2-PLP-RCA from step 3 to the hybridization buffer (10% formamide, 2X SSC buffer, 1% salmon sperm DNA) at a final concentration of 100 nM, mix well to obtain the hybridization reaction system; add the hybridization reaction system to the above reaction chamber, place it in a humidified chamber, and hybridize overnight at 37°C (8~12 h).

[0117] 5. Connection reaction

[0118] Mix the T4 DNA ligase reaction system thoroughly and add it to the above reaction chamber. Incubate at 16°C for 2 hours. T4 DNA ligase reaction system: 4% T4 ligase, 10% T4 ligation buffer, 2% nuclease-free BSA (10X), and add water to a final volume of 50 μl.

[0119] 6. Rolling circle amplification

[0120] Mix the phi29 DNA polymerase rolling circle expansion reaction system thoroughly and add it to the above reaction chamber. Incubate at 30°C for 8 hours. The phi29 DNA polymerase rolling circle expansion reaction system consists of 10% Phi 29 enzyme, 10% Phi 29 buffer, 10% dntp, 5% glycerol, and water to a final volume of 50 μl.

[0121] 7. Fluorescent probe hybridization

[0122] ① Add fluorescent probe A-546 (SEQ ID NO: 8) to the above reaction chamber at a final concentration of 500 nM and place at 37°C for 30 min, then allow to equilibrate at room temperature for 30 min.

[0123] ② Discard the hybridization reaction system in the chamber, wash twice with PBST solution, 5 min each time. Then add goat anti-mouse 647 as a fluorescent secondary antibody (1:500 dilution, Thermo Fisher Scientific), and prepare it with primary antibody dilution buffer (0.1% Triton X-100, 2% nuclease-free BSA, 0.02%-0.1% dextran sulfate, PBST solution containing 5 mM EDTA), and incubate at 37℃ for 45 min;

[0124] ③ Discard the hybridization reaction system in the chamber, wash three times with PBST solution for 10 min each time. Then prepare a DAPI staining solution with a concentration of 0.1 μg / ml using PBS, add the DAPI staining solution to the reaction chamber, and react at room temperature for 2 min.

[0125] Imaging was performed using a Leica TCS SP8 laser confocal imaging system. Corresponding fluorescence channels were set to determine the signal peaks and troughs of cells. The tissue was scanned layer by layer with a step size of 0.5 μm, and the images from each layer were superimposed to obtain the overall signal map with maximum projection. Results are as follows: Figure 2 As shown, the detection sensitivity of the BPA-antibody-nucleic acid conjugation method is significantly better than that of the traditional immunofluorescence IHC.

[0126] The expression of PMS2 protein in human colon cancer Lovo cell line was detected using conventional immunofluorescence (IF) and compared with the BPA-antibody-nucleic acid conjugation method of this embodiment. The results are as follows: Figure 3 As shown, when the PMS2 antibody was used to verify the effect on the Lovo cell line, as the antibody-BPA protein-nucleic acid tag complex was continuously diluted (1:200~1:2000), the immunofluorescence signal gradually weakened and eventually disappeared, while the signal of the BPA-antibody-nucleic acid conjugation method was not significantly affected.

[0127] Example 4

[0128] Preparation of antibody-BPA protein-nucleic acid tag complexes Ab-BPA-BG-MLH1, Ab-BPA-BG-MSH6, Ab-BPA-BG-MSH2 and Ab-BPA-BG-2PMS2

[0129] (1) Following the method in Example 2, the recombinant protein A-bpa-SNAP-tag was mixed with O 6The oligonucleotides BG-MLH1, BG-MSH6, BG-MSH2, and BG-2PMS2 modified with benzylguanine were combined to obtain protein-nucleic acid complexes BPA-BG-MLH1, BPA-BG-MSH6, BPA-BG-MSH2, and BPA-BG-2PMS2, respectively. The oligonucleotide sequences of this embodiment are shown in Table 2.

[0130] Table 2. Oligonucleotides for MMR protein multiplexing.

[0131]

[0132] (2) The protein-nucleic acid complex BPA-BG-MLH1 was conjugated with MLH1 antibody (Mitaka, Clone No. 241472D1) according to the method in Example 2 to obtain antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-MLH1;

[0133] The antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-MSH6 was obtained by using the protein-nucleic acid complex BPA-BG-MSH6 and the MSH6 antibody (Mitsubishi, Clone No. 66172-1-Ig) in the same step.

[0134] The antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-MSH2 was obtained by using the protein-nucleic acid complex BPA-BG-MSH2 and the MSH2 antibody (Mitsubishi Clone No. 2775-1-RR) in the same step.

[0135] The antibody-BPA protein-nucleic acid tag complex Ab-BPA-BG-2PMS2 was obtained by using the protein-nucleic acid complex BPA-BG-2PMS2 and the PMS2 antibody (Mitsubishi Clone No. 1G4E6) in the same step.

[0136] Example 5

[0137] Multiplex detection of MMR proteins in human colorectal cancer pMMR-type pathological samples was performed using the BPA-antibody-nucleic acid conjugation method.

[0138] This embodiment utilizes the antibody-BPA protein-nucleic acid tag complexes Ab-BPA-BG-MLH1, Ab-BPA-BG-MSH6, Ab-BPA-BG-MSH2, and Ab-BPA-BG-2PMS2 from Example 4 to perform multiplex detection of MMR proteins.

[0139] 1. Based on the oligonucleotide sequence, the probe sequence was designed as shown in Table 3.

[0140] Table 3. Probes for multiplex detection of MMR proteins

[0141]

[0142] 2. Primary antibody incubation

[0143] (1) Dewaxing the paraffin sections of colorectal cancer PMMR type according to the procedure in Table 4:

[0144] Table 4 Dewaxing Process

[0145]

[0146] (2) Dilute 50×Tris-EDTA antigen retrieval solution (Beyotime, #P0084) to 1× with DEPC-H2O, and perform antigen retrieval on the dewaxed sections at 80℃ for 30 min;

[0147] (3) Dilute proteinase K (20 mg / mL) in PBS solution at a ratio of 1:2000 and digest the repaired sections at 37°C for 10 min;

[0148] (4) After digestion, discard proteinase K, transfer the slice to 1×glycine solution, and let stand at room temperature for 1 min to terminate the reaction;

[0149] (5) Discard the 1× glycine solution, wash twice with PBS solution, and dilute the antibody-BPA protein-nucleic acid tag complexes Ab-BPA-BG-MLH1, Ab-BPA-BG-MSH6, Ab-BPA-BG-MSH2, and Ab-BPA-BG-2PMS2 at a ratio of 1:500 using antibody dilution buffer. Add the diluted four complexes to the slides and incubate at 4°C for 12 h. The antibody dilution buffer formula (total volume 100 μL) is as follows: 10% Triton X-100: 5 μL; 20× PBS: 5 μL; 20% BSA: 1 μL; add ddH2O to 100 μL.

[0150] 3. Detect antibody tags

[0151] (1) The 5' end of the lock probe MLH1-PLP was phosphorylated by T4 polynucleotide kinase, and MLH1-RCA was added to initiate the annealing treatment at 95℃ for 5 min, and then the temperature was reduced to 25℃ at 0.1℃ / s to obtain the phosphorylated probe MLH1-PLP-RCA.

[0152] The 5' end of the lock-lock probe MSH2-PLP was phosphorylated using T4 polynucleotide kinase. MSH2-RCA was added to initiate the annealing process at 95℃ for 5 min, followed by a decrease in temperature to 25℃ at 0.1℃ / s, to obtain the phosphorylated probe MSH2-PLP-RCA.

[0153] The 5' end of the lock-in probe MSH6-PLP was phosphorylated using T4 polynucleotide kinase. MSH6-RCA was added to initiate the annealing process at 95℃ for 5 min, followed by a decrease in temperature to 25℃ at 0.1℃ / s, to obtain the phosphorylated probe MSH6-PLP-RCA.

[0154] The 5' end of the locked probe 2PMS2-PLP was phosphorylated using T4 polynucleotide kinase. 2PMS2-RCA was added to initiate the annealing treatment of the probe at 95℃ for 5 min, followed by a decrease in temperature to 25℃ at 0.1℃ / s, to obtain the phosphorylated probe 2PMS2-PLP-RCA.

[0155] (2) Wash the slices after incubation in step 3 with PBST (PBS solution containing 0.1% Tween 20) at 25°C for 3 times, 10 min each time;

[0156] (3) Add phosphorylated probes MLH1-PLP-RCA, MSH2-PLP-RCA, MSH6-PLP-RCA and 2PMS2-PLP-RCA to hybridization buffer (10% formamide, 2X SSC buffer, 1% salmon sperm DNA) to a final concentration of 100 nM, mix well to obtain the hybridization reaction system; add the hybridization reaction system to the slide, place it in a humidified chamber, and hybridize overnight at 37°C (8~12 h).

[0157] (4) Mix the T4 DNA ligase reaction system of Example 2, add it to the slice, and place it at 16°C for 2 hours;

[0158] (5) Mix the phi29 DNA polymerase rolling circle expansion reaction system of Example 2, add it to the slice, and place it at 30°C for 8 hours;

[0159] (6) Prepare a DAPI staining solution with a concentration of 0.1 μg / ml using PBS solution, add the DAPI staining solution to the slide for DAPI staining, and react at room temperature for 2 min;

[0160] (7) Prepare a fluorescent probe reaction system (containing 10 nM B-488 (SEQ ID NO: 9), 10 nM B-cy3 (SEQ ID NO: 10), 10 nM B-cy5 (SEQ ID NO: 11), and 10 nM B-cy7 fluorescent probes (SEQ ID NO: 12)) and add it to the slide. Place it at 25°C and react for 1 hour. Wash the slide three times with PBST solution for 5 min each time.

[0161] (8) Add PBST solution and use a Leica Thunder imaging system wide-field microscope to image and obtain the fluorescence position information of B-488, B-cy3, B-cy5 and B-cy7;

[0162] (9) Images were collected at 0.6 μm steps, merged, registered, and calibrated using barcodes to determine the spatial distribution of MMR proteins. The spatial location information of MMR proteins within the tissue was then reconstructed. The results are as follows: Figure 4 As shown in the figure, the four colors of the signal represent four MMR proteins: green represents MLH1; red represents MSH6; cyan represents MSH2; and purple represents PMS2.

[0163] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for preparing an antibody-BPA protein-nucleic acid tag complex, characterized in that: Includes the following steps: (1) The recombinant protein A-bpa-SNAP-tag was combined with O 6 The recombinant protein protein A-bpa-SNAP-tag is bound to an oligonucleotide modified with benzylguanine to obtain a protein-nucleic acid complex; the amino acid sequence of the recombinant protein protein A-bpa-SNAP-tag is shown in SEQ ID NO: 2, and 4-benzoyl-L-phenylalanine is inserted at the 12th amino acid position. (2) The protein-nucleic acid complex and the antibody are coupled together and then subjected to ultraviolet irradiation to obtain the antibody-BPA protein-nucleic acid tag complex.

2. The preparation method according to claim 1, characterized in that: In step (1), the O 6 The oligonucleotide modified with benzylguanine is any one of BG-PMS2, BG-MLH1, BG-MSH6, BG-MSH2 and BG-2PMS2; The recombinant protein A-bpa-SNAP-tag and O 6 The molar ratio of β-benzylguanine-modified oligonucleotides is 1:1~2; the binding time is 15~20 minutes; The nucleotide sequences of BG-PMS2, BG-MLH1, BG-MSH6, BG-MSH2 and BG-2PMS2 are shown in SEQ ID NO: 3 to SEQ ID NO: 7; The recombinant protein A-bpa-SNAP-tag and O 6 The molar ratio of β-benzylguanine-modified oligonucleotides was 1:1; the binding time was 15 minutes.

3. The preparation method according to claim 1, characterized in that: The antibody is any one of PMS2, MLH1, MSH6, and MSH2; The molar ratio of the antibody to the protein-nucleic acid complex is 1:2~5; The coupling temperature is 4~8℃, and the coupling time is 2~3 h; The wavelength of the ultraviolet irradiation is 350~365 nm, and the irradiation time is 60~90 min.

4. An antibody-BPA protein-nucleic acid tag complex prepared by the preparation method according to any one of claims 1 to 3.

5. The application of the antibody-BPA protein-nucleic acid tag complex of claim 4 in in situ detection in cells.

6. A method for in situ spatial detection of cells using the antibody-BPA protein-nucleic acid tag complex as described in claim 4, characterized in that: Includes the following steps: S1. Based on the sequence of oligonucleotides in the antibody-BPA protein-nucleic acid tag complex, design lock probes and initiation probes, and perform phosphorylation treatment; S2. After in situ detection pretreatment of the cell samples to be tested, add the antibody-BPA protein-nucleic acid tag complex for antibody incubation; S3. Add the phosphorylated lock probe and the initiation probe to the sample to be tested that binds to the antibody-BPA protein-nucleic acid tag complex for hybridization reaction; S4. After the hybridization reaction is complete, T4 DNA ligase is added to the sample to be tested to carry out the ligation reaction. S5. After the ligation reaction is complete, add phi29 DNA polymerase to the sample to be tested and perform rolling circle amplification reaction. S6. After the rolling circle amplification reaction is completed, the fluorescent probe is added to the sample to be tested for in situ hybridization and color development; finally, the sample to be tested is subjected to imaging analysis.

7. The method according to claim 6, characterized in that: In step S1, when the oligonucleotide is BG-PMS2, the designed lock-in probe and initiation probe are as follows: Lock-on probe PMS2-PLP: ACGCTTCGCTAACCCTAATGAGATCGTCATCGTGACCGTAGTCGCTGCTATA; Initiation probe PMS2-RCA: ACGATGACGATCTCAT; When the oligonucleotide is BG-MLH1, the designed lock-in probe and initiation probe are as follows: Lock-on probe MLH1-PLP: TTGCCGATCACATATGTGACCGGGTACAATATGTGACCGGGTACACCGAGAACCCT; Initiating probe MLH1-RCA: CATATTAAGTGTACCCGGTCACA; When the oligonucleotide is BG-MSH2, the designed lock-in probe and initiation probe are as follows: Lock-on probe MSH2-PLP: TGCCGATAACACCGTCTATTAGTGGAGCCAGTCTATTAGTGGAGCCTCACCGTACAACT; Initiation probe MSH2-RCA: CGACAGGCTCCACTAATAG; When the oligonucleotide is BG-MSH6, the designed lock-in probe and initiation probe are as follows: Lock-on probe MSH6-PLP: ACTCATAACACCGATAACGATCCCTCACAAATAACGATCCCTCACACACGACGACCT; Initiation probe MSH6-RCA: ACATCAAACCCTGTGAGGGATCGTT; When the oligonucleotide is BG-2PMS2, the designed lock-in probe and initiation probe are as follows: Lock-on probe 2PMS2-PLP: ACCTCGTCCTACTACCCGAGATAGAGTCATACCCGAGATAGAGTCGCAATTTAAGCCT; Initiation probe 2PMS2-RCA: TGACTCTATCTCGGG.

8. The method according to claim 6, characterized in that: In step S2, the samples to be tested are cell samples and paraffin samples; When the sample to be tested is a cell sample, the cells are human colorectal cancer Lovo cells. The pretreatment process is as follows: the cultured cells are washed with PBST, fixed with paraformaldehyde, washed with gradient alcohol, punched with Triton and blocked with goat serum in sequence. When the sample to be tested is a paraffin sample, the paraffin sample is a paraffin section of colorectal cancer PMMR type. The pretreatment process is as follows: the paraffin section is dewaxed, antigen retrieval is performed and proteinase K digestion is performed in sequence.

9. The method according to claim 7, characterized in that: In step S6, when the oligonucleotide is BG-PMS2, the fluorescent probe is A-546; When the oligonucleotide is BG-MLH1, the fluorescent probe is B-488; When the oligonucleotide is BG-MSH6, the fluorescent probe is B-cy3; When the oligonucleotide is BG-MSH2, the fluorescent probe is B-cy7; When the oligonucleotide is BG-2PMS2, the fluorescent probe is B-cy5.

Images