SNP molecular marker related to wheat grain hardness on wheat 1B chromosome

By developing SNP molecular markers and KASP primer sets on wheat chromosome 1B, early and rapid detection of wheat grain hardness was achieved, solving the problem of research on genes regulating wheat grain hardness and improving breeding efficiency and variety selection speed.

CN121852582APending Publication Date: 2026-04-14GUIZHOU GUOTAI LIQUOR CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511925070.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

In the current technology, the research on genes regulating wheat grain hardness is not comprehensive, making it difficult to quickly and effectively identify and breed wheat varieties with ideal grain hardness.

Method used

We developed SNP molecular markers on wheat chromosome 1B that are associated with grain hardness and designed a KASP primer set. Through PCR amplification and fluorescence signal analysis, we achieved early and rapid detection of grain hardness.

Benefits of technology

It improves the efficiency of wheat breeding selection, shortens the breeding cycle, and enables the rapid identification and breeding of wheat varieties with ideal grain hardness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852582A_ABST
    Figure CN121852582A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of wheat molecular breeding, and particularly relates to an SNP molecular marker related to wheat grain hardness on a wheat chromosome. The SNP molecule is named as qHI.1B-1; the molecular marker contains a nucleotide sequence of which the polymorphism at the 393305782bp of the wheat 1B chromosome is A or G; the wheat with the polymorphic site genotype of GG has lower grain hardness compared with the wheat with the genotype of AA. Based on the particularity, the inventor carries out further BSR analysis on an F2 population constructed based on the two varieties, and the SNP site is obtained. Based on the site, a certain foundation can be laid for early and rapid detection and analysis of the wheat hardness character, the subsequent selection efficiency can be improved, the breeding period can be shortened, and wheat varieties with ideal grain hardness can be rapidly identified and cultivated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of wheat molecular breeding technology, specifically involving a SNP molecular marker on a wheat chromosome that is related to wheat grain hardness. Background Technology

[0002] Wheat, as one of the most important food crops, has grain hardness as a key trait determining its milling quality, significantly impacting its market value and grading. Based on market applications, wheat grain hardness is generally classified as follows: hard white wheat and hard red wheat have a hardness index of no less than 60, while soft white wheat and soft red wheat have a hardness index of no more than 45. Wheat with a hardness index less than 40 is classified as soft wheat, greater than 60 as hard wheat, and mixed wheat (which can be understood as medium hardness) falls between the two. Durham wheat grains are exceptionally hard, generally greater than 70. Extra-soft wheat grains are very soft, generally with a hardness index less than 30 or even negative.

[0003] Genomic studies have shown that wheat grain hardness is primarily determined by the Puroindoline (Pin) gene at the Ha locus on chromosome 5D, including the Pina and Pinb genes. PINA and Pinb are two seed-specific proteins, approximately 13 kDa in size, highly basic (PI 10-11), and rich in cysteine ​​(Cys) and tryptophan. They consist of 148 amino acids and belong to the 2S subfamily of endosperm seed proteins, a superfamily of endosperm seed proteins. Pina , Pinb The gene encodes the PINA and PINA proteins, which are present on the surface of starch grains in the young endosperm, making wheat grains soft. On the other hand, if one or both of these alleles mutate, the grain hardness will increase. However, due to the complexity of the wheat genome, whether there are other genes regulating wheat grain hardness requires further exploration and research. Summary of the Invention

[0004] The main purpose of this application is to provide a molecular marker of an SNP on wheat chromosome 1B that is related to wheat grain hardness, and a set of related detection primers developed based on this marker, so as to lay a certain technical foundation for the discovery of genes regulating wheat grain hardness and further regulation of wheat quality.

[0005] The specific technical solution adopted in this application is as follows.

[0006] A single SNP molecular marker on wheat chromosome 1B associated with wheat grain firmness, wherein the SNP molecular marker is a nucleotide sequence at position 393305782 bp on wheat chromosome 1B with a polymorphism of A or G, named as follows: qHI.1B-1 Based on this, wheat is divided into soft wheat (GG genotype) and hard wheat (AA genotype). That is, wheat with the GG genotype (polymorphic site G) has lower grain hardness than wheat with the AA genotype (polymorphic site A). Specifically: The wheat sequence corresponding to the SNP site for the GG genotype (201 bp, with G at position 101, as shown in SEQ ID No. 1) is as follows: TCCTTCTCTCCTCTCACTCTCTCAAAGTCTCAAGTCTCAACCGCTGCCGCGAGCCCGTGTGAGAGATGGGGAGACGCCGAGCCGGCGGCGGGGGGCGCGGAGGAGGCAGAGATCGAGGCCGAGGAGGAGAAGGACGGGGTGGAGGAGAGGAGGAGGATCTGCAGCTGCACAAGGCCGCGAGGTCGGGTGATGCGGCG; The wheat sequence corresponding to the SNP site for the AA genotype (201 bp, with A at position 101, as shown in SEQ ID No. 2) is as follows: TCCTTCTCTCCTCTCACTCTCTCAAAGTCTCAAGTCTCAACCGCTGCCGCGAGCCCGTGTGAGAGATGGGGAGACGCCGAGCCGGCGGCGGGGGGCACGGAGGAGGCAGATCGAGGCCGAGGAGGAGAAGGACGGGGTGGAGGAGAGGAGGAGGATCTGCAGCTGCACAAGGCCGCGAGGTCGGGTGATGCGGCG.

[0007] The KASP primer set for SNP molecular marker detection, which is a set of primers for PCR amplification, is specifically designed as follows: 1B_3933_F1: 5'-GAAGGTGACCAAGTTCATGCT CTCGATCTCTGCCTCCTCCGT-3'; The sequence “GAAGGTGACCAAGTTCATGCT” is a FAM fluorescent tag sequence. 1B_3933_F2: 5' -GAAGGTCGGAGTCAACGGATT CTCGATCTCTGCCTCCTCCGC -3'; The “GAAGGTCGGAGTCAACGGATT” sequence is a HEX fluorescent tag sequence. 1B_3933_R: 5'-CCTCTCACTCTCTCTCAAAGTCTCAAG-3'.

[0008] A reagent or kit for detecting wheat grain hardness was prepared using the aforementioned KASP primer set.

[0009] The KASP primer set is used in wheat variety breeding for the identification of wheat grain hardness in wheat molecular breeding.

[0010] The method for detecting wheat grain hardness using the aforementioned KASP primer set includes the following steps: (a) Preparation of DNA template DNA was extracted from the wheat samples to be tested and used as a template for PCR amplification. (II) PCR amplification Using the DNA prepared in step (I) as a template, PCR amplification was performed using the KASP primer set; For PCR amplification, the following reference design is used for a 5 μL amplification system: 2×KASP Mix, 2.5μL; Primer mixture, 0.7 μL; DNA template, 30-50 ng; Add water to a volume of 5 μL; The primer mixture, in 100 μL, comprises: 10 μM forward primer 1 (1B_3933_F1), 12 μL; 10 μM forward primer 2 (1B_3933_F2), 12 μL; 10 μM reverse primer (1B_3933_R), 30 μL; and the remainder is water. The PCR amplification program was as follows: 94℃, 15 min; 94℃, 20 s, 65℃, 60 s, 10 cycles, with the annealing temperature decreasing by 0.8℃ per cycle; 95℃, 20 s, 57℃, 60 s, 30 cycles; 25℃, 10 min. (III) Result Determination Fluorescence signal acquisition and analysis of the PCR amplification products in step (II), or electrophoresis detection and analysis or sequencing analysis of the PCR amplification products, and determination of the grain hardness trait of the wheat sample to be tested based on the analysis results; the determination criterion is: wheat with genotype GG has lower grain hardness than wheat with genotype AA.

[0011] In their routine hybridization breeding work, the applicant discovered that, even with the major genes controlling grain hardness, pina and pinb, being wild-type, there was still a significant fold difference in grain hardness between Zhengmai 113 and Zhengmai 824. Based on this specificity, the inventors conducted further BSR analysis on the F2 population constructed from these two varieties, obtaining a SNP locus related to grain hardness. qHI.1B-1 This locus contains a polymorphism of either A or G at position 393305782 bp on wheat chromosome 1B. Analysis showed that wheat with the GG genotype had lower grain hardness compared to wheat with the AA genotype. Based on these results, the inventors further developed a specific KASP primer set targeting this locus, which lays a foundation for early and rapid detection and analysis of wheat hardness traits. This not only improves subsequent selection efficiency but also shortens the breeding cycle, facilitating the rapid identification and breeding of wheat varieties with ideal grain hardness, and has significant practical application value. Attached Figure Description

[0012] Figure 1 The distribution of grain hardness phenotypic data of mature grains from 430 naturally harvested wheat F2 population materials is shown in the figure. The grain hardness phenotypic data were measured by a single grain characteristic tester (SKCS-4100). Figure 2 To calculate the Δ(SNP-index) value for each variant site based on BSR-seq analysis, the distribution map of the Δ(SNP-index) on chromosome 1B was obtained, along with the QTLs related to grain hardness. qHI.1B-1 The significant marker 1B_3933 identified in this invention, as indicated by the red box, is in the relevant QTL. qHI.1B-1 Inside; Figure 3 This is the wheat genotyping result at chromosome 393305782 on chromosome 1B provided in Example 2 of the present invention; wherein, AA represents 1B_3933_AA, GG represents 1B_3933_GG, and AG represents 1B_3933_AG; Figure 4 This is a statistical chart of hardness index of different genotypes at chromosome 393305782 on chromosome 1B provided in Embodiment 2 of the present invention; in the figure: "***" indicates that the difference is significant at the p<0.01 level. Detailed Implementation

[0013] The present application will be further explained below with reference to the embodiments. Before further introducing the specific embodiments, the experimental background of some biological materials and other factors involved in the following embodiments will be briefly described as follows.

[0014] Biomaterials: Zhengmai 113 and Zhengmai 824 are common wheat varieties in the existing technology. As a professional wheat research institution, the applicant has been preserving and collecting relevant wheat germplasm materials for many years and has also built a public germplasm resource bank. The relevant materials can also be obtained through public channels. In the following examples, the wheat was planted in the applicant's experimental field (located in Xinxiang, Henan Province), and sown and managed in accordance with the recommendations of the local agricultural technology department and common planting and management methods.

[0015] Example 1 In their research on wheat grain hardness, the inventors discovered a significant difference in grain hardness between Zhengmai 113 and Zhengmai 824, but the major genes controlling grain hardness, pina and pinb, in both varieties are wild-type. To further analyze this difference, the inventors constructed an F2 population using Zhengmai 824 as the maternal parent and Zhengmai 113 as the paternal parent, attempting to further explore the genes regulating grain hardness. A brief summary of the specific experimental details is as follows.

[0016] (I) Grain hardness phenotypic determination and analysis The grain hardness phenotypic data of 430 mature wheat F2 generation single-plant grains harvested naturally in 2022 were measured using a single-grain grain phenotype analyzer (SKCS-4100). During the measurement, impurities were removed from each sample, and 300 grains were taken for hardness index determination. The average value of these 300 grain phenotypic data was then calculated (each sample was repeated twice, and the average value was taken). The distribution map of the relevant phenotypic data was obtained (statistical results are shown in the figure). Figure 1 (As shown).

[0017] (ii) Cluster separation analysis based on transcriptome sequencing (BSR-seq) The specific process is as follows: (1) Constructing a mixed pool: Based on the grain hardness index of the F2 segregating population, the 40 plants with the highest grain hardness and the 40 plants with the lowest grain hardness were selected to construct extreme mixed ponds. (2) Sample testing: RNA was extracted from the extreme mixed pool sample constructed in step (1) for transcriptome sequencing. It should be noted that before transcriptome sequencing, agarose gel electrophoresis and nanodrop detection were performed to ensure the quality and quantity of the sample RNA (the RNA concentration should be no less than 50 ng / ul and the total amount should be no less than 1000 ng to ensure the accuracy and repeatability of sequencing). (3) Library construction and quality control: mRNA was enriched using magnetic beads with Oligo(dT) and then fragmentation buffer was added to randomly break down the mRNA after enrichment. Using mRNA as a template, the first cDNA strand was synthesized using six-base random primers. Then, buffer, dNTPs, RNase H and DNA polymerase I were added to synthesize the second cDNA strand. The cDNA was purified using AMPureXPbeads. The purified double-stranded cDNA was then repaired at the ends, A-tailed, and ligated with sequencing adapters. Fragment size selection was then performed using AMPureXPbeads. cDNA libraries were obtained by PCR enrichment. The obtained cDNA library was initially quantified using Qubit 2.0, and the insert size of the library was detected using Agilent 2100. After the insert size met the expectations, the next step of the experiment was carried out. Finally, the effective concentration of the library was accurately quantified using qPCR (effective concentration of library > 2nM) to complete the library detection. (4) Sequencing: After the library passes the inspection, different libraries are pooled according to the target amount of data to be generated, and paired-end 150bp (PE150) sequencing is performed using the Illumina HiSeq platform. During sequencing, PE150, or paired-end sequencing, reads 150 bp from each end. It utilizes insert fragments from small fragment libraries for high-throughput sequencing, facilitating subsequent sequence alignment and analysis, and improving the accuracy and reliability of the data.

[0018] (III) Results Analysis Combining the grain hardness phenotypic data from step (I) and the BSR sequencing results from step (II), the contribution of important SNP sites to protein content was analyzed. Ultimately, a relevant SNP site was screened on chromosome 1B of the wheat genome. Variations at this SNP site significantly reduced grain hardness. Further referencing the existing wheat genome (IWGSC V2.1), a significant site affecting wheat grain hardness (1B: 393305782bp) was identified (partial results are shown in...). Figure 2 ), and named the site: qHI.1B-1 Analysis showed that this locus has a polymorphism of either A or G at position 393305782 bp on wheat chromosome 1B.

[0019] Example 2 Based on the sequencing analysis results of Example 1, and to facilitate the practical application of this SNP site, a primer set for detecting this SNP site was further developed and designed based on the KASP principle. The specific design is as follows: 1B_3933_F1: 5'-GAAGGTGACCAAGTTCATGCT CTCGATCTCTGCCTCCTCCGT-3'; The sequence “GAAGGTGACCAAGTTCATGCT” is a FAM fluorescent tag sequence. 1B_3933_F2: 5' -GAAGGTCGGAGTCAACGGATT CTCGATCTCTGCCTCCTCCGC -3'; The “GAAGGTCGGAGTCAACGGATT” sequence is a HEX fluorescent tag sequence. 1B_3933_R: 5'- CCTCTCACTCTCTCTCAAAGTCTCAAG-3'; When designing, PCR amplification was performed using primer pairs 1B_3933-F1 and 1B_3933-R to amplify the A-base sequence at chromosome 393305782 on wheat molecular marker 1B. When performing PCR amplification using primer pairs 1B_3933-F2 and 1B_3933-R, the sequence with a G base at site 393305782 on chromosome 1B of wheat molecular markers is used to amplify the sequence.

[0020] Based on the primer set designed above, the genotypes of 430 wheat materials were detected. The specific experimental details are briefly described below.

[0021] (a) Extraction of genomic DNA DNA genomes were extracted from wheat grain samples using the CTAB method.

[0022] (II) PCR amplification Using the DNA prepared in step (I) as a template, PCR amplification was performed using the KASP primer set designed above; after the PCR amplification reaction was completed, fluorescence signal values ​​were collected using an ELISA reader, and data analysis was performed based on the fluorescence signals. For PCR amplification, the 5 μL amplification system was designed as follows: 2×KASP Mix, 2.5μL; Primer mixture, 0.7 μL; DNA template, 30-50 ng; Add water to a volume of 5 μL; The primer mixture, in 100 μL, comprises: 12 μL of 10 μM forward primer 1; 12 μL of 10 μM forward primer 2; 12 μL of 10 μM reverse primer 30 μL, with the remainder being water; The PCR amplification program (using an Eppendorf 384 PCR instrument) was as follows: 94℃, 15 min; 94℃, 20 s, 65℃, 60 s, 10 cycles, with the annealing temperature decreasing by 0.8℃ per cycle; 95℃, 20 s, 57℃, 60 s, 30 cycles; 25℃, 10 min. Based on the grain hardness tests of 430 wheat samples, an association analysis was performed to examine the relationship between genotype and grain hardness phenotype (see Appendix 1 for specific genotypes and wheat grain hardness test results). The statistical results are shown in Table 1 below. Figure 3 , Figure 4 As shown.

[0023] Table 1. Effects of different genotypes of KASP molecular marker 1B_3933 on grain hardness in the F2 population of soft wheat. Note: a and b indicate that the difference is significant at the P<0.05 level.

[0024] The results in the table above show that wheat grains of the GG genotype (polymorphic site G) have softer grain hardness than wheat grains of the AA genotype (polymorphic site A) (i.e., wheat grains of the AA genotype are harder). In other words, marker 1B_3933 (i.e., the site...) qHI.1B-1 The marker and its corresponding KASP primer set can effectively distinguish wheat grain hardness. Based on this marker and the corresponding KASP primer set, a good technical foundation can be laid for the breeding of new wheat varieties with different hardness and to accelerate the breeding cycle of new wheat varieties.

[0025] Appendix Table 1: Hardness index and KASP molecular marker 1B_3933 typing results of 430 soft wheat materials

Claims

1. A SNP molecular marker on wheat chromosome 1B associated with wheat grain hardness, characterized in that, The SNP molecules are divided into two types: soft wheat GG genotype and hard wheat AA genotype. The SNP sequence corresponding to the GG genotype is shown in SEQ ID No. 1, specifically: TCCTTCTCTCCTCTCACTCTCTCAAAGTCTCAAGTCTCAACCGCTGCCGCGAGCCCGTGTGAGAGATGGGGAGACGCCGAGCCGGCGGCGGGGGGCGCGGAGGAGGCAGAGATCGAGGCCGAGGAGGAGAAGGACGGGGTGGAGGAGAGGAGGAGGATCTGCAGCTGCACAAGGCCGCGAGGTCGGGTGATGCGGCG; The SNP sequence corresponding to the AA genotype is shown in SEQ ID No. 2, specifically: TCCTTCTCTCCTCTCACTCTCTCAAAGTCTCAAGTCTCAACCGCTGCCGCGAGCCCGTGTGAGAGATGGGGAGACGCCGAGCCGGCGGCGGGGGGCACGGAGGAGGCAGATCGAGGCCGAGGAGGAGAAGGACGGGGTGGAGGAGAGGAGGAGGATCTGCAGCTGCACAAGGCCGCGAGGTCGGGTGATGCGGCG.

2. The application of the SNP molecular marker described in claim 1 in wheat variety breeding, characterized in that, Used for identifying wheat grain hardness in wheat molecular breeding.

3. The KASP primer set for SNP molecular marker detection described in claim 1, characterized in that, The KASP primer set is a set of primers for PCR amplification, and its specific design is as follows: 1B_3933_F1: 5'-GAAGGTGACCAAGTTCATGCT CTCGATCTCTGCCTCCTCCGT-3'; The sequence "GAAGGTGACCAAGTTCATGCT" is a FAM fluorescent tag sequence. 1B_3933_F2: 5' -GAAGGTCGGAGTCAACGGATT CTCGATCTCTGCCTCCTCCGC -3'; The "GAAGGTCGGAGTCAACGGATT" sequence is a HEX fluorescent tag sequence. 1B_3933_R: 5'-CCTCTCACTCTCTCTCAAAGTCTCAAG-3'.

4. A reagent or kit for detecting wheat grain hardness prepared using the KASP primer set described in claim 3.

5. The application of the KASP primer set described in claim 5 in wheat variety breeding, characterized in that, Used for identifying wheat grain hardness in wheat molecular breeding.

6. A method for detecting wheat grain hardness using the KASP primer set described in claim 3, characterized in that, Includes the following steps: (a) Preparation of DNA template DNA was extracted from the wheat samples to be tested and used as a template for PCR amplification. (II) PCR amplification Using the DNA prepared in step (I) as a template, PCR amplification was performed using the KASP primer set; (III) Result Determination The PCR amplification products of step (II) are subjected to fluorescence signal acquisition and analysis, or electrophoresis detection and analysis or sequencing analysis, and the grain hardness of the wheat sample to be tested is determined based on the analysis results. The criterion is that wheat with genotype GG has lower grain hardness compared to wheat with genotype AA.

7. The method for detecting wheat grain hardness as described in claim 6, characterized in that, In step (ii), the PCR amplification system is designed as follows: 5 μL amplification system: 2×KASP Mix, 2.5μL; Primer mixture, 0.7 μL; DNA template, 30-50 ng; Add water to a volume of 5 μL; The primer mixture, per 100 μL, comprises: 10 μM 1B_3933_F1, 12 μL; 10 μM 1B_3933_F2, 12 μL; 10 μM 1B_3933_R, 30 μL; with the remainder being water. The PCR amplification program was as follows: 94℃, 15 min; 94℃, 20 s, 65℃, 60 s, 10 cycles, with the annealing temperature decreasing by 0.8℃ per cycle; 95℃, 20 s, 57℃, 60 s, 30 cycles; 25℃, 10 min.