Aptamer for specifically recognizing tetrodotoxin and application thereof
By designing a cyclic bivalent aptamer and a 3D-DNA walker sensor, a highly sensitive detection of tetrodotoxin was achieved using the magnetic kite-like complex MB@TDK, solving the problem of poor detection performance in existing technologies and realizing the specific recognition and signal amplification of low concentrations of tetrodotoxin.
Patent Information
- Application Number
- CN202511814232.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-04
- Publication Date
- 2026-04-07
AI Technical Summary
Existing technologies for tetrodotoxin detection are ineffective due to low sensitivity and high signal-to-noise ratio. Traditional magnetic bead MNAzyme systems are limited by issues such as random distribution of substrate orbitals, non-specific adsorption, and steric hindrance, resulting in unsatisfactory detection results.
A circular bivalent aptamer was designed and combined with a 3D-DNA walker sensor. High-density S5 strands were immobilized using magnetic beads, and signal amplification was achieved through MNAzyme cleavage sites. A magnetic kite-like complex MB@TDK was used, and Mg²⁺-assisted MNAzyme was used to directionally walk on the surface of the magnetic beads to continuously cleave the substrate, thereby achieving signal cyclic amplification.
It achieves highly sensitive detection of tetrodotoxin with a detection limit of 0.02 ng/mL, exhibits good specificity, maintains high binding performance in complex matrices, reduces background signal, and improves signal-to-noise ratio.
Smart Images

Figure CN121801918A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of detection, in particular to an aptamer specifically recognizing tetrodotoxin and application thereof. BACKGROUND
[0002] Tetrodotoxin (TTX) is an amino hydroquinoline compound with high toxicity, commonly found in pufferfish. As a potent and selective sodium channel blocker, TTX can specifically bind to the receptor site of the channel, induce conformational changes and block the normal channel opening, which can rapidly lead to nerve paralysis and muscle weakness, and cause potential fatal conditions such as respiratory failure. In order to prevent TTX food poisoning and protect public health, various detection methods have been developed so far, including mouse bioassay, liquid chromatography-mass spectrometry, enzyme-linked immunosorbent assay and immunochromatography test paper, but the sample pretreatment is complex, expensive equipment and special technical personnel are needed, and the stability is poor. In recent years, aptamer sensors based on nanomaterials have shown good application potential in the field of analysis and detection of tetrodotoxin, but low sensitivity and high signal-to-noise ratio are still the main problems they face, so it is urgent to develop reliable and sensitive aptamer sensors for detecting TTX.
[0003] In order to solve the problem of low binding affinity caused by poor stability of aptamer in matrix sample, the local flexibility restriction technology of nucleic acid can effectively promote the folding of aptamer into a specific conformation, so as to maintain high binding performance in the matrix, among which the cyclic bivalent (CB) aptamer as a typical structure-enhanced aptamer has attracted much attention. Multicomponent nucleic acid enzyme (MNAzymes) is an allosteric DNA enzyme constructed by splitting the catalytic core of DNA enzyme into two subunits. Generally, MNAzyme complex assembles into a structure with catalytic activity under the induction of target, and uses metal ions as cofactors to cut the substrate track. With the development of nanotechnology, 3D DNA walker constructed by fixing the substrate track of MNAzyme on the surface of nanoparticles exhibits high enzyme cutting efficiency due to its extended spatial dimension. However, the MNAzyme system based on traditional magnetic beads (MBs) is often limited by problems such as random distribution of substrate track, non-specific adsorption and spatial steric hindrance of MNAzyme binding, which together reduce the signal-to-noise ratio and enzyme cutting efficiency of the walking system. Therefore, it is of great significance to establish a magnetic 3D track with precise spatial control and efficient nucleic acid hybridization. In addition, based on the problem of poor performance of the above aptamer targeting tetrodotoxin, the detection effect of the sensor constructed by it is not satisfactory. SUMMARY
[0004] Therefore, the technical problem to be solved by the present application is to overcome the problem of poor detection effect of tetrodotoxin in the prior art.
[0005] To solve the above technical problems, the application provides an aptamer specifically recognizing tetrodotoxin and application thereof. The application first obtains a circular bivalent aptamer through structure optimization. The circular bivalent aptamer of the application has good affinity and specificity, good thermal stability, and is not interfered by ion strength and protein impurities in tetrodotoxin, serum and tetrodotoxin, and has high conformational stability. Based on the circular bivalent aptamer of the application, the application also designs an aptamer sensor based on 3D-DNA walker. The application designs a tetrahedral framework structure nucleic acid complex containing MNAzyme enzyme cutting site by using S1-S5 chains, and introduces magnetic beads and fluorescent quantum dots into the nucleic acid complex to obtain a magnetic kite-shaped complex (MB@TDK). When the aptamer connected with the cDNA chain efficiently recognizes and captures TTX, the cDNA chain is released. The cDNA hybridizes with HDNA in the catalytic system to form a complex having MNAzyme enzyme activity, and the S5 chain is cut off under the assistance of Mg 2+ Since the S5 chain is partially complementary to the H1 and H2 chains labeled with fluorescent quantum dots, the release of the H1 and H2 chains labeled with fluorescent quantum dots is caused by the breakage of the S5 chain, and further signal amplification is realized. Meanwhile, the introduction of the magnetic beads makes the S5 chain orderly and densely arranged, so that the activated MNAzyme realizes three-dimensional directional "walking" on the surface of the magnetic beads and continuously cuts the substrate, realizing cyclic amplification of the signal.
[0006] Walker cycle and principle: in the presence of the target, the released cDNA chain specifically hybridizes with HDNA to form a cDNA-HDNA complex, which folds to form a catalytically active MNAzyme, and at the same time, the MNAzyme is combined with the S5 chain fixed on the surface of the magnetic bead through base complementary pairing, realizing the assembly of the "catalytic unit-track", under the assistance of Mg²⁺, the activated MNAzyme specifically recognizes the cleavage site (R) of the S5 chain and breaks its phosphodiester bond. After the S5 chain is broken, the HCR-QDs complex originally partially complementary to the S5 chain is released from the surface of the magnetic bead into the solution to generate a fluorescence signal (first signal output), after the S5 chain is cut, the complementary pairing of the S5 chain with the MNAzyme is weakened (the binding force of the broken fragment decreases), and the MNAzyme (cDNA-HDNA complex) is dissociated from the cut S5 fragment. Because a large number of high-density S5 chains (tracks) are fixed on the surface of the magnetic bead, the active MNAzyme dissociated from the S5 chain will quickly re-hybridize with the adjacent uncut S5 chain, completing a "walk". The MNAzyme recombined with the S5 chain again exerts a catalytic effect to cut the new S5 chain, release the HCR-QDs complex, and generate a stronger fluorescence signal. The process (dissociation-recombination-cutting) is repeated continuously, and an activated cDNA-MNAzyme complex can cut multiple S5 chains on the surface of the magnetic bead (theoretically, dozens to hundreds of substrates can be cut), realizing the cascade amplification effect of "one target (TTX) -> release one cDNA -> activate one MNAzyme -> cut multiple S5 chains -> release a large number of quantum dots".
[0007] The first object of the present application is to provide an aptamer for detecting tetrodotoxin, and the nucleic acid sequence of the aptamer is shown as SEQ ID NO. 1.
[0008] The second object of the present application is to provide an application of the above-mentioned aptamer in the preparation of a tetrodotoxin detection product.
[0009] The third object of the present application is to provide a tetrodotoxin detection product, and the detection product comprises the above-mentioned aptamer.
[0010] The fourth object of the present application is to provide a tetrodotoxin detection method, comprising the following steps:
[0011] (1) mixing and reacting a first sequence, a second sequence, a third sequence, a fourth sequence and a fifth sequence to obtain a first complex, wherein the first sequence, the second sequence, the third sequence, the fourth sequence and the fifth sequence are shown as SEQ ID NO. 2-6, respectively;
[0012] (2) affinity connecting the first complex with a magnetic separation medium to obtain a second complex;
[0013] (3) The H1 and H2 chains coupled with fluorescent quantum dots are mixed with the second complex to obtain the third complex, wherein the H1 chain is partially complementary to the fifth sequence and the H1 and H2 chains are partially complementary.
[0014] (4) The above-mentioned aptamer and cDNA were co-incubated, and then mixed with different concentrations of tetrodotoxin. Then HDNA, the third complex and magnesium ions were added and co-incubated. After magnetic separation, the fluorescence intensity of the supernatant was detected and a curve relating fluorescence intensity to tetrodotoxin concentration was established. The cDNA and the aptamer were partially complementary, and the HDNA and the cDNA were partially complementary.
[0015] (5) Perform the test sample according to S4 and detect the fluorescence intensity. Substitute the result into the S4 relationship curve to calculate the content of tetrodotoxin in the test sample.
[0016] Furthermore, the introduction of magnetic beads immobilizes a large number of TDK structures on their surface (serving as substrate orbitals and signal outputs for Walker), resulting in an ordered and high-density arrangement of the S5 chains. This immobilization design increases the local S5 chain concentration, allowing activated MNAzymes to achieve three-dimensional directional "walking" on the magnetic bead surface and continuously cutting the substrate. This avoids the decrease in catalytic efficiency caused by the diffusion of free S5 chains, providing structural support for signal amplification. In addition, the separation characteristics of the magnetic beads further reduce background signals, thereby improving the detection signal-to-noise ratio.
[0017] Furthermore, SEQ ID NO.6:
[0018] CGCCGAATCCTAGACTACTGTGTTRGGTTTTAATCCCGGAGGTTGACGCA, where R represents riboadenosine, which is the core structural unit of the MNAzyme catalytic mechanism.
[0019] Furthermore, the sequences of H1 and H2 are shown in SEQ ID NO.7-8, respectively.
[0020] Furthermore, the H1 chain and H2 chain are respectively modified with amino groups, and the H1 chain and H2 chain are covalently connected to the fluorescent quantum dot.
[0021] Furthermore, the sequence of the cDNA is shown in SEQ ID NO.9, and the sequence of the HDNA is shown in SEQ ID NO.10.
[0022] The fifth objective of this invention is to provide an aptamer sensor based on a 3D-DNA walker, comprising:
[0023] The catalytic system comprises a multi-component deoxynuclease assembled from the HDNA shown in SEQ ID NO.10 and the cDNA shown in SEQ ID NO.9, a substrate orbital, and magnesium ions;
[0024] The aptamer is shown in SEQ ID NO.1;
[0025] A fluorescence amplification system includes a first sequence, a second sequence, a third sequence, a fourth sequence, a fifth sequence, and fluorescent quantum dot-labeled H1 and H2 chains, wherein the first, second, third, fourth, and fifth sequences are as shown in SEQ ID NO.2-6, and the sequences of the H1 and H2 chains are as shown in SEQ ID NO.7-8, respectively.
[0026] A magnetic separation medium, wherein the magnetic separation medium is affinity-connected to the first sequence and the fifth sequence.
[0027] Furthermore, the first sequence is modified with biotin, and the magnetic separation medium is modified with streptavidin.
[0028] Furthermore, it also includes a device for detecting the fluorescence signal of the fluorescent quantum dots.
[0029] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:
[0030] The cyclic divalent aptamer of this invention exhibits good affinity and specificity, good thermal stability, and is not affected by impurities such as ionic strength and protein in pufferfish meat and serum when detecting tetrodotoxin, demonstrating high conformational stability. Based on this cyclic divalent aptamer, this invention also designs an aptamer sensor based on a 3D-DNA walker. This aptamer sensor can detect low concentrations of tetrodotoxin, with a detection limit of 0.02 ng / mL, and cannot detect GTX, DTX, ATX-II, ATX-a, and MC-LR, exhibiting good specificity. Attached Figure Description
[0031] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0032] Figure 1 These are the design principles and related characteristics of the aptamer of this invention;
[0033] Figure 2 These are the stability test results of the aptamer of the present invention;
[0034] Figure 3This is a diagram illustrating the detection principle of the aptamer sensor of the present invention;
[0035] Figure 4 This is a characterization diagram of the MB@TDK complex of the present invention;
[0036] Figure 5 This is a diagram showing the feasibility verification results of the aptamer sensor of the present invention;
[0037] Figure 6 This is a graph showing the detection results of tetrodotoxin by the aptamer sensor of the present invention. Detailed Implementation
[0038] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0039] The sequence information involved in the following embodiments is shown in Table 1.
[0040] Table 1 Sequence Information
[0041]
[0042] The detection methods involved in the following embodiments:
[0043] Affinity testing methods
[0044] The binding affinity of the A36 mutant was determined using a graphene oxide (GO)-based fluorescence method. The specific steps were as follows: The FAM-labeled aptamer was diluted with binding buffer, heated at 95°C for 10 minutes, cooled on ice for 5 minutes, and then incubated with TTX at 37°C for 60 minutes. Finally, 1 mg / mL of GO was added to the mixture, and the mixture was shaken for 5 minutes. The fluorescence intensity was measured using a microplate reader (excitation wavelength: 485 nm, emission wavelength: 528 nm).
[0045] The affinity of the CB aptamer was determined by a fluorescence method based on SYBR Green I (SGI) dye. The procedure was as follows: the aptamer was mixed with SGI dye (final concentration 1×), heated at 95°C for 10 minutes, cooled on ice for 5 minutes, and then incubated at room temperature for 10 minutes to form the aptamer-SGI complex. This complex was further incubated with TTX for 30 minutes. Fluorescence intensity was measured using a microplate reader (excitation wavelength: 490 nm, emission wavelength: 520 nm).
[0046] Finally, the binding affinity was calculated using GraphPad Prism 5 software based on the fluorescence intensity change value (DF=F1-F0) and the concentration of the aptamers.
[0047] Example 1: Construction of cyclic bivalent aptamers
[0048] The mutant aptamer A36M5 was obtained using a hairpin enhancement strategy. A circular bivalent aptamer was then prepared via a T4 DNA ligase-mediated ligation reaction. The specific steps were as follows: Equal volumes of 2 μM 5'-P-A36M5-13-1 (5'-P-CGTAAATCAGTCATGGAGTCACGACGCCCAGTCAAATTTGCGTCTACTCC) and 2 μM 5'-P-A36M5-13-2 (5'-P-TGACTGATTTACGTGGAGTCACGACGCCCAGTCAAATTTGCGTCTACTCC) were dispersed in 1×T4 DNA ligase buffer. The mixture was heated at 95°C for 5 min, cooled for 5 min, and then incubated at 37°C for 4 h to form double-stranded DNA with two gaps. The resulting double-stranded DNA was then incubated with T4 DNA ligase at 16°C for 12 h, generating a circular bivalent aptamer (CB13) through the ligation gaps. The aptamer was then heated at 65°C for 10 h. After inactivating the ligase, CB13 was purified by phenol-chloroform extraction and ethanol precipitation. The concentration of CB13 was finally determined using a NanoDrop-2000 spectrophotometer. All sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0049] Cyclic bivalent aptamers were designed and prepared based on structural reinforcement strategies, such as... Figure 1 As shown in Figure A, we designed a series of mutants, including A36M1, A36M2, A36M3, A36M4, and A36M5, through base mutation. Aptamers A36M1, A36M2, and A36M3 were obtained by replacing the AT base pairs in stem 2 and stem 1 with GC base pairs, respectively. A36M4 was designed by replacing the A base at the end of stem 1 with a C base. Compared with A36, aptamers A36M1 and A36M4 showed similar affinity, while aptamers A36M2 and A36M3 showed lower affinity. Considering the influence of base pair mutations on binding affinity, we prepared mutant A36M5, which had a slightly stronger affinity (42.6 ± 2.1 nM) than A36.
[0050] To further improve the binding performance of aptamers in complex matrices, we hybridized and ligated the extended sequence of A36M5 using DNA T4 ligase, designing and constructing circular bivalent aptamers CB11, CB13, and CB15, as follows: Figure 1As shown in Figure B, electrophoresis results indicate that CB13 migrates more slowly than A36M5-13-1-P and A36M5-13-2-P, confirming the successful synthesis of the CB13 aptamer. CB13 exhibits the highest affinity (12.7 ± 1.1 nM), approximately 2.6 times higher than A36. Furthermore, compared to A36, the CD spectrum of A36M5 shows a blue shift, and the CD intensity of A36M5 and CB13 is enhanced at 280 nm and weakened at 250 nm, indicating enhanced base stacking and higher helicity. Figure 1 These results confirm that A36M5 and CB13 undergo a certain conformational transformation compared to A36. Furthermore, the melting temperature of CB13 (Tm = 64℃) is significantly higher than that of A36 and A36M5 (55℃), confirming that CB13 possesses superior thermal stability. Figure 1 D). In conclusion, we have successfully obtained the optimal aptamer CB13.
[0051] Table 2. Relevant sequences and their affinities for aptamer optimization.
[0052]
[0053] Example 2: Stability Analysis of CB13
[0054] The conformational stability of the aptamer was characterized using circular dichroism (CD) spectroscopy. In short, 10 μM of the aptamer was heated at 95 °C for 10 min, cooled for 5 min, and then added to binding buffer (BB), pufferfish meat, and serum and incubated at 37 °C for 60 min. The CD spectra of the aptamer were recorded in the wavelength range of 230–320 nm with a bandwidth of 1 nm. Subsequently, to assess the thermal stability of the aptamer, its thermal melting curve at 280 nm was monitored in the range of 25–90 °C at a heating rate of 1 °C / min.
[0055] The stability of A36 and CB13 to exonuclease I (ExoI), pufferfish meat, and fetal bovine serum was analyzed by 8% non-denaturing polyacrylamide gel electrophoresis (PAGE). Specifically, to assess the stability of the exonuclease in solution, A36 and CB13 were incubated with ExoI (concentrations of 0.1, 0.2, 0.4, and 0.6 U / μL, respectively) at 37 °C for 1 h, followed by heating the samples at 75 °C for 5 min to denature the enzyme. In addition, to assess the stability of the aptamers in complex matrices, A36 and CB13 were mixed with pufferfish meat and serum, respectively, and incubated at 37 °C for 2 h.
[0056] The stability of aptamers A36 and CB13 in complex matrices (pufferfish meat and serum) was investigated and compared, including conformational stability and biostability, such as... Figure 2As shown in Figure A, compared to the BB control group, the circular dichroism spectrum of A36 in solutions PM1 (pufferfish meat extract) and F1 (DMEM containing 10% fetal bovine serum) showed a blue shift from 280 nm to 272 nm. However, the spectral changes of A36 in diluted matrices (PM2-4 and F2-4) were negligible. These results indicate that the folding conformation of A36 is susceptible to interference from ionic strength and proteins in the matrix. In contrast, CB13 showed minimal changes under all matrix conditions, confirming its high conformational stability, which can be attributed to its enhanced structural rigidity. Subsequently, the biostability of the CB13 aptamer was evaluated by incubation with different concentrations of Exo I and various matrix solutions. Figure 2 B indicates that A36 readily degrades after incubation with 0.1 U / μL Exo I, while CB13 retains its integrity due to its cyclic structure. Furthermore, A36 exhibits instability and partial degradation under PM1 and F1 conditions, while the band intensity of A36 is restored in diluted solutions PM2-PM4 and F2-F4. Figure 2 (C and 2D). Notably, CB13 maintained band integrity under all matrix conditions, indicating that its rigid structure exhibits weak protein interactions and high ionic strength tolerance, thus demonstrating excellent biological stability.
[0057] Example 3: Preparation of MB@TDK complex
[0058] DNA tetrahedral frameworks were prepared using a one-pot method. In short, chains S1 (biotin-modified), S2, S3, and S4 were mixed in equimolar ratio in TNM buffer (10 mM Tris, 50 mM NaCl, 20 mM MgCl2, pH 7.9), heated at 95 °C for 10 min, and cooled to 4 °C for 6 h to form TDF. Subsequently, chain S5 was incubated with TDF at 37 °C for 1 h to obtain the TDF-S5 (TDS) complex.
[0059] TDS was further added to 10 μL of streptavidin-functionalized magnetic beads (SA-MBs) (1 mg / mL) and incubated at 37°C for 1.5 h to obtain the TDS-modified SA-MBs complex (MB@TDS). Then, 10% bovine serum albumin (BSA) was added and incubated at 37°C for another 0.5 h to block the unbound sites on the surface of the magnetic beads. After washing three times with PBS, MB@TDS was resuspended in PBS buffer and stored at 4°C.
[0060] Prior to the hybridization chain reaction, the amino-modified H1 and H2 chains were coupled to carboxylated red quantum dots via an amide reaction. Specifically, 20 μL of carboxylated quantum dots and 32 μL (50 μM) of H1 / H2 chains were mixed in 68 μL of 25 mM MES buffer (pH 6.5). Then, 20 μL of 10 mg / mL 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and 20 μL of 10 mg / mL N-hydroxysuccinimide were added, and the mixture was gently shaken at 25°C for 2 h to obtain the H1 / H2-QD conjugates (QD-H1 and QD-H2). Finally, MB@TDS and QD-H1 and QD-H2 were incubated in TNM buffer at an equimolar ratio at 37°C for 3 h to form the MB@TDK complex.
[0061] In addition, SA-MBs and activated S5 chains (biotin-modified) were incubated with QD-H1 at 37°C for 3 h, followed by the addition of 10% BSA and incubation at 37°C for another 0.5 h to block unbound sites on the surface of the magnetic beads. The resulting MB@S5@QD-H1 (MB@QD) complex was separated by an additional magnetic field and washed three times with PBS as a control group.
[0062] In this study, a tetrahedral DNA structure with four extension arms was synthesized using a one-pot method and immobilized on a magnetic sphere using streptavidin-biotin. Subsequently, the S5 orbital strand of MNAzyme and the quantum dot-labeled DNA strand were sequentially assembled onto the extension arms of the tetrahedral DNA framework, forming a magnetic tetrahedral kite-like complex with three-dimensional walking trajectory functionality. Figure 4 A). Transmission electron microscopy images show that the quantum dots have a uniform triangular morphology, good dispersion, and an average diameter of 6.8 nm ( Figure 4 B), whose fluorescence emission spectrum exhibits a maximum emission peak at 625 nm, effectively eliminates the interference of potential short-wavelength background fluorescence in the matrix. Figure 4 C).
[0063] Agarose gel electrophoresis confirmed the assembly of TDF and TDK. By sequentially adding DNA strands (S1, S1+S2, S1+S2+S3, S1+S2+S3+S4) into the channels, lanes 1-4 exhibited significantly different migration speeds, such as... Figure 4 As shown in Figure D, the fourth lane, containing all four chains, exhibits a bright band and the slowest migration speed, confirming successful TDF assembly. Figure 4In E, lane 3 showed a new band with a lower migration rate than lanes 1 (TDF) and 2 (S5), confirming that TDS assembly was complete. Furthermore, lanes 4-7 corresponded to H1, H2, H1+H2, and TDS+H1+H2, respectively. Lane 6 showed a band corresponding to the H1-H2 double-stranded hybridization product. When TDS was mixed with H1 and H2 (lane 7), a high-molecular-weight band with a trailing dispersion was observed, indicating successful TDK formation. In addition, Zeta potential measurements showed that the surface potential of SA-MBs before and after TDK modification significantly decreased from -13 mV to -28.7 mV. Figure 4 F), while the corresponding particle size increased from 1280 nm to 1720 nm (F). Figure 4 These results all confirm the success of the surface modification.
[0064] Example 4: Feasibility Verification and Procedures for Detecting Tetrodotoxin with a 3D DNA Walker
[0065] To verify the feasibility of the proposed enzyme digestion and fluorescent aptamer sensor, non-denaturing PAGE was used to verify the formation of reaction products during enzyme cleavage, and the fluorescence signal of the DNA walker under different conditions was investigated.
[0066] The experimental procedure for the 3D DNA walker was as follows: 10 μL of CB13 (1 μM) was incubated with cDNA at 37°C for 40 min to form a CB13-cDNA complex. The complex was then mixed with 120 μL of TTX at different concentrations and shaken at 37°C for another 50 min. Next, 10 μL of HDNA (2 μM, diluted with 10 × 10 mM Mg²⁺ buffer) and 10 μL of MB@TDK were added to the mixture to activate the Mg²⁺-dependent MNAzyme digestion reaction. Finally, the fluorescence intensity in the supernatant was measured using an F-7000 fluorescence spectrophotometer.
[0067] like Figure 5 As shown in Figure A, lanes 1-3 correspond to cDNA, HDNA, and S5, respectively, while lanes 4-6 represent HDNA+S5, cDNA+HDNA+S5, and cDNA+HDNA+S5+Mg, respectively. 2+ The hybridization product. Notably, lane 6 shows a new bright band in the low molecular weight region, accompanied by a weaker S5 band, indicating that Mg... 2+The cDNA-HDNA complex was activated to cleave the substrate S5 chain, resulting in a new, shorter DNA chain. Next, the feasibility and superiority of the target-initiated DNA walker were further evaluated. Using a traditional MB@QD-based aptamer sensor (composed of an A36-cDNA complex and MB@QD) as a control, the fluorescence intensity and signal-to-noise ratio released by MB@TDK after the addition of TTX were 3 times and 1.6 times that of MB@QD, respectively. Figure 5 B). Furthermore, the MB@TDK-based DNA walker exhibited a stronger fluorescence response and a shorter reaction time. Figure 5 C) demonstrated that the DNA walker with MB@TDK as the substrate strand has high shearing efficiency. These performance improvements are attributed to the unique design of TDK: (1) controllable high-density substrate orbitals achieved by nano-confinement; (2) the “vertical” orientation of the orbital strands on the TDF; and (3) the “single orbital-multiple quantum dot” signal amplification effect.
[0068] Under optimal experimental conditions, the analytical performance of the developed fluorescent aptamer sensor was evaluated using different concentrations of TTX. Figure 6 As shown in Figure A, when the TTX concentration increased from 0.05 ng / mL to 100 ng / mL, the fluorescence intensity increased gradually and showed a good linear relationship with the logarithm of the TTX concentration. Figure 6 B). Its regression equation is ΔF = 2011.1 log[TTX] + 2545 (R²). 2 = 0.9949), and the limit of detection was 0.02 ng / mL (calculated based on the 3δ / κ rule, where δ is the standard deviation of the blank assay and κ is the slope of the calibration curve). Subsequently, the specificity of this method was further evaluated by detecting five marine biotoxins (MC-LR, GTX, DTX, ATX-II, and ATX-a). Figure 6 As shown in Figure C, the sensor's fluorescence response to TTX is significantly stronger than that of the potential interfering toxin, confirming its superior specificity. Furthermore, stability tests indicate that the developed fluorescent aptamer sensor retains 90% of its initial signal intensity after 30 days of storage, demonstrating satisfactory storage stability. Figure 6 D).
[0069] Example 5: Spike Recovery in Real Samples
[0070] Weigh 0.2 g of pufferfish meat and mix with 4 mL of 0.1% acetic acid solution. Vigorously shake for 3 min, then sonicate for 15 min. Centrifuge the mixture at 8000 rpm for 15 min and collect the supernatant. Adjust the pH of the supernatant to 7.5 with Tris buffer and bring the volume to 20 mL. Heat the resulting solution in a 100°C water bath and maintain boiling for 10 min. Centrifuge again at 8000 rpm for 15 min. The resulting supernatant is named PM1 solution. PM2, PM3, and PM4 are solutions obtained by diluting PM1 2-fold, 4-fold, and 8-fold with 2xBB, respectively. Furthermore, F1 represents DMEM medium containing 10% fetal bovine serum, while F2, F3, and F4 are solutions obtained by diluting FM1 2-fold, 4-fold, and 8-fold with BB, respectively.
[0071] To evaluate the practical applicability of this method, spiked recovery experiments were conducted in real sample matrices. As shown in Table 1, the developed aptamer sensor achieved recoveries of 96%–110% in pufferfish meat samples with relative standard deviations (RSDs) of 3.7%–4.1%, and recoveries of 94%–114% in serum samples with RSDs of 3.7%–6.1%. Further validation by UPLC-MS showed good agreement between the proposed method's recovery rates and RSDs. In conclusion, the developed aptamer sensor demonstrated satisfactory accuracy, precision, and applicability for the quantitative analysis of TTX in real samples.
[0072] Table 1. Spiked recovery results of TTX in pufferfish meat and 10% fetal bovine serum samples
[0073]
[0074] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. An aptamer that specifically recognizes tetrodotoxin, characterized in that, The nucleic acid sequence of the aptamer is shown in SEQ ID NO.
1.
2. The use of the aptamer according to claim 1 in the preparation of tetrodotoxin detection products or tetrodotoxin capture products.
3. A product for detecting tetrodotoxin, characterized in that, The testing product includes the aptamer as described in claim 1.
4. A method for detecting tetrodotoxin, characterized in that, Includes the following steps: S1. The first sequence, the second sequence, the third sequence, the fourth sequence and the fifth sequence are mixed and reacted to obtain a first complex, wherein the first sequence, the second sequence, the third sequence, the fourth sequence and the fifth sequence are as shown in SEQ ID NO.2-6, respectively; S2. Connect the first composite with a magnetic separation medium to obtain the second composite; S3. The fluorescent quantum dot-coupled H1 and H2 chains are mixed with the second complex to obtain a third complex, wherein the sequences of the H1 and H2 chains are shown in SEQ ID NO.7-8, respectively. S4. The aptamer described in claim 1 is co-incubated with cDNA, and then mixed with different concentrations of tetrodotoxin for reaction. After that, HDNA, the third complex and magnesium ions are added and co-incubated. After magnetic separation, the fluorescence intensity of the supernatant is detected, and a curve relating fluorescence intensity to tetrodotoxin concentration is established. The sequence of the cDNA is shown in SEQ ID NO. 9, and the sequence of the HDNA is shown in SEQ ID NO.
10. S5. Perform the test on the sample according to S4 and detect the fluorescence intensity. Substitute the result into the relationship curve of S4 to calculate the content of tetrodotoxin in the sample.
5. The detection method according to claim 4, characterized in that, The first sequence is modified with biotin, and the magnetic separation medium is modified with streptavidin.
6. The detection method according to claim 4, characterized in that, The H1 and H2 chains are covalently connected to the fluorescent quantum dots, respectively.
7. The detection method according to claim 6, characterized in that, The covalent connection includes covalent connection via amide bonds.
8. An aptamer sensor based on a 3D-DNA walker, characterized in that, include, The catalytic system includes the HDNA shown in SEQ ID NO.10, the cDNA shown in SEQ ID NO.9, and magnesium ions; The aptamer is shown in SEQ ID NO.1; A fluorescence amplification system includes a first sequence, a second sequence, a third sequence, a fourth sequence, a fifth sequence, and fluorescent quantum dot-labeled H1 and H2 chains, wherein the first, second, third, fourth, and fifth sequences are as shown in SEQ ID NO.2-6, and the sequences of the H1 and H2 chains are as shown in SEQ ID NO.7-8, respectively. A magnetic separation medium, wherein the magnetic separation medium is affinity-connected to the first sequence.
9. The aptamer sensor according to claim 8, characterized in that, It also includes a device for detecting the fluorescence signal of the fluorescent quantum dots.
10. The application of the aptamer sensor according to claim 8 or 9 in the preparation of tetrodotoxin detection products.