SNP (Single Nucleotide Polymorphism) molecular marker related to grass carp feed utilization rate and application of SNP molecular marker
By screening for SNP markers at the 51653399 locus on chromosome 2 of grass carp through genome-wide association analysis, primers were designed for PCR amplification, and individuals with the GG genotype were selected for breeding. This approach solved the problems of long breeding cycles and low breeding efficiency in grass carp, achieving high-efficiency breeding and high feed utilization.
Patent Information
- Application Number
- CN202610386570.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-27
- Publication Date
- 2026-05-01
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Grass carp have a long breeding cycle and low breeding efficiency, making it difficult to effectively improve feed utilization and affecting aquaculture benefits.
SNP markers at chromosome 51653399 of grass carp were screened through genome-wide association analysis. Primers were designed for PCR amplification, and individuals with the GG genotype were selected for breeding to improve feed utilization.
It significantly shortens breeding time, improves breeding efficiency, reduces breeding costs, and enhances grass carp production performance and aquaculture profits.
Smart Images
Figure CN121951079A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular markers for aquatic animals and aquatic genetic breeding technology, and to SNP molecular markers related to feed utilization of grass carp “Husu No. 1” and their applications. Background Technology
[0002] Grass carp (Ctenopharyngodon idella) is a dominant economic fish species in freshwater aquaculture in my country, and genetic improvement of its growth traits is of great significance for enhancing aquaculture efficiency. However, the long sexual maturity cycle of grass carp (4 to 5 years) results in an extremely long breeding cycle and low breeding efficiency, severely restricting the development of the grass carp breeding industry. With the advancement of molecular biology, molecular marker-assisted selection has begun to be carried out and is gradually maturing in breeding work. Compared with traditional breeding techniques, molecular marker-assisted selection is less affected by environmental factors, has a shorter generation interval, and higher breeding accuracy, greatly accelerating the breeding process and improving breeding efficiency. Building on this foundation, thanks to the rapid development of high-throughput sequencing technology and the completion of resequencing of aquatic animal-related genes, a genome-wide association study (GWAS) method, which uses single nucleotide polymorphism (SNP) as a molecular marker to screen for SNPs related to target phenotypic variation across the entire genome, has been increasingly applied to aquatic animal genetic breeding work and has yielded a series of significant results.
[0003] As one of the important growth traits of grass carp, feed conversion ratio (FCR) reflects the efficiency with which grass carp utilize nutrients in feed to maintain metabolism, promote muscle growth, and fat deposition. It directly relates to feed costs in aquaculture and is crucial to the profitability of farming enterprises. Improving feed efficiency in grass carp is of great significance to the overall progress of the aquaculture industry. Therefore, screening for SNP loci related to feed conversion ratio is beneficial for providing a theoretical basis and reference for subsequent grass carp breeding work.
[0004] Therefore, providing a SNP molecular marker related to grass carp feed utilization and its application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0005] This invention aims to provide a SNP molecular marker related to feed utilization of grass carp and its application. This invention collects DNA from 78 grass carp "Husu No. 1" for genotyping and uses GWAS method to further screen out SNP sites that are significantly related to the feed utilization trait of grass carp, successfully providing a new molecular marker for the selection of feed utilization trait of grass carp "Husu No. 1".
[0006] The specific technical solution of the present invention is as follows:
[0007] Firstly, this invention provides a SNP molecular marker related to feed utilization efficiency in grass carp. This invention measures and records the feed utilization efficiency of 78 grass carp individuals of the "Hu-Su No. 1" variety. After sequencing the collected DNA and performing genotypic quality control, GWAS analysis was performed on the remaining 6,660,311 markers and the 78 individuals to screen for SNP loci significantly associated with grass carp feed utilization efficiency. Based on the grass carp reference genome, one significant SNP locus was finally identified. This locus is located at position 51,653,399 on chromosome 2 of the grass carp (Chr02: 51653399), with a polymorphic base of G / T.
[0008] Furthermore, the nucleotide sequence containing the SNP marker is shown in SEQ ID NO: 3, where the SNP marker is located at position 201 of the sequence.
[0009] Secondly, the present invention provides primers for detecting the aforementioned SNP molecular markers, the primer sequences of which are as follows:
[0010] Forward primer: 5'-CCCAAGAATTACTCAGTTACTC-3' (SEQ ID NO: 1);
[0011] Reverse primer: 5'-CCCACAGCCATCCATCATAA-3 (SEQ ID NO: 2).
[0012] Thirdly, the present invention provides a kit comprising primers with sequences as shown in SEQ ID NO: 1-2.
[0013] Fourthly, this invention provides the application of the aforementioned SNP molecular markers, primers, or kits in the breeding of grass carp with high feed utilization rates.
[0014] Furthermore, individuals with the genotype GG at the Chr02:51653399 locus were selected for breeding, as strains with the genotype GG have high feed utilization rates.
[0015] Furthermore, the grass carp in question is of the variety "Hu-Su No. 1".
[0016] Fourthly, this invention provides the application of the aforementioned SNP molecular markers, primers, or kits in the genetic breeding of grass carp.
[0017] Fifthly, the present invention provides a method for improving grass carp varieties. The method involves detecting the SNP molecular markers on chromosome 2 of grass carp and selecting individuals with the genotype GG for breeding (this genotype of grass carp has a high feed utilization rate), thereby reducing the feed consumption of offspring grass carp during the production process.
[0018] Furthermore, the method for improving grass carp varieties includes the following steps:
[0019] Step 1: Extract DNA from the fin rays of the grass carp to be tested;
[0020] Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using primers with sequences as shown in SEQ ID NO: 1-2;
[0021] Step 3: Sequencing the amplification products obtained in Step 2 to determine the genotype of the SNP molecular marker Chr02:51653399 locus in the grass carp individuals to be tested. Individuals with the genotype GG are selected for breeding to obtain grass carp strains with higher feed utilization.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] This invention provides a SNP molecular marker associated with feed utilization rate in grass carp 'Hu Su No. 1' and its application. DNA from 78 'Hu Su No. 1' grass carp was sequenced and genotype-controlled. Genome-wide association analysis then identified a SNP locus significantly associated with feed utilization rate in grass carp, located at nucleotide 51653399 on chromosome 2. When the genotype at this locus is GG, the grass carp exhibits higher feed utilization.
[0024] The SNP molecular markers of this invention can be used for early selection and breeding of grass carp with high feed utilization, which greatly reduces the breeding workload, significantly shortens the breeding time, accelerates the breeding process, improves breeding efficiency, and reduces breeding costs. It has important guiding significance for improving the production performance of grass carp, reducing the breeding cost of grass carp and increasing breeding income, and is suitable for widespread application. Attached Figure Description
[0025] Figure 1 The distribution of feed utilization phenotypes in the grass carp "Husu No. 1" experimental population is shown on the x-axis; the x-axis represents the phenotypic values of the experimental population.
[0026] Figure 2 This is a Manhattan plot for genome-wide association analysis of the feed utilization trait. In this invention, a single SNP located at Chr02:51653399 with a relatively small p-value above the threshold was selected for further analysis.
[0027] Figure 3 Q-Q plot of genome-wide association analysis for feed utilization traits.
[0028] Figure 4 The graph shows the statistical results of feed utilization rate (FCR) of grass carp carrying different genotypes of SNP Chr02: 51653399 G>T. 4A represents the results of whole-genome high-throughput sequencing screening in Example 1, and 4B represents the results of first-generation sequencing verification in Example 2. The vertical axis represents the phenotypic value of FCR, and the horizontal axis represents the three genotypes GG, GT, and TT. Detailed Implementation
[0029] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.
[0030] Example 1: Screening of SNP molecular markers associated with grass carp feed utilization traits
[0031] 1. Sample Collection
[0032] The grass carp used in this study were collected from the Wujiang National Four Families Carp Farm in Jiangsu Province, China. Seventy-eight healthy individuals of the "Hu-Su No. 1" grass carp were selected. At the beginning and end of the experiment, the fish were starved for 24 hours before being weighed. Feed intake was recorded and feed utilization was calculated using the following formula:
[0033] Feed utilization rate (%) = Weight of feed ingested / (Fish body weight at the end of the experiment - Fish body weight at the beginning of the experiment) × 100%. Figure 1 The distribution of feed utilization phenotypes in the grass carp "Husu No. 1" experimental population is shown.
[0034] Simultaneously, tail fin tissue was collected from the experimental fish for genomic DNA extraction.
[0035] 2. Extraction of genomic DNA
[0036] DNA was extracted from the samples using a magnetic bead method. The concentration of DNA samples was detected using a Qubit real-time fluorescence analyzer; the integrity of the DNA samples was detected by 1% agarose gel electrophoresis.
[0037] 3. SNP quality control and population structure analysis
[0038] The raw high-throughput sequencing data were processed using quality control and filtering. Thresholds were set using PLINK software, including a deletion rate > 0.1, minor allele frequency (MAF) < 0.05, recall rate < 0.1, and Hardy-Weinberg precision (HWE) < 1e-6, to remove low-quality SNPs from the raw data. Ultimately, 6,660,311 high-quality SNP loci were obtained for subsequent analysis.
[0039] Before starting the genome-wide association analysis, to avoid the influence of population structure, principal component analysis (PCA) was performed on the quality-controlled data using PLINK software, and the data was visualized using the R package ggplot2. The phylogenetic tree was constructed using raxml-ng software and visualized using the website (https: / / itol.embl.de).
[0040] 4. Genome-wide association analysis of feed utilization trait
[0041] Genome-wide association analysis (GWA) was performed using rMVP software based on the General Linear Model (GLM) method for the feed utilization trait of 78 individuals, taking into full account population structure and inter-individual phylogenetic relationships. The statistical model is as follows:
[0042] y = Xα + Zβ + e
[0043] In the formula, y represents the phenotypic trait; Xα is the population structure, which is a fixed effect; Zβ is the marking effect; and e is the residual.
[0044] Bonferroni correction (Bonferroni 1936) was used to determine the significance threshold for the whole genome. The calculation formula was p = 0.05 / N, where N represents the total markers used for association analysis. QQ plots and Manhattan plots were drawn using the CMplot package in R. Phenotypic variance interpretation (PVE) and F-values were calculated using rMVP software.
[0045] 5. Results Analysis
[0046] After PLINK quality control washing, 6,660,311 SNP loci were obtained from 78 grass carp individuals for further GWAS analysis. The Bonferroni-corrected threshold for genome-wide significant SNP markers was set at P = 0.05 / 6660311 = 7.51 × 10⁻⁶. -9 The GWAS results for grass carp feed utilization traits are as follows: Figure 2As shown: A single SNP locus, Chr02:51653399 G>T, was detected on chromosome 2, which was most strongly associated with the grass carp feed utilization trait (P< 0.001). Figure 3 The QQ graph shows that the GWAS analysis performed was of good quality.
[0047] In this example, 78 grass carp carrying SNP Chr02: 51653399 G>T had feed utilization rates of individuals with different genotypes as follows: Figure 4 As shown in Figure A, there were significant differences in the average feed utilization of grass carp among the three genotypes at the SNP Chr02:51653399 G>T locus. Among them, the average feed utilization of grass carp carrying the GG genotype was significantly higher than that of individuals carrying the GT and TT genotypes.
[0048] Example 2: Validation of SNP molecular markers related to feed utilization trait in grass carp
[0049] The validation experiment used different grass carp populations, randomly selecting 50 experimental fish. Feed utilization traits of each fish were measured and recorded, and caudal fin samples were collected and preserved from each fish for DNA extraction. The specific DNA extraction procedure was the same as in Example 1. Subsequently, using the extracted DNA as a template, PCR amplification was performed using SEQ ID NO:1 and SEQ ID NO:2 as primers to obtain a gene fragment containing SNP Chr02:51653399 G>T (i.e., a molecular marker sequence, such as SEQ ID NO:3). Among them:
[0050] The sequences of the upstream and downstream primer pairs for SNP Chr02:51653399 are as follows:
[0051] Forward primer: 5'-CCCAAGAATTACTCAGTTACTC-3' (SEQ ID NO: 1);
[0052] Reverse primer: 5'-CCCACAGCCATCCATCATAA-3' (SEQ ID NO: 2);
[0053] The molecular marker sequence is shown in SEQ ID NO:3. SNP Chr02:51653399 G>T is located at position 201 of the gene fragment SEQ ID NO:3, and the mutation type is G / T.
[0054] SEQ ID NO:3 (where the underlined single base in the middle indicates the mutation site, and the underlines on both sides indicate the positions of the upstream and downstream primers):
[0055] ATGTTTGAAGTAAAGCGACATATTAGAGAAAATCCTATGTGTCTGTATATTGGATCAGTGCATTAGTTCTTAAAGAATTGGTTCCATTTAAAATGAAAATTA CCCCAAGAATTACTCAGTTACT CAACGTCAGTTACGCTTTTTCCGTAATGCTGAATACAGAAGATGTAGAACGTAGCGAAGTGTTTTCAACTGCGAGA G GCGTTAAACTTCCTTCATAAGTTGAATACTTAAGGTGGTCTGGCAGAAGCTAGATATTTTACTTCATAACTTGTTAAATATGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACACAAACGCATAGTTTCGCTTCAGAAGGCCTTTATTATGTGGAGTATGT TTATGATGGATG GCTGTGG ATGGAAGAACTTTCTTC
[0056] The PCR amplification reaction system, in 20 μl increments, consisted of: 1 μl of 100 ng / μl template DNA, 0.5 μl each of 10 pmol / μl forward and reverse primers, 10 μl of Taq Mix, and the remainder being double-distilled water. The reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ or 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30-35 cycles; and incubation at 72℃ for 7 min.
[0057] The amplified products were sequenced to obtain the genotype of each individual, and the feed utilization data of individuals with different genotypes were statistically analyzed. Figure 4 B presents the results of experimental verification of SNP Chr02:51653399. Figure 4 B indicates that there are significant differences in feed utilization among individuals with different genotypes of grass carp SNP Chr02: 51653399; among them, individuals carrying the GG genotype have a higher feed utilization rate than individuals carrying the GT and TT genotypes. (Compared to Example 1) Figure 4 Result A is consistent.
[0058] In summary, this invention successfully screened a SNP marker (SNPChr02: 51653399) that is significantly associated with the feed utilization rate trait of grass carp. Its genotype can be determined by a pair of primers, which is simple and reliable. This SNP site has promising applications in molecular marker-assisted breeding and genome selection breeding of grass carp.
[0059] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A SNP molecular marker associated with grass carp feed utilization rate, characterized in that, The SNP molecular marker is located at position 51653399 on chromosome 2 of grass carp, and the polymorphic base is G / T.
2. The SNP molecular marker related to grass carp feed utilization as described in claim 1, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.3; the SNP molecular marker is located at position 201 of the nucleotide sequence shown in SEQ ID NO.
3.
3. A primer for detecting the SNP molecular marker of claim 1 or 2, characterized in that, The primer sequences are as follows: Forward primer: 5'-CCCAAGAATTACTCAGTTACTC-3'; Reverse primer: 5'-CCCACAGCCATCCATCATAA-3'.
4. A reagent kit, characterized in that, Includes the primers described in claim 3.
5. The application of the SNP molecular marker of claim 1 or 2, the primer of claim 3, or the kit of claim 4 in the breeding of grass carp with high feed utilization.
6. The application according to claim 5, characterized in that, Individuals with the genotype GG at the SNP molecular marker Chr02:51653399 locus were selected for breeding, as strains with the genotype GG have high feed utilization rates.
7. The application according to claim 5, characterized in that, The grass carp in question is of the variety "Hu-Su No. 1".
8. The application of the SNP molecular marker of claim 1 or 2, the primer of claim 3, or the kit of claim 4 in the genetic breeding of grass carp.
9. A method for improving grass carp varieties, characterized in that, The method involves detecting the SNP molecular markers as described in claim 1 or 2 on chromosome 2 of grass carp, and selecting individuals with the genotype GG for breeding.
10. The method for improving grass carp varieties according to claim 9, characterized in that, Includes the following steps: Step 1: Extract DNA from the fin rays of the grass carp to be tested; Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using the primers described in claim 3; Step 3: Sequencing the amplification products obtained in Step 2 to determine the genotype of the SNP molecular marker Chr02:51653399 locus in the grass carp individuals to be tested. Individuals with the genotype GG are selected for breeding to obtain grass carp strains with higher feed utilization.