Methods for improving genome engineering efficiency

Abstract

The present invention relates to methods and materials for genome engineering in eukaryotic cells, and in particular to methods for improving the efficiency of genome engineering (ie, transformation or genome editing) via delivery of one or more RKD2 and RKD4 genes and genome engineering components.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 798,010, filed on January 29, 2019, which is incorporated herein by reference in its entirety. Technical Field

[0003] Described herein are novel methods and materials for genome engineering in eukaryotic cells, particularly methods for improving the efficiency of genome engineering (ie, transformation or genome editing) by delivering nucleic acids encoding RKD2 and / or RKD4 and genome engineering components.

[0004] Sequence Listing

[0005] This application contains a sequence table in ASCII format submitted electronically and is incorporated herein by reference in its entirety. The ASCII copy was created on November 25, 2018, named KWS0304_SEQLIST_20181123_ST25.txt, and is 73,166 bytes in size. Background Art

[0006] Traditional breeding has provided domesticated plants and animals, while modern biotechnology, especially genome engineering, is expanding breeding capabilities and enabling improvements that would not be possible simply by crossing closely related species. The use of biotechnology has introduced a variety of traits in crops, such as high yield, herbicide tolerance, and pest resistance, resulting in tremendous advances in global agriculture and food security. However, the presence of foreign DNA in such biotechnology products can raise biosafety and environmental concerns.

[0007] By isolating any integrated DNA, genome editing techniques can be used to generate site-specific modifications of target genomes in the absence of exogenous DNA in terminal plants. In addition, through transient expression, genome editing can have transient editing activity to create site-specific modifications without the need for DNA integration at any time in the process. Genome-edited plants, particularly plants derived from transient activity, are very different from traditional genome-modified plants and may not be used as genetically modified (GM) plant regulation. Therefore, genome editing techniques, particularly via transient editing methods, can provide high-precision, safe and powerful plant breeding and development tools for agriculture.

[0008] However, genome engineering based on transient activity faces additional challenges. Compared with stable transformation, transient engineering generally results in fewer modified cells. In the absence of integrated selectable markers, it is extremely challenging to identify engineered cells and achieve homologous modifications in regenerated plants. These challenges hinder the routine implementation of transient gene editing as a breeding tool for plant improvement. Therefore, novel methods and materials to improve the efficiency of genome engineering are urgently needed. Summary of the invention

[0009] In one aspect, a method for genetic modification in a plant cell is provided, the method comprising

[0010] (a) introducing into the plant cell

[0011] (i) a nucleic acid comprising a polynucleotide sequence encoding an RKD2 polypeptide or an RKD4 polypeptide, a recombinant gene comprising said nucleic acid, or a DNA construct comprising said nucleic acid; and

[0012] (ii) transgenic and / or genome engineered components of interest;

[0013] (b) optionally, culturing the plant cell under conditions that allow synthesis of the RKD2 polypeptide or the RKD4 polypeptide from the nucleic acid after chemical induction; and

[0014] (c) optionally, culturing the plant cell under conditions that allow genetic modification of the genome of the plant cell by integration of a transgene of interest and activity of a genome engineering component in the presence of the RKD2 polypeptide or the RKD4 polypeptide;

[0015] The polynucleotide sequence encoding the RKD2 polypeptide or the RKD4 polypeptide is operably linked to a heterologous promoter, and the heterologous promoter is directly chemically inducible or indirectly chemically inducible, preferably indirectly chemically inducible via an intermediate transcription factor.

[0016] In some embodiments, the method is effective to improve the efficiency of plant regeneration. In some embodiments, the method is effective to improve the regeneration capacity of plant cells. In some embodiments, in step (b), the RKD2 polypeptide or RKD4 polypeptide is synthesized from the nucleic acid after direct or indirect chemical induction of a heterologous promoter, preferably after addition of β-estradiol or a glucocorticoid such as dexamethasone to the plant cells.

[0017] In some embodiments, the heterologous promoter is an XVE / OLexA system for chemical inducibility with chemical β-estradiol. In various embodiments, the XVE / OLexA system comprises a nucleic acid sequence of SEQ ID NO: 22, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 22.

[0018] In some embodiments, the heterologous promoter is an inducible bidirectional promoter. In a plurality of embodiments, the inducible bidirectional promoter is operably connected to a second nucleic acid sequence encoding a desired polypeptide. In a plurality of embodiments, the second nucleic acid sequence comprises a reporter gene and a polynucleotide encoding a reporter protein. In certain embodiments, the reporter is GUS or tdTomato.

[0019] In various embodiments, the inducible bidirectional promoter is a dexamethasone inducible promoter. In some specific embodiments, the promoter is pOp1, pOp2, pOp4 or pOp6. In some specific embodiments, pOp6 comprises the nucleic acid sequence of SEQ ID NO: 15, or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 15.

[0020] In some embodiments, in step (a)(i), another nucleic acid comprising a polynucleotide sequence encoding a transcription factor operably linked to a strong constitutive promoter is introduced into the plant cell, wherein the transcription factor activates pOp6 upon binding to dexamethasone. In a specific embodiment, the transcription factor is LhGR or LhG4. In some embodiments, the LhGR has the amino acid sequence of SEQ ID NO:17, or an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:17; or wherein the nucleic acid encoding the LhGR comprises the coding sequence of SEQ ID NO:16, or a coding sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:16.

[0021] In some embodiments, the strong constitutive promoter is a ubiquitin promoter or a double 35S promoter. In some specific embodiments, the double 35S promoter comprises the nucleotide sequence of SEQ ID NO: 21, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 21. In some specific embodiments, the ubiquitin promoter comprises the nucleotide sequence of SEQ ID NO: 23, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 23. In some specific embodiments, the ubiquitin promoter additionally comprises a ubiquitin intron, which comprises the nucleotide sequence of SEQ ID NO:20, or a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:20.

[0022] In some embodiments, plant cells are cultured under conditions that allow the genome of the plant cells to be genetically modified by integrating a transgene of interest and the activity of a genome engineering component in the presence of a RKD2 polypeptide or a RKD4 polypeptide; in some specific embodiments, the cultured plant cells do not express a reporter gene in the absence of a chemical agent effective to induce a chemically inducible promoter. In some embodiments, the plant cells are cultured to produce embryonic structures. In some embodiments, the embryonic structures are cultured to produce regenerated plants.

[0023] In various embodiments, the RKD2 polypeptide or the RKD4 polypeptide is transiently present, transiently active and / or transiently expressed in a plant cell, and / or a nucleic acid encoding a RKD2 polypeptide is transiently present, transiently active and / or transiently expressed in a plant cell, or a nucleic acid encoding a RKD4 polypeptide is transiently present, transiently active and / or transiently expressed in a plant cell.

[0024] In various embodiments, the RKD2 polypeptide comprises an amino acid sequence of SEQ ID NO:5, or an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:5; or the nucleic acid encoding the RKD2 polypeptide encodes an amino acid sequence of SEQ ID NO:5, or an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:5.

[0025] In various embodiments, the RKD4 polypeptide comprises the amino acid sequence of SEQ ID NO:2, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:2; or the nucleic acid encoding the RKD4 polypeptide encodes the amino acid sequence of SEQ ID NO:2, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:2. NO:2 has an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.

[0026] In some embodiments, the nucleic acid encoding the RKD2 polypeptide comprises a nucleic acid having a coding sequence selected from the group consisting of:

[0027] a) a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 3 or 4;

[0028] b) a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 3 or 4;

[0029] c) and a nucleic acid that hybridizes under stringent hybridization conditions to the complementary strand of a nucleic acid as defined in a) or b).

[0030] In some embodiments, the nucleic acid encoding the RKD4 polypeptide comprises a nucleic acid having a coding sequence selected from the group consisting of:

[0031] a) a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1;

[0032] b) a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1; and

[0033] c) A nucleic acid that hybridizes to the complementary strand of the nucleic acid defined in (1) or (2) under stringent hybridization conditions.

[0034] In some embodiments, the genome engineering components comprise:

[0035] a) an enzyme that induces a double strand break (DSB) or a nucleic acid encoding the same, and optionally a repair nucleic acid molecule, wherein the DSB-inducing enzyme preferably recognizes a predetermined site in the genome of the cell;

[0036] b) an enzyme that induces a single strand break (SSB) or a nucleic acid encoding the same, and optionally a repair nucleic acid molecule, wherein the SSB-inducing enzyme preferably recognizes a predetermined site in the genome of the cell;

[0037] c) a base editing enzyme, optionally fused to a disarming DSB or SSB inducing enzyme, wherein the base editing enzyme preferably recognizes a predetermined site in the genome of the cell; or

[0038] d) an enzyme that effects DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ribosylation or histone citrullination, which is optionally fused to a disarming DSB or SSB inducing enzyme, wherein the enzyme preferably recognizes a predetermined site in the genome of the cell.

[0039] In some embodiments, the genome engineering component comprising a DSB or SSB inducing enzyme or a variant thereof is a CRISPR / Cas endonuclease, a CRISPR / Cas9 endonuclease, a CRISPR / Cpf1 endonuclease, a CRISPR / Csm1 endonuclease, a CRISPR / MAD7 endonuclease, a CRISPR / CasX endonuclease, a CRISPR / CasY endonuclease, a zinc finger nuclease (ZFN), a homing endonuclease, a meganuclease, or a TAL effector nuclease.

[0040] In some embodiments, the activity of the genome engineering component in step (c) includes inducing one or more double-strand breaks in the genome of the plant cell, one or more single-strand breaks in the genome of the plant cell, one or more base editing events in the genome of the plant cell, or one or more of DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ubiquitination, histone ribosylation or histone citrullination in the genome of the plant cell. In a specific embodiment, after inducing one or more double-strand breaks or one or more single-strand breaks, non-homologous end joining (NHEJ) and / or homology-directed repair (HDR) of the breaks is performed by a homologous recombination mechanism.

[0041] In some embodiments, the transgene in step (a)(ii) is selected from: genes encoding resistance or tolerance to abiotic stress, including drought stress, osmotic stress, heat stress, cold stress, oxidative stress, heavy metal stress, nitrogen deficiency, phosphate deficiency, salt stress or waterlogging, herbicide resistance, including resistance to glyphosate, glufosinate / phosphinothricin, hygromycin, protoporphyrinogen oxidase (PPO) inhibitors, ALS inhibitors and dicamba; genes encoding resistance or tolerance to biotic stress, including virus resistance genes, fungal resistance genes, bacterial resistance genes, insect resistance genes; or genes encoding yield-related traits, including lodging resistance, flowering time, seed shattering resistance, seed color, endosperm composition or nutritional content.

[0042] In some embodiments, in step (c), the modification of the genome is selected from

[0043] i) replacing at least one nucleotide;

[0044] ii) deleting at least one nucleotide;

[0045] iii) inserting at least one nucleotide;

[0046] iv) changes in DNA methylation;

[0047] v) changes in histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone parabiquitination, histone ribosylation or histone citrullination; and

[0048] vi) Any combination of i)-v).

[0049] In various embodiments, the method effectively promotes cell proliferation or cell regeneration, preferably after genetic modification. In various embodiments, the method effectively induces embryo formation from a single cell, preferably after genetic modification. In various embodiments, the method effectively improves the efficiency of stable transformation of transgenes into plant cells. In various embodiments, the method effectively improves the efficiency of genome engineering components editing plant cell genomes.

[0050] In another aspect, a genetically modified plant cell obtained or obtainable according to any one of the methods of the above aspects and embodiments is provided. Also provided is a plant or plant part comprising the genetically modified plant cell.

[0051] In another aspect, a plant cell is provided, comprising

[0052] a) a polynucleotide encoding a RKD2 polypeptide; or a polynucleotide encoding a RKD4 polypeptide; and

[0053] b) transgenic and / or genome engineered components of interest;

[0054] The polynucleotide encoding the RKD2 polypeptide or the RKD4 polypeptide is operably linked to a heterologous promoter, and the heterologous promoter is directly chemically inducible or indirectly chemically inducible, preferably indirectly chemically inducible via an intermediate transcription factor.

[0055] In another aspect, a plant cell comprising a DNA construct is provided, wherein the DNA construct comprises

[0056] a) A nucleic acid comprising a polynucleotide encoding a RKD2 or RKD4 polypeptide, said polynucleotide being operably linked to a chemically inducible bidirectional promoter.

[0057] b) a reporter gene operably linked to the bidirectional promoter, and

[0058] c) a third recombinant gene encoding a transcription factor operably linked to a strong constitutive promoter.

[0059] In another aspect, a method for producing a genetically modified plant is provided, comprising the steps of:

[0060] (a) genetically modifying a plant cell according to any one of the above methods, and

[0061] (b) regenerating a plant from the modified plant cell of step (a).

[0062] In some embodiments, the produced plant does not contain any of the genome engineering components stably integrated into the plant genome. Also provided is a genetically modified plant or part thereof obtained or obtainable by the method.

[0063] On the other hand, provided is a nucleic acid comprising a polynucleotide encoding an RKD2 polypeptide or an RKD4 polypeptide, a recombinant gene comprising the nucleic acid, or a DNA construct comprising the nucleic acid for improving the efficiency of plant regeneration or increasing the regeneration capacity of plant cells after chemical induction, wherein the polynucleotide encoding the RKD2 polypeptide or the RKD4 polypeptide is operably linked to a heterologous promoter, and the heterologous promoter is directly chemically inducible or indirectly chemically inducible, preferably indirectly chemically inducible via an intermediate transcription factor. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Shown is a map of the gene expression vector pZY ZZ-TOP, which carries the pOp6 / LHGR system for GUS expression and developmental genes of interest. The plasmid contains the pOp6 chemically inducible promoter. Upon exposure to dexamethasone, both the developmental genes and the GUS reporter gene are expressed. pZY ZZ-TOP also contains the gene LhGR operably linked to the ubiquitin promoter. In the presence of dexamethasone, LhGR enters the nucleus and activates pOp6.

[0065] Figure 2 is a graph showing a comparison of regeneration efficiency mediated by various developmental genes under the control of a chemically inducible promoter system after induction. Plants were transformed with the pZY-ZZ-TOP plasmid into which different developmental genes (i.e., LEC2, WUS, BBM, AGL15, and RKD4) were inserted. Some plants were treated with dexamethasone to induce expression of developmental genes (as indicated by the "+" on the X-axis), while other plants were not treated in this way ("-"). The regeneration efficiency on the Y-axis refers to the frequency of somatic embryo formation.

[0066] Figure 3 Shown is somatic embryo formation induced in Arabidopsis thaliana plants expressing RKD4 in the pOp6 / LhGR transactivation system described above. Formation of somatic embryos was observed in roots (left panel), leaves (middle panel), or both roots and leaves (right panel).

[0067] Figure 4AtRKD4-mediated regeneration of Phalaenopsis amabilis plants after induction of AtRKD4 expression at the leaf base with dexamethasone is shown. The presence of somatic embryos (arrows) was confirmed at day 0 (left), 7 (middle), and 14 (right) after removal of dexamethasone from the culture medium.

[0068] Figure 5 Estradiol-induced expression of TaRKD2 in common wheat (Triticum aestivum) plants is shown. Induction and development of embryonic structures were observed: callus formation (left panel, arrows), chlorosis (middle panel) and leaf emergence (right panel, arrows).

[0069] Figure 6 Estradiol-induced expression of TaRKD2 in barley (Hordeum vulgare) plants is shown. Induction and development of embryonic structures were observed: callus formation (upper left panel), shoot and root development (upper right panel, arrows), chlorosis (lower left panel) and seedling formation (lower right panel).

[0070] Figure 7 Dexamethasone-induced expression of AtRKD4 and TaRKD2 in corn (Zea mays) is shown. Dexamethasone-inducible constructs were co-bombarded with the red fluorescent tdTomato gene in the presence of a constitutive promoter (see Example 1). After exposure to dexamethasone, the induction of a large number of callus structures with stably integrated tdTomato was observed 33 days after bombardment for AtRKD4 (left panel) and TaRKD2 (right panel).

[0071] Figure 8 Shown is a plasmid map of pERV1-hygro carrying the XVE / OLexA system for β-estradiol chemical inducibility of expression of developmental genes of interest (Borghi, L. (2010). Inducible gene expression systems for plants. In Plant Developmental Biology (pp. 65-75). Humana Press, Totowa, NJ.). DETAILED DESCRIPTION

[0072] definition

[0073] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0074] The term "about" used in the context of this application refers to + / -10% of the stated value, preferably + / -5% of the stated value. For example, about 100 nucleotides (nt) should be understood as a value of 90-110 nt, preferably a value of 95-105 nt.

[0075] Regeneration of transformed or gene-edited plant cells may include a somatic embryogenesis process, which is an artificial process of deriving plants or embryos from a single somatic cell or a group of somatic cells. Somatic embryos are formed from plant cells that are not normally involved in embryonic development, i.e., plant tissues such as buds, leaves, and branches. Applications of this process may include: clonal propagation of genetically identical plant materials; elimination of viruses; providing source tissues for genetic transformation; generating whole plants from single cells such as protoplasts; and the development of synthetic seed technology. Cells derived from competent source tissues can be cultured to form callus. Plant growth regulators such as auxins or cytokinins in tissue culture media can be manipulated to induce callus formation and subsequently altered to induce callus to form embryos. Somatic embryos are described as occurring in two ways: directly or indirectly. Direct embryogenesis occurs when embryos produce identical clones starting from explant tissue. Indirect embryogenesis occurs when an explant produces undifferentiated or partially differentiated cells (i.e., callus) that then maintain or differentiate into plant tissues such as leaves, stems, or roots.

[0076] The term "transgenic" used according to the present invention refers to a plant, plant cell, tissue, organ or material comprising a gene or a gene construct, wherein the gene or gene construct comprises a "transgene" transferred into the plant, plant cell, tissue, organ or material by natural means or by a transformation technique from another organism. The term "transgenic" includes nucleic acid sequences, including DNA or RNA, or amino acid sequences, or a combination or mixture thereof. Therefore, the term "transgenic" is not limited to sequences that are usually identified as "genes", i.e., sequences that encode proteins. It can also refer to, for example, non-protein encoding DNA or RNA sequences. Therefore, the term "transgenic" generally means that the corresponding nucleic acid or amino acid sequence does not naturally exist in the corresponding target cell, and the corresponding target cell includes plants, plant cells, tissues, organs or materials. Therefore, the term "transgenic" or "transgenic" used herein refers to a nucleic acid sequence or amino acid sequence extracted from the genome of an organism or synthetically produced and then introduced into another organism in a transient or stable manner by artificial techniques such as molecular biology and genetics. "Plant material" used herein refers to any material that can be obtained from a plant at any stage of development. The plant material can be obtained by culturing the plant or its tissue or organ in situ (in planta) or in vitro. Thus, the term includes plant cells, tissues and organs and developed plant structures, as well as subcellular components, such as nucleic acids, polypeptides and all chemical plant substances or metabolites, which can be found in plant cells or compartments and / or can be produced by plants, or can be obtained from extracts of any plant cell, tissue or plant at any stage of development. The term also includes derivatives of plant material, such as protoplasts, which are derived from at least one plant cell contained in the plant material. Thus, the term also includes meristem cells or meristems of plants.

[0077] The term "genome engineering" as used herein refers to the strategy and technology of genetic modification of any genetic information or genome of plant cells, including genome transformation, genome editing, etc. Similarly, "genome editing" refers to the technology of targeted specific modification of any genetic information or genome of plant cells. Therefore, "genome engineering" and "genome editing" include the editing of gene coding regions, and the editing of regions outside the gene coding regions of genomes. These also include the editing or engineering of the nucleus (if present) and other genetic information of plant cells. In addition, "genome engineering" also includes epigenetic editing or engineering, i.e. targeted modification, such as methylation, histone modification or non-coding RNA that may cause heritable changes in gene expression.

[0078] The term "genome editing" as used herein refers to strategies and techniques for targeted specific modification of any genetic information or genome of plant cells, including editing of regions outside the gene coding region of the genome (such as intron sequences, non-coding RNA, miRNA, sequences of regulatory elements such as promoters, terminators, transcription activator binding sites, cis or trans-acting elements, etc.). In addition, "genome editing" may include base editing for targeted replacement of single nuclear bases. It may also include editing the nuclear genome and other genetic information of plant cells, i.e., mitochondrial genome or chloroplast genome and miRNA, pre-mRNA or mRNA. In addition, "genome editing" may include epigenetic editing or engineering that may cause heritable changes in gene expression, i.e., targeted modification, such as DNA methylation or histone modification, such as histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone sumoylation, histone ribosylation or histone citrullination. "Genome editing" may also include epigenetic editing or engineering of non-coding RNA that may cause heritable changes in gene expression.

[0079] As used herein, "base editor" refers to a protein or fragment thereof having the same catalytic activity as the protein from which it is derived, which is referred to herein as a base editing complex when provided alone or as a molecular complex. Base editors have the ability to mediate targeted base modifications, i.e., converting a base of interest to result in a point mutation of interest, and if the base conversion does not cause a silent mutation, but converts the amino acid encoded by the codon containing the position to be converted by the base editor, the point mutation may in turn result in a targeted mutation.

[0080] As used herein, "regulatory element" refers to a nucleotide sequence that is not a part of a nucleotide sequence encoding a protein, but mediates the expression of a nucleotide sequence encoding a protein. Regulatory elements include, for example, promoters, cis-regulatory elements, enhancers, introns, or terminators. Depending on the type of regulatory element, it is located on a nucleic acid molecule before (i.e., at 5') or after (i.e., at 3') the nucleotide sequence encoding the protein. Regulatory elements work in living plant cells. The term "operably connected" means that a regulatory element is connected to a nucleotide sequence encoding a protein by such a manner, i.e., by such a manner relative to a nucleotide sequence encoding a protein, such as a nucleic acid molecule, so that the expression of the nucleotide sequence encoding a protein can be carried out in a living cell under the control of the regulatory element.

[0081] As used herein, "upstream" refers to a position on a nucleic acid molecule near the 5' end of the nucleic acid molecule. Similarly, the term "downstream" refers to a position on a nucleic acid molecule near the 3' end of the nucleic acid molecule. For the avoidance of doubt, nucleic acid molecules and their sequences are usually expressed in a 5' to 3' direction (from left to right).

[0082] As used herein, a "flanking region" is a region of a repair nucleic acid molecule that has a nucleotide sequence homologous to a nucleotide sequence of a DNA region flanking (ie, upstream or downstream) a preselected site.

[0083] As used herein, "transient expression" refers to the phenomenon that the transferred protein / polypeptide and the nucleic acid fragment encoding the protein / polypeptide are transiently expressed and / or active in the cell and are quickly shut down and / or degraded as the cell grows.

[0084] As used herein, a "double-strand DNA break-inducing enzyme," "double-strand break-inducing enzyme," or "DSBI enzyme" is an enzyme that can induce double-strand DNA breaks at a specific nucleotide sequence called a "recognition site" or "predetermined site." Correspondingly, a "single-strand DNA break-inducing enzyme," "single-strand break-inducing enzyme," or "SSBI enzyme" is an enzyme that can induce single-stranded DNA or RNA breaks at a specific nucleotide sequence called a "recognition site" or "predetermined site."

[0085] As used herein, "repair nucleic acid molecule" is a single-stranded or double-stranded DNA molecule or RNA molecule that is used as a template for modifying genomic DNA or RNA at a preselected site, the preselected site being near or at the cleavage site. As used herein, "used as a template for modifying genomic DNA" refers to replication or integration of a repair nucleic acid molecule at a preselected site by homologous recombination between a flanking region and a corresponding homologous region in a target genome flanking a preselected site, optionally in combination with non-homologous end joining (NHEJ) at one of the two ends of the repair nucleic acid molecule (e.g., in the case of only one flanking region).

[0086] As used herein, "modification of a genome" means that the genome has been altered in at least one nucleotide or by at least one epigenetic edit.

[0087] As used herein, "preselected site", "predetermined site" or "predefined site" refers to a specific nucleotide sequence in a genome (e.g., a nuclear genome or a chloroplast genome) at which one or more nucleotides are desired to be inserted, replaced and / or deleted.

[0088] As used herein, "plant hormone" or "plant growth regulator" refers to any naturally occurring or synthetic material and chemical that promotes plant cell division and / or plant morphogenesis. As used herein, "regeneration" refers to the process by which a single or multiple cells proliferate and develop into tissues, organs, and ultimately complete plants.

[0089] As used herein, the term "vector" or "plasmid" refers to a construct for introduction or transformation, transfection or transduction into any eukaryotic cell, including plants, plant cells, tissues, organs or materials according to the present invention, especially including plasmids or (plasmid) vectors, cosmids, artificial yeast or bacterial artificial chromosomes (YAC and BAC), phagemids, vectors based on bacterial phages, expression cassettes, isolated single-stranded or double-stranded nucleic acid sequences, including linear or circular sequences, or amino acid sequences, viral vectors, including modified viruses, and combinations or mixtures thereof.

[0090] In the context of recombinant gene, "recombination" can include regulating sequence and / or positioning sequence. Recombinant construct according to the present invention or DNA construct can be integrated in the vector, or can be a vector (comprising a plasmid vector), and / or it can be isolated from the carrier structure and exist, for example, exist in the form of single-stranded or double-stranded nucleic acid. After for example, transforming or transfecting by biological or physical means to introduce recombinant gene or DNA construct, described recombinant gene or DNA construct can persist outside chromosome, promptly is not integrated in the genome of target cell, for example, exists in the form of double-stranded or single-stranded DNA. Or, recombinant gene or DNA construct can stably be integrated in the genome of target cell, include other genetic elements of nuclear genome or target cell, include the genome of plastid like mitochondria or chloroplast.

[0091] The inventors have shown that nucleic acids encoding RKD2 and / or RKD4 mediate a strong effect, particularly in the early stages of regeneration after delivery of transgenic and / or genome engineered components. This effect does not affect plant development, and regenerated plants show good plant growth and fertility in adulthood. Therefore, integration of RKD2 and RKD4 genes can be isolated in offspring by hybridization and selection.

[0092] RKD2 and RKD4 are plant-specific RWP-RK transcription factors. RKD2 and RKD4 are found in Arabidopsis and other plant species such as wheat and corn. RKD2 and RKD4 alone or in combination can improve genome engineering and / or improve plant regeneration of transformed or gene-edited plant cells. RKD2 and RKD4 alone or together can increase the performance or ability of plant cells (preferably derived from somatic tissue, embryonic tissue, callus or protoplasts) to regenerate in whole plants, preferably fertile plants. Therefore, RKD2 and RKD4 can regulate somatic embryo formation (somatic embryo formation) and / or can increase the proliferation rate of plant cells individually or together. RKD2 and RKD4 may have a synergistic effect when combined together. In the various methods disclosed herein, RKD2, RKD4 or a combination of RKD2 and RKD4 can be transiently co-expressed. The polynucleotide encoding RKD2 or RKD4 can be introduced into plant cells.

[0093] Also provided are nucleic acids encoding RKD2 or RKD4 comprising the amino acid sequence of SEQ ID NO: 2 or 5. Further provided are nucleic acids encoding RKD2 or RKD4 comprising an amino acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 2 or 5.

[0094] A nucleic acid encoding RKD4 comprising an amino acid sequence of SEQ ID NO: 2, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 84%, 83%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 2 may include a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1. The nucleic acid may comprise a nucleotide sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1. Or, under stringent hybridization conditions, the nucleic acid can hybridize to the complementary strand of a nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 or a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:1.

[0095] Nucleic acids encoding RKD2 comprising the amino acid sequence of SEQ ID NO: 5, or an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 5 may also include nucleic acids comprising the nucleotide sequence of SEQ ID NO: 3 or 4. The nucleic acid may comprise a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 3. The nucleic acid may comprise a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 4. Alternatively, the nucleic acid may hybridize under stringent hybridization conditions to a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 3 or to the complement of a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 3. Or, under stringent hybridization conditions, the nucleic acid can hybridize to the complementary strand of a nucleic acid comprising the nucleotide sequence of SEQ ID NO:4 or a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:4.

[0096] A recombinant gene is provided, comprising a nucleic acid encoding RKD2 or RKD4, wherein the nucleic acid of RKD2 or RKD4 comprises the amino acid sequence of SEQ ID NO: 2 or 5, or an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 2 or 5. The nucleic acid may be operably linked to one or more regulatory elements. The regulatory element may be a promoter, a cis-regulatory element, an enhancer, an intron or a terminator. The regulatory element may be at 5' of the nucleic acid sequence. The regulatory element may be at 3' of the nucleic acid sequence. The regulatory element may be a directional promoter. The nucleic acid may comprise a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, 3 or 4. The nucleic acid may comprise a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1, 3 or 4. Under stringent hybridization conditions, the nucleic acid may hybridize to a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, 3 or 4 or to the complementary strand of a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1, 3 or 4.

[0097] In some embodiments, the nucleic acid is operably linked to a heterologous promoter. The heterologous promoter can be an inducible promoter.

[0098] The heterologous promoter can be a bidirectional inducible promoter, such as the chemically inducible promoter pOp6. The pOp6 promoter contains six copies of an optimized lac operator sequence, as described in Samalova et al., Plant J., 2005, 41(6):919-35. As part of the pOp6 / LhGR expression system, dexamethasone mobilizes LhGR to localize to the nucleus, where LhGR activates pOp6. LhGR can be operably linked to a strong constitutive promoter (e.g., a ubiquitin promoter or a double 35S promoter). The LhGR coding sequence can also include a ubiquitin intron. Alternatively, LhGR and a strong constitutive promoter can be expressed on separate DNA constructs.

[0099] In some embodiments, in step (a)(i), another nucleic acid comprising a polynucleotide sequence encoding a transcription factor operably linked to a strong constitutive promoter is introduced into the plant cell, wherein the transcription factor activates pOp6 upon binding to dexamethasone. In a specific embodiment, the transcription factor is LhGR or LhG4. In some embodiments, the LhGR has the amino acid sequence of SEQ ID NO:17, or an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:17; or wherein the nucleic acid encoding the LhGR comprises the coding sequence of SEQ ID NO:16, or a coding sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO:16.

[0100] In some embodiments, the strong constitutive promoter is an ubiquitin promoter or a double 35S promoter. In some specific embodiments, the double 35S promoter comprises the nucleotide sequence of SEQ ID NO: 21, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 21. In some specific embodiments, the ubiquitin promoter comprises the nucleotide sequence of SEQ ID NO: 23, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 23. In some specific embodiments, the ubiquitin promoter also includes a ubiquitin intron, which includes the nucleotide sequence of SEQ ID NO: 20, or a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 20.

[0101] Activated pOp6 can direct the transcription of genes operably linked to pOp6. Due to its bidirectionality, pOp6 can express both target genes (such as developmental genes) and reporter genes (such as GUS or tdTomato). As an alternative, pOp1, pOp2 or pOp4 can also be used.

[0102] Alternatively, the heterologous promoter can be XVE / OlexA, for example, as part of a β-estradiol-inducible XVE / OlexA system. Upon exposure to β-estradiol, XVE / OlexA becomes activated and can direct transcription of a gene operably linked to XVE / OlexA.

[0103] Since β-glucuronidase has a low activity level in plants, the GUS reporter system is applicable to most plants (GUS is β-glucuronidase). The tDTomato gene (tDT) encodes an exceptionally bright red fluorescent protein with a maximum excitation at 554 nm and a maximum emission at 581 nm. In addition, other reporter enzymes such as luciferase, β-galactosidase, chloramphenicol acetyltransferase (CAT), and alkaline phosphatase can also be used.

[0104] Also provided is a DNA construct, preferably a vector, comprising any of the above nucleic acids or recombinant genes. The nucleic acid may include a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, 3 or 4. The nucleic acid may include a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 1, 3 or 4. Or, under stringent hybridization conditions, the nucleic acid can hybridize to a complementary strand of a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1, 3 or 4 or a nucleic acid comprising a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 1, 3 or 4. In some embodiments, the DNA construct is a plasmid. In some embodiments, the DNA construct comprises a bidirectional inducible promoter (e.g., pOp6). The nucleic acid can be operably linked to the bidirectional inducible promoter. In some embodiments, the DNA construct comprises an XVE / OlexA promoter system capable of inducing expression of the nucleic acid upon exposure to β-estradiol. Another reporter nucleic acid (e.g., GUS or tdTomato) can also be operably linked to the bidirectional inducible promoter. The reporter nucleic acid can help select plants that express the nucleic acid in a leaky manner, such as when no induction of a bidirectional inducible promoter occurs. For example, plants can be selected that express GUS or tdTomato that is operably linked to the dexamethasone-inducible pOp6 when dexamethasone is not applied.

[0105] Plant Cells

[0106] In another aspect, a plant cell is provided, comprising one or more of the RKD2 or RKD4, nucleic acids, recombinant genes and DNA constructs described herein, preferably transgenic. In some embodiments, RKD2 or RKD4 comprises the amino acid sequence of SEQ ID NO: 2 or 5. In some embodiments, RKD2 or RKD4 comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 2 or 5. The nucleic acid may include a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, 3 or 4. The nucleic acid may comprise a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1, 3 or 4. Under stringent hybridization conditions, the nucleic acid may hybridize to a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, 3 or 4 or to the complementary strand of a nucleic acid comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 1, 3 or 4. Also provided are plants, plant parts, seeds, embryos or callus tissue comprising the plant cells.

[0107] The plant cell can be part of or derived from any type of plant material, preferably shoots, hypocotyls, cotyledons, stems, leaves, petioles, roots, embryos, callus, flowers, gametophytes or parts thereof, or can be protoplasts or derived from protoplasts. Isolated plant cells as well as plant material, i.e. whole plants or parts of plants comprising plant cells, can be used.

[0108] A part of a plant, or parts of multiple plants, can be attached to an intact whole plant, or separated from an intact whole plant. These parts of a plant include, but are not limited to, organs, tissues and cells of the plant, preferably seeds.

[0109] The plant cell, plant part or plant may be from any plant species, whether monocot or dicot. Preferably, the plant suitable for the methods and uses of the present invention is a plant selected from the genera Hordeum, Sorghum, Saccharum, Zea, Setaria, Oryza, Triticum, Secale, Triticale, Malus, Brachypodium, Aegilops, Daucus, Beta, Eucalyptus, Nicotiana, Solanum, Coffea, Vitis, Erythrante, Genlisea, Cucumis, Marus, Arabidopsis. rabidopsis, Crucihimalaya, Cardamine, Lepidium, Capsella, Olmarabidopsis, Arabia, Brassica, Eruca, Raphanus, Citrus, Jatropha, Populus, Medicago, Cicer, Cajanus, Phaseolus, Glycine, Gossypium, Astragalus, Lotus, Torenia, Allium, or Helianthus. More preferably, the plant is selected from the group consisting of barley (Hordeum vulgare), Hordeum bulbusomum, Sorghum bicolor, sugarcane (Saccharum officinarium), maize (Zeaspp.), including maize (Zea mays), millet (Setaria italica), small-grain rice (Oryza minuta), rice (Oryza sativa), Australian wild rice (Oryza australiensis), tall rice (Oryza alta), common wheat (Triticum aestivum), durum wheat (Triticum durum), rye (Secale cereale), triticale (Triticale), apple (Malus domestica), Brachypodium distachyon, Hordeum marinum, goat grass (Aegilops tauschii), carrot (Daucus glochidiatus), beet (Beta spp.), including sugar beet (Beta vulgaris), wild carrot (Daucus pusillus), Daucus muricatus, wild carrot (Daucus carota), Eucalyptus grandis, Nicotiana sylvestris, Nicotiana tomentosiformis, Nicotiana tabacum, Nicotiana benthamiana, tomato (Solanum lycopersicum), potato (Solanum tuberosum), coffee (Coffea canephora), grape (Vitis vinifera), Erythrante guttata, bladderwort (Genlisea aurea), cucumber (Cucumis sativus), Sichuan mulberry (Marus notabilis), Arabidopsis arenosa, Arabidopsis lyrata, Arabidopsis thaliana, Crucihimalaya himalaica), Crucihimalaya wallichii, Cardamine nexuosa, Lepidium virginicum, Capsella bursa pastoris, Olmarabidopsis pumila, Arabis hirsute, Brassica napus, Brassica oleracea, Brassica rapa, Raphanus sativus, Brassica juncacea, Brassica nigra, Eruca vesicariasubsp.sativa), sweet orange (Citrus sinensis), jatropha (Jatropha curcas), poplar (Populustrichocarpa), Medicago truncatula, Cicer yamashitae, Cicer bijugum, chickpea (Cicer arietinum), Cicer reticulatum, Cicer judaicum, Cajanus cajanifolius, bugle bean (Cajanus scarabaeoides), kidney bean (Phaseolus vulgaris), soybean (Glycine max), cotton (Gossypium sp.), astragalus sinicus, Lotus japonicas, torenia fournieri, onion (Allium cepa), shallot (Allium fistulosum), garlic (Allium sativum), sunflower (Helianthus annuus), Jerusalem artichoke (Helianthus tuberosus), and / or leek (Allium tuberosum). Particularly preferred are sugar beet (Beta vulgaris), corn (Zea mays), common wheat (Triticum aestivum), barley (Hordeum vulgare), rye (Secale cereale), sunflower (Helianthus annuus), potato (Solanum tuberosum), sorghum (Sorghum bicolor), turnip (Brassica rapa), rapeseed (Brassicanapus), canola (Brassica juncacea), cabbage (Brassica oleracea), radish (Raphanussativus), rice (Oryza sativa), soybean (Glycine max) and / or cotton (Gossypium sp.).

[0110] The genetically modified plant cell can be a part of the whole plant, or a part of the part. Therefore, the present invention also relates to a plant or plant part comprising the genetically modified plant cell.

[0111] Plant cells into which genome engineering components have been (co)introduced are cultured under conditions that allow genetic modification of the genome of said plant cells by integrating the transgene of interest and the activity of the genome engineering components in the presence of RKD2 or RKD4.

[0112] Genetic modification of plant cells

[0113] Also provided are methods for genetic modification in plant cells. The methods include introducing into plant cells (i) any nucleic acid, recombinant gene, or DNA construct described herein; and (ii) transgenic and / or genome engineering components. The plant cells can be cultured under conditions that allow synthesis of RKD2 or RKD4 polypeptides from nucleic acids, recombinant genes, or DNA constructs. The plant cells can be cultured under conditions that allow genetic modification of the genome of the plant cells by the activity of genome engineering components in the presence of RKD2 or RKD4 polypeptides.

[0114] Genome engineering components can be introduced as proteins and / or nucleic acids encoding genome engineering components, particularly as DNA such as plasmid DNA, RNA, mRNA or RNP. Genome engineering can be used to make transgenic, gene-edited or base-edited plant materials.

[0115] For the plant cells to be modified, transformation methods based on biological approaches can be used, such as Agrobacterium transformation or viral vector-mediated plant transformation. Common biological methods are transformation with Agrobacterium, which has been used in a variety of different plant materials for decades. Viral vector-mediated plant transformation can also be used to introduce genetic material into target cells. Agrobacterium-mediated transformation refers to the use of Agrobacterium tumefaciens to transport foreign DNA into plant cells, and Agrobacterium tumefaciens is a soil bacterium that is used as a natural genetic engineering vector. Agrobacterium tumefaciens can invade plants and transfer foreign DNA in a fairly wide range of plants.

[0116] Alternatively, transformation methods based on physical delivery methods, such as particle bombardment or microinjection, can be used. Particle bombardment includes biolistic transfection or microparticle-mediated gene transfer, which refers to a physical delivery method in which coated microparticles or nanoparticles containing nucleic acids or gene constructs of interest are transferred into target cells or tissues. Physical introduction means are suitable for the introduction of nucleic acids, i.e., RNA and / or DNA, as well as proteins. Particle bombardment and microinjection have become prominent techniques for the introduction of genetic material into target plant cells or tissues. Helenius et al., "Gene delivery into intact plants using the Helios TMGene Gun", Plant Molecular Biology Reporter, 2000, 18(3):287-288 discloses particle bombardment as a physical method for introducing substances into plant cells. Thus, there are a variety of plant transformation methods for introducing genetic material in the form of gene constructs into target plant cells, including biological and physical methods known to those skilled in the art of plant biotechnology, which can be used to introduce at least one gene encoding at least one wall-associated kinase into at least one cell of at least one of a plant cell, tissue, organ or whole plant.

[0117] The term "particle bombardment", also known as "gene gun transfection" or "microparticle-mediated gene transfer" as used herein, refers to a physical delivery method for transferring coated microparticles or nanoparticles containing RKD2 or RKD4 genes, genome engineering components and / or transgenes into target cells or tissues. Microparticles or nanoparticles act as projectiles and are fired at the target structure of interest using an appropriate device (commonly known as a gene gun) under high pressure. Transformation by particle bombardment uses metal microprojectiles coated with the construct of interest, which are then fired at the target cells using a device known as a "gene gun" (Sandford et al. 1987) at a high speed fast enough (about 1500 km / h) to penetrate the cell wall of the target tissue, but not enough to cause cell death. For protoplasts from which the cell wall has been completely removed, the conditions are logically different. The construct deposited on the at least one microprojectile is released into the cell after bombardment. The acceleration of the microprojectile is accomplished by high-voltage discharge or compressed gas (helium). As for the metal particles used, they must be non-toxic, non-reactive, and their diameter must be smaller than the diameter of the target cell. The most commonly used are gold or tungsten. Manufacturers and suppliers of gene guns and related systems provide a wealth of public information on their general uses.

[0118] In a particularly preferred embodiment of microprojectile bombardment, one or more RKD2 or RKD4 genes, genome engineering components and / or transgenes are co-delivered via microcarriers comprising gold particles having a size in the range of 0.4-1.6 micrometers (μm), preferably 0.4-1.0 μm. In an exemplary procedure, 10-1000 μg of gold particles, preferably 50-300 μg, are used per bombardment.

[0119] RKD2 or RKD4 gene, genome engineering components and / or transgene can be delivered to target cells, for example, using a Bio-Rad PDS-1000 / He particle gun or a handheld Helios gene gun system. When using the PDS-1000 / He particle gun system, the bombardment rupture pressure is 450-2200psi, preferably 450-1100psi, while the Helios gene gun system has a rupture pressure of 100-600psi. More than one chemical substance or construct can be co-delivered to the target cell simultaneously with the genome engineering components.

[0120] The above-mentioned delivery methods for conversion and transfection can be used to introduce the instrument of the present invention simultaneously. Similarly, there are specific conversion or transfection methods for introducing the target nucleic acid or amino acid construct into plant cells, including electroporation, microinjection, nanoparticles and cell penetrating peptides (CPP). In addition, there are chemical-based transfection methods to introduce gene constructs and / or nucleic acids and / or proteins, including calcium phosphate transfection, liposome (e.g., cationic liposome) transfection, or cationic polymer (including DEAD-dextran or polyethyleneimine) transfection, or a combination thereof. The above-mentioned delivery techniques can be used alone or in combination in vivo (including original position) or in vitro methods.

[0121] In some embodiments, the genome engineering components comprise:

[0122] a) an enzyme that induces a double strand break (DSB) or a nucleic acid encoding the same, and optionally a repair nucleic acid molecule, wherein the DSB inducing enzyme optionally recognizes a predetermined site in the genome of the cell;

[0123] b) an enzyme that induces a single strand break (SSB) or a nucleic acid encoding the same, and optionally a repair nucleic acid molecule, wherein the SSB inducing enzyme optionally recognizes a predetermined site in the genome of the cell;

[0124] c) a base editing enzyme, optionally fused to a disarmed DSB or SSB inducing enzyme, wherein the base editing enzyme preferably recognizes a predetermined site in the genome of the cell; or

[0125] d) an enzyme that effects DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ribosylation or histone citrullination, which is optionally fused to a disarming DSB or SSB inducing enzyme, wherein the enzyme preferably recognizes a predetermined site in the genome of the cell.

[0126] In order to be able to break at a predetermined target site, the enzyme preferably includes a binding / recognition domain and a cleavage domain. Specific enzymes that can induce double-stranded or single-stranded breaks are nucleases or nickases and variants thereof, including no longer comprising nuclease or nickase functions, but being combined with another enzyme as an enzyme for recognition molecules. In recent years, many suitable nucleases have been developed, especially customized endonucleases, including meganucleases, zinc finger nucleases, TALE nucleases, Argonaute nucleases such as those derived from Natronobacterium gregoryi, and CRISPR nucleases, including, for example, Cas9, Cpf1, Csm1, MAD7, casX or CasY nucleases as part of a clustered regularly spaced short palindromic repeat (CRISPR) system. In a preferred embodiment of the present invention, the genome engineering component comprises a DSB or SSB inducing enzyme or a variant thereof selected from the following: CRISPR / Cas endonuclease, CRISPR / Cas9 endonuclease, CRISPR / Cpf1 endonuclease, CRISPR / Csm1 endonuclease, CRISPR / MAD7 endonuclease, CRISPR / CasX endonuclease, CRISPR / Casy endonuclease, zinc finger nuclease (ZFN), homing endonuclease, large range nuclease, and TAL effector nuclease.

[0127] Rare cutting endonucleases are DSBI / SSBI enzymes, which have a recognition site preferably of about 14 to 70 continuous nucleotides, so even in larger genomes (e.g., most plant genomes), they also have a very low cutting frequency. Homing endonucleases, also referred to as meganucleases, constitute the family of this rare cutting endonucleases. They can be encoded by introns, independent genes, or intervening sequences, and have surprising structural and functional properties that distinguish them from more classical restriction enzymes (generally derived from bacterial restriction modification type II systems). Their recognition sites have a general asymmetry, which is contrary to the characteristic binary symmetry of most restriction endonuclease recognition sites. Several homing endonucleases encoded by introns or inteins have been shown to promote the homing of their respective genetic elements to the intronless or inteinless sites of the allele. By causing site-specific double-strand breaks in intronless or inteinless alleles, these nucleases generate recombinant ends that participate in the gene conversion process, which duplicates the coding sequence and results in the insertion of introns or intervening sequences at the DNA level. A further list of rare-cutting meganucleases and their respective recognition sites are provided in Table I of WO 03 / 004659 (pages 17 to 20) (incorporated herein by reference).

[0128] In addition, methods can be used to design custom rare-cutting endonucleases that recognize essentially any target nucleotide sequence of choice. In short, chimeric restriction enzymes can be prepared by using hybridization between zinc finger domains designed to recognize specific nucleotide sequences and non-specific DNA cleavage domains from natural restriction enzymes (e.g., FokI). This approach is described in WO 03 / 080809, WO 94 / 18313 or WO 95 / 09233 and Isalan et al. (2001). A rapid, generally applicable zinc finger engineering approach is illustrated targeting the HIV-1 promoter. Nature biotechnology, 19(7):656; Liu et al. (1997). Design of multi-finger zinc finger proteins for unique addressing in complex genomes. Proceedings of the National Academy of Sciences, 94(11):5525-5530.

[0129] Another example of a custom endonuclease includes TALE nucleases (TALENs), which are based on transcription activator-like effector proteins (TALEs) from the bacterial genus Xanthomonas fused to the catalytic domain of a nuclease (e.g., FokI or a variant thereof). The DNA binding specificity of these TALEs is defined by repeated variable doublets (RVDs) of 34 / 35 amino acid repeat units arranged in tandem, such that one RVD specifically recognizes one nucleotide in the target DNA. These repeat units can be assembled to recognize essentially any target sequence and fused to the catalytic domain of a nuclease to produce a sequence-specific endonuclease (see, e.g., Boch et al. (2009). Breaking the code of DNA binding specificity of TAL-type III effectors. Science, 326(5959), 1509-1512; Moscou & Bogdanove (2009). A simple cipher governs DNA recognition by TAL effectors. Science, 326(5959), 1501-1501; and WO 2010 / 079430, WO 2011 / 072246, WO 2011 / 154393, WO 2011 / 146121, WO 2012 / 001527, WO 2012 / 093833, WO 2012 / 104729, WO 2012 / 138927, WO 2012 / 138939). WO 2012 / 138927 further describes monomeric (compact) TALENs and TALEs with multiple catalytic domains and combinations thereof.

[0130] Recently, a new type of customizable endonuclease system has been described; called the CRISPR / Cas system. The CRISPR system in its natural environment describes a molecular complex comprising at least one small, single noncoding RNA and a Cas nuclease or another CRISPR nuclease (such as a Cpf1 nuclease or a Csm1 nuclease) (Zetsche et al., "Cpf1 Is a Single RNA-Guides Endonuclease of a Class 2 CRISPR-Cas System", Cell, 163, pp. 1-13, October 2015.; US 2017 / 0233756 A1), which can produce specific DNA double-strand breaks. Currently, CRISPR systems are divided into 2 categories, including 5 types of CRISPR systems, such as type II systems using Cas9 as effectors and type V systems using Cpf1 as effector molecules (Makarova et al., Nature Rev. Microbiol., 2015). In the artificial CRISPR system, synthetic non-coding RNA and CRISPR nuclease and / or optionally modified CRISPR nuclease (which is modified to act as a nickase or lacks any nuclease function) can be used in combination with at least one synthetic or artificial guide RNA or gRNA that combines crRNA and / or tracrRNA functions (Makarova et al., 2015, supra). The immune response mediated by the CRISPR / Cas system in nature should require CRISPR-RNA (crRNA), wherein the maturation of this guide RNA that controls the specific activation of CRISPR nucleases varies greatly between the various CRISPR systems characterized so far. First, the invading DNA (also called the spacer) is integrated between two adjacent repeat regions at the proximal end of the CRISPR locus. The type II CRISPR system encodes the Cas9 nuclease as a key enzyme in the interference step, and the system contains both crRNA and trans-activating RNA (tracrRNA) as guide motifs. These hybridize and form double-stranded (ds) RNA regions that are recognized by RNAseIII and can be cut to form mature crRNA. These in turn then bind to the Cas molecule in order to guide the nuclease specifically to the target nucleic acid region. Recombinant gRNA molecules can contain both variable DNA recognition regions and Cas interaction regions, and can therefore be designed specifically independent of the particular target nucleic acid and the desired Cas nuclease.

[0131] As a further safety mechanism, a PAM (protospacer adjacent motif) must be present in the target nucleic acid region; these are DNA sequences that are directly following the DNA that recognizes the Cas9 / RNA complex. The PAM sequence of Cas9 from Streptococcus pyogenes has been described as "NGG" or "NAG" (standard IUPAC nucleotide code) (Jinek et al, "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", Science 2012, 337: 816-821). The PAM sequence of Cas9 from Staphylococcus aureus is "NNGRRT" or "NNGRR (N)". Other variant CRISPR / Cas9 systems are known. Thus, the Cas9 of Neisseria meningitidis cuts at the PAM sequence NNNNGATT. Cas9 of Streptococcus thermophilus cuts at the PAM sequence NNAGAAW. Recently, another PAM motif NNNNRYAC has been described for the CRISPR system of Campylobacter jejuni (WO 2016 / 021973 A1). For Cpf1 nuclease, it has been described that the Cpf1-crRNA complex without tracrRNA effectively recognizes and cuts the target DNA with a short T-rich PAM in front, which is in contrast to the PAM that is usually rich in G recognized by the Cas9 system (Zetsche et al., supra). In addition, by using modified CRISPR polypeptides, specific single-strand breaks can be obtained. The combined use of Cas nickase and a variety of recombinant gRNAs can also induce highly specific DNA double-strand breaks by producing double DNA nicks. In addition, by using two RNAs, the specificity of DNA binding can be optimized, and thus DNA cutting can be optimized. Other CRISPR effectors, such as the CasX and CasY effectors originally described in bacteria, are also available and represent additional effectors that can be used for genome engineering purposes (Burstein et al., "New CRISPR-Cas systems from uncultivated microbes", Nature, 2017, 542, 237-241).

[0132] The cleavage site of the DSBI / SSBI enzyme is related to the exact position of the induced break on the DNA or RNA. The cleavage site may or may not be included in the recognition site of the DSBI / SSBI enzyme (overlapping with it), so it is believed that the cleavage site of the DSBI / SSBI enzyme is located at or near its recognition site. The recognition site (sometimes also referred to as the binding site) of the DSBI / SSBI enzyme is a nucleotide sequence that is recognized by the DSBI / SSBI enzyme (specificity) and determines its binding specificity. For example, a TALEN or ZNF monomer has a recognition site determined by its RVD repeats or ZF repeats, respectively, and its cleavage site is determined by its nuclease domain (e.g., FokI), and is generally outside the recognition site. In the case of a dimeric TALEN or ZFN, the cleavage site is located between the two recognition / binding sites of each monomer, and the spacer DNA or RNA region where the cleavage occurs is referred to as a spacer.

[0133] One skilled in the art is able to select a DSBI / SSBI enzyme that recognizes a specific recognition site and induces DSB or SSB at a cleavage site at or near a preselected / predetermined site, or design such a DSBI / SSBI enzyme. Alternatively, a DSBI / SSBI enzyme recognition site can be introduced into the target genome using any conventional transformation method or by hybridization with an organism having a DSBI / SSBI enzyme recognition site in its genome, and then any desired nucleic acid can be introduced at or near the cleavage site of the DSBI / SSBI enzyme.

[0134] In various embodiments, the modification of the genome comprises one or more of: i) replacement of at least one nucleotide; ii) deletion of at least one nucleotide; iii) insertion of at least one nucleotide; iv) changes in DNA methylation; and v) changes in histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone sumoylation, histone ribosylation or histone citrullination.

[0135] In some embodiments, the activity of the genome engineering component induces one or more double-strand breaks in the genome of a plant cell, one or more single-strand breaks in the genome of a plant cell, one or more base editing events in the genome of a plant cell, or one or more of DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ubiquitination, histone ribosylation, or histone citrullination in the genome of a plant cell.

[0136] In some embodiments, after inducing one or more double-strand breaks or one or more single-strand breaks, non-homologous end joining (NHEJ) and / or homology-directed repair of the breaks is performed by a homologous recombination mechanism (HDR). NHEJ and HDR are two major and different approaches to repair breaks. Homologous recombination requires the presence of homologous sequences as templates (such as repair nucleic acid molecules or "donors") to guide the cell repair process and the repair results are error-free and predictable. In the absence of a template (or repair nucleic acid molecule or "donor") sequence for homologous recombination, cells typically attempt to repair breaks by a non-homologous end joining (NHEJ) process.

[0137] In the particularly preferred aspect of the present embodiment, the repair nucleic acid molecule is introduced into the plant cell in addition.The repair nucleic acid molecule is a single-stranded or double-stranded DNA molecule or an RNA molecule, which is used as the template for modifying the genomic DNA or RNA at the preselected site, and the preselected site is near the cleavage site or is located at the cleavage site.In some embodiments, the repair nucleic acid molecule is used as the template for modifying genomic DNA, wherein by homologous recombination between the corresponding homology region in the target genome positioned at the flank of the preselected site, optionally with the non-homologous end connection (NHEJ) (for example, in the case of only having a flanking region) combination at one of the two ends of the repair nucleic acid molecule, the repair nucleic acid molecule is replicated or integrated at the preselected site.Integration by homologous recombination allows the repair nucleic acid molecule to be accurately connected to the target genome until reaching the nucleotide level, and NHEJ may cause the junction between the repair nucleic acid molecule and the genomic DNA to have less insertion / deletion.

[0138] In various embodiments of the aspects described herein, modification of the genome occurs, wherein the genome has undergone at least one nucleotide change. The genome may be modified by insertion of a transgene (preferably comprising an expression cassette for the transgene of interest), substitution of at least one nucleotide and / or deletion of at least one nucleotide and / or insertion of at least one nucleotide, as long as it results in a total change of at least one nucleotide compared to the nucleotide sequence of the preselected genomic target site prior to modification, thereby allowing identification of the modification, for example, by techniques such as sequencing or PCR analysis, which are well known to the skilled person.

[0139] The genome can be modified at a preselected site, predetermined site or predefined site in a genome (e.g., a nuclear genome or a chloroplast genome), i.e., a specific nucleotide sequence, where it is desired to insert, replace and / or delete one or more nucleotides. For example, the preselected site, predetermined site or predefined site can be an endogenous locus or a specific nucleotide sequence in or connected to a previously introduced exogenous DNA, RNA or transgenic. The preselected site can be a specific nucleotide position where one or more nucleotides are intended to be inserted (afterwards). The preselected site can also include a sequence of one or more nucleotides that will be exchanged (replaced) or deleted.

[0140] In a number of embodiments, the length and percentage sequence identity of the flanking region are selected to enable homologous recombination to be performed between the flanking region and its corresponding DNA region upstream or downstream of the preselected site. The DNA region flanking the preselected site that has homology to the flanking DNA region of the repair nucleic acid molecule is also referred to as a homologous region in the genomic DNA.

[0141] In order to have enough homology to carry out recombination, the length of the flanking DNA region of the repair nucleic acid molecule can be different, and its length should be at least about 10nt, about 15nt, about 20nt, about 25nt, about 30nt, about 40nt or about 50nt. However, the flanking region can actually be as long as possible (for example, up to about 100-150kb, such as complete bacterial artificial chromosome (BAC)). Preferably, the flanking region is about 50nt to about 2000nt, for example about 100nt, 200nt, 500nt or 1000nt. In addition, the region of the target DNA flank need not be identical with the homology region (DNA region flanking the preselected site), and can have about 80% to about 100% sequence identity with the DNA region flanking the preselected site, preferably about 95% to about 100% sequence identity. The longer the flanking region is, the less strict the requirement to homology is. Furthermore, in order to achieve exchange of the target DNA sequence at the preselected site without changing the DNA sequence of the adjacent DNA sequences, the flanking DNA sequences should preferably be identical to the upstream and downstream DNA regions flanking the preselected site.

[0142] In order to achieve sequence modification at the preselected site, the flanking region must be selected so that the 3' end of the upstream flanking region and / or the 5' end of the downstream flanking region are aligned with the end of the predetermined site. Therefore, the 3' end of the upstream flanking region determines the 5' end of the predetermined site, while the 5' end of the downstream flanking region determines the 3' end of the predetermined site.

[0143] The preselected site is located outside or away from the cleavage (and / or recognition) site, such that the site (preselected site) in which the genome modification is to be performed does not include the cleavage site and / or recognition site of the DSBI / SSBI enzyme, so that the preselected site does not overlap with the cleavage (and / or recognition) site. Therefore, in this regard, outside / away means upstream or downstream of the cleavage (and / or recognition) site.

[0144] In various embodiments, at least one base editor according to the present invention is temporarily or permanently connected to at least one site-specific DSBI / SSBI enzyme complex or at least one modified site-specific DSBI / SSBI enzyme complex, or optionally connected to a component of the at least one site-specific DSBI / SSBI enzyme complex. The connection can be covalent and / or non-covalent. Any base editor or site-specific DSBI / SSBI enzyme complex disclosed herein, or a catalytically active fragment thereof, or any component of a base editor complex or site-specific DSBI / SSBI enzyme complex can be introduced into a cell as a nucleic acid fragment representing or encoding a DNA, RNA or protein effector, or it can be introduced as DNA, RNA and / or protein or any combination thereof.

[0145] Base editors are proteins or fragments thereof having the ability to mediate targeted base modification, i.e., converting the target base to obtain a target point mutation. Preferably, in the context of the present invention, the at least one base editor is temporarily or permanently fused to at least one DSBI / SSBI enzyme, or optionally to a component of at least one DSBI / SSBI. The fusion may be covalent and / or non-covalent. Multiple publications show targeted base conversion using CRISPR / Cas9 nickase or non-functional nuclease (apolipoprotein B mRNA editing catalytic polypeptide (APOBEC1), such as APOBEC derived from rats) connected to a cytidine deaminase domain, mainly from cytidine (C) to thymine (T). The deamination of cytosine (C) is catalyzed by cytidine deaminase, and uracil (U) is produced, which has the property of pairing with thymine (T) bases. Most known cytidine deaminases work on RNA, and a few examples of known acceptance of DNA require single-stranded (ss) DNA. Studies on dCas9-target DNA complexes have shown that at least 9 nucleotides (nt) in the displaced DNA strand are unpaired when forming the "R-loop" complex of Cas9-guide RNA-DNA (Jore et al., Nat. Struct. Mol. Biol., 18, 529-536 (2011)). In fact, in the structure of the Cas9 R-loop complex, the first 11 nucleotides of the pre-spacer sequence on the displaced DNA strand are disordered, indicating that their movement is not strictly restricted. It is also speculated that the mutation of cytosine induced by the Cas9 nickase in the non-template strand may be due to the accessibility of cellular cytosine deaminase. It is speculated that a subset of this section of ssDNA in the R-loop can serve as an effective substrate for the cytidine deaminase tethered to dCas9 to achieve direct programmable conversion of C to U in DNA (Komor et al., supra). Recently, Goudelli et al., Programmable baseediting of A·T to G·C in genomic DNA without DNA cleavage, Nature, 2017, 551(7681), 464 described an adenine base editor (ABE) that mediates the conversion of A·T to G·C in genomic DNA.

[0146] Enzymes that achieve DNA methylation and histone modifying enzymes have been identified in the art. Histone post-translational modification plays an important role in regulating chromatin structure and gene expression. For example, enzymes for histone acetylation are described in Sterner DE, Berger SL (June 2000): "Acetylation of histones and transcription-related factors", Microbiol. Mol. Biol. Rev. 64 (2): 435-59. Enzymes that achieve protein methylation are described in Zhang Y., Reinberg D (2001): "Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails", Genes Dev. 15 (18): 2343-60. Histone ubiquitination is described in Shilatifard A (2006): "Chromatin modifications by methylation and ubiquitination: implications in the regulation of gene expression", Annu. Rev. Biochem. 75: 243-69. Enzymes for histone phosphorylation are described in Nowak SJ, Corces VG (April 2004): "Phosphorylation of histone H3: a balancing act between chromosome condensation and transcriptional activation", Trends Genet. 20 (4): 214-20. Enzymes for histone ubiquitination are described in Nathan D., Ingvarsdottir K., Sterner DE, et al. (April 2006): "Histone sumoylation is a negative regulator in Saccharomyces cerevisiae and shows dynamic interplay with positive-acting histone modifications", Genes Dev. 20 (8): 966-76.The enzymes for histone ribosylation are described in Hassa P.O., Haenni SS, Elser M., Hottiger MO (September 2006): "Nuclear ADP-ribosylation reactions in mammalian cells: where are we today and where are we going?", Microbiol. Mol. Biol. Rev. 70(3): 789-829. Histone citrullination is catalyzed by an enzyme called peptidyl arginine deaminase 4 (PAD4, also known as PADI4), which converts histone arginine (Arg) and monomethylarginine residues to citrulline.

[0147] Enzymes that effect DNA methylation and histone modifying enzymes may be fused to disarming DSB or SSB inducing enzymes, which preferably recognize predetermined sites in the genome of the cell.

[0148] Exemplary transgenes

[0149] In various embodiments of the method for genetic modification in plant cells, the transgene can be a gene selected from the following: a gene encoding resistance or tolerance to abiotic stress, including drought stress, osmotic stress, heat stress, cold stress, oxidative stress, heavy metal stress, nitrogen deficiency, phosphate deficiency, salt stress or waterlogging, herbicide resistance, including resistance to glyphosate, glufosinate / ammonium glufosinate, hygromycin, protoporphyrinogen oxidase (PPO) inhibitors, ALS inhibitors and dicamba; a gene encoding resistance or tolerance to biotic stress, including virus resistance genes, fungal resistance genes, bacterial resistance genes, insect resistance genes; or a gene encoding yield-related traits, including lodging resistance, flowering time, shattering resistance, seed color, endosperm composition or nutritional content.

[0150] In a plurality of embodiments of the method for carrying out genetic modification in plant cells, the method effectively promotes cell proliferation or cell regeneration, or effectively improves the regeneration efficiency of transgenic, gene editing or base editing plants. The method is preferably effective after genetic modification / genomic modification. In a plurality of embodiments of the method for carrying out genetic modification in plant cells, the method effectively induces direct or indirect (somatic) embryo formation from a single cell (preferably embryonic cells, somatic cells or protoplasts) or from callus cells. The method is preferably effective after genetic modification / genomic modification. In a plurality of embodiments, the method effectively improves the stable conversion efficiency of transgenic into plant cells, or effectively improves the production efficiency of genetically modified plants. In a plurality of embodiments, the method effectively improves the efficiency of genome engineering component editing plant cell genomes, or effectively improves the generation efficiency of transgenic, gene editing or base editing plants.

[0151] In some embodiments, the method is effective to increase the regeneration efficiency of plants derived from recalcitrant genotypes, effective to increase the regeneration efficiency of plants from unconventional tissue types, or preferably effective to accelerate the regeneration process following genetic / genomic modification.

[0152] Transient expression of RKD2 or RKD4 gene

[0153] Also provided is a method for transiently expressing RKD2 or RKD4 genes in plant cells. The method comprises introducing into plant cells (i) a nucleic acid, a recombinant gene or a DNA construct as described herein; and (ii) a transgenic and / or genome engineering component.

[0154] In some embodiments, RKD2 and RKD4 are transiently co-expressed. Such co-expression can effectively promote cell proliferation. Such co-expression can effectively promote cell regeneration. Such co-expression can effectively induce embryo formation from a single cell, thereby providing the ability to regenerate homogeneous plants without selection. Co-expression can improve genome editing efficiency by co-delivery with genome editing components.

[0155] Transient co-delivery of RKD2 and RKD4 can be performed as described in US Provisional Application No. 62 / 685,626, which is incorporated herein by reference in its entirety.

[0156] Transient expression can be carried out by transient transformation / transfection of a nucleic acid fragment encoding a RKD2 or RKD4 protein / polypeptide preferably expressed under a chemically inducible promoter. Transient expression of a nucleic acid encoding a RKD2 polypeptide or a nucleic acid encoding a RKD4 polypeptide can also be achieved by stably transforming the RKD2 or RKD4 gene under the control of a tissue and development-specific promoter or an inducible promoter. The RKD2 or RKD4 gene can be expressed and then have transient activity. The RKD2 or RKD4 gene can be turned off and degraded soon after the plant cell development is changed or the inducing conditions are removed. For example, the dexamethasone inducible promoter pOp6 (SEQ ID NO: 15) can be used to drive transient transformation of the RKD2 or RKD4 gene.

[0157] Transient transfection, transient transformation and stable transformation can all produce transient expression. "Transient transformation" and "transient transfection" include transferring foreign substances [i.e. nucleic acid fragments, proteins, ribonucleoproteins (RNPs), etc.] into host cells, thereby causing gene expression and / or activity without integrating and stabilizing the inherited foreign substances. Foreign components are not permanently incorporated into the cell genome, but provide a temporary effect that causes genome modification. Transient transformation events cannot be passed to the next generation and are therefore non-inheritable. "Stable transformation" refers to an event in which the transferred nucleic acid fragments are integrated into the host cell genome (including both the nuclear and organelle genomes) to cause stable inheritance of the nucleic acid fragments.

[0158] For example, transient expression can be used for transient genome editing. The transient activity and / or transient presence of genome engineering components in plant cells can lead to one or more double-strand breaks in the plant cell genome, one or more single-strand breaks in the plant cell genome, one or more base editing events in the plant cell genome, or one or more DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ubiquitination, histone ribosylation or histone citrullination in the plant cell genome. The modification produced in the plant cell genome can be selected, for example, from: replacement of at least one nucleotide, deletion of at least one nucleotide, insertion of at least one nucleotide, changes in DNA methylation, changes in histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone benzoylation, histone ribosylation or histone citrullination, or any combination thereof.

[0159] In addition to direct or indirect chemical induction of a heterologous promoter operably linked to a polynucleotide sequence encoding a RKD2 polypeptide or a RKD4 polypeptide, transient expression can also be achieved by one or more site-directed transcriptional activators. Such site-directed transcriptional activators can be synthetic transcription factors described in U.S. Provisional Application Nos. 62 / 609,508 and 62 / 758,068, both of which are incorporated herein by reference. The synthetic transcription factor may include at least one recognition domain and at least one gene expression regulatory domain, particularly an activation domain, wherein the synthetic transcription factor is configured to regulate the expression of endogenous genes in the genome of a plant or plant cell. Such endogenous genes are preferably (natural) morphogenetic genes encoding polypeptides involved in plant development processes such as root formation or shoot formation. In some embodiments, the endogenous morphogenetic gene is selected from an endogenous nucleic acid encoding a RKD4 polypeptide or an endogenous nucleic acid encoding a RKD2 polypeptide. In some embodiments, the at least one recognition domain is a molecule or molecule fragment selected from the following: at least one TAL effector, at least one disarmed CRISPR / nuclease system, at least one zinc finger domain and at least one disarmed homing endonuclease, or any combination thereof.

[0160] In some embodiments, the at least one unarmed CRISPR / nuclease system is a CRISPR / dCas9 system, a CRISPR / dCpf1 system, a CRISPR / dCsm1 system, a CRISPR / dMAD7 system, a CRISPR / dCasX system or a CRISPR / dCasY system, or any combination thereof, and wherein the at least one unarmed CRISPR / nuclease system comprises at least one guide RNA.

[0161] In some embodiments, the at least one activation domain is selected from an acidic transcriptional activation domain, preferably, wherein the at least one activation domain is selected from a TAL effector gene of Xanthomonas oryzae, VP16 or tetrameric VP64 from Herpes simplex, VPR, SAM, Scaffold, Suntag, P300, VP160, or any combination thereof. In some embodiments, the activation domain is VP64.

[0162] In some embodiments, the synthetic transcription factor is configured to regulate the expression, preferably transcription, of the morphogenic gene by binding to a regulatory region located at a certain distance relative to the start codon. In a preferred embodiment, the synthetic transcription factor is configured to increase the expression, preferably transcription, of the morphogenic gene by binding to a regulatory region located at a certain distance relative to the start codon.

[0163] In some embodiments, the site-directed transcriptional activator / synthetic transcription factor or the nucleic acid encoding the same comprises at least one recognition domain and at least one activation domain, wherein the site-directed transcriptional activator is configured to increase the expression of an endogenous RKD4 polypeptide or an endogenous RKD2 polypeptide, preferably by binding to a regulatory region located at a certain distance relative to the start codon of the endogenous RKD4 polypeptide or the endogenous RKD2 polypeptide.

[0164] As used herein, "regulatory region" refers to the binding site of at least one recognition domain and a target sequence in the genome at or near a morphogenetic gene. Depending on the nature of the at least one activation domain and at least one recognition domain further disclosed herein, there may be two discrete regulatory regions, or there may be overlapping regulatory regions, and the different domains of the synthetic transcription factor may be assembled in a modular manner.

[0165] In some embodiments, the at least one recognition domain can target at least one sequence (recognition site) relative to the start codon of the target gene, and the sequence is located at least 1000bp, -700bp to +700bp, -550bp to +500bp or -550bp to +425bp upstream (-) or downstream (+) relative to the start codon of the target gene. In some embodiments, the recognition domain near the recognition promoter may be preferred, and the targeting range of synthetic transcription factors is highly expanded compared to traditional or naturally occurring transcription factors, representing the advantages of specific synthetic transcription factors. Because recognition and / or activation domains can be specifically designed and constructed to specifically recognize and target the hot spots of regulation.

[0166] In certain embodiments, at least one recognition site may be located at -169bp to -4bp, -101bp to -48bp, -104bp to -42bp, or -175bp to +450bp relative to the start codon of the target gene (upstream (-) or downstream (+), respectively) to provide an optimal spatial binding environment that allows optimal regulation, preferably transcriptional activation activity. In particular, for CRISPR-based synthetic transcription factors that work with guide RNAs as recognition moieties, the binding site may also be located within the coding region of the target gene (downstream of the start codon of the target gene).

[0167] In another embodiment, the recognition domain of the synthetic transcription factor can be bound to the 5' and / or 3' untranslated region (UTR) of the target gene. In an embodiment using different recognition domains, at least two recognition domains can be bound to different target regions of the morphogenic gene, including 5' and / or 3' UTR, but they can also be bound outside the gene region, but still maintain a certain distance of up to 1 to 1500 bp therefrom. A preferred region to which the recognition domain can be bound is located about -4 bp to about -300 bp upstream of the start codon of the target morphogenic gene, preferably about -40 bp to about -170p. In addition, in this way, the length of the recognition domain and therefore the length of the corresponding recognition site in the target genome can vary according to the properties of the synthetic transcription factor and the recognition domain used. Based on the molecular characteristics of the at least one recognition domain, this will also determine the length of the corresponding at least one recognition site. For example, in the case where a single zinc finger can be about 8 bp to about 20 bp, wherein an array of 3 to 6 zinc finger motifs is preferred, a single TALE recognition site can be about 11 bp to about 30 bp, or more. The recognition site of the gRNA of a synthetic CRISPR-based transcription factor includes a targeting or "spacer" sequence of the gRNA that hybridizes to the genomic region of interest, while the gRNA includes other domains, including a domain that interacts with the disarmed CRISPR effector. The recognition site of a synthetic transcription factor based on a disarmed CRISPR effector will include a PAM motif, as the PAM sequence is required for targeted binding to any CRISPR effector, and the exact sequence depends on the type of CRISPR effector, i.e., a disarmed CRISPR effector.

[0168] Introduction of RKD2 or RKD4 gene

[0169] Nucleic acids encoding RKD2 or RKD4 and / or genome engineered components can be introduced as DNA, such as plasmid DNA, RNA, mRNA, or RNP.

[0170] The RKD2 or RKD4 gene can be co-delivered with one or more genome engineering components. As used herein, "co-delivery" or "co-delivery" and "co-introduction" or "co-introduction" are used interchangeably. For the purposes of the present invention, "co-introduction" refers to the process of delivering at least two different components into the same plant cell at the same time. Therefore, the genome engineering components and RKD2 and / or RKD4 are introduced into the same plant cell together. Co-introduction into plant cells can be performed by particle bombardment, microinjection, Agrobacterium-mediated transformation, electroporation, electrofusion, Agrobacterium infiltration or vacuum infiltration.

[0171] It is believed that the regeneration capacity of transformed cells is not as good as that of wild-type cells. Due to the presence of exogenous DNA in cells, transformed cells are susceptible to programmed cell death. The stress caused by delivery (e.g., bombardment injury) may also trigger cell death. Therefore, promoting cell division is essential for the regeneration of modified cells. In addition, the efficiency of genome engineering is largely controlled by the state of host cells. Cells that undergo rapid cell division, such as those in plant meristems, are the most suitable receptors for genome engineering. Promoting cell division is likely to increase the integration or modification of DNA during DNA replication and division, thereby improving the efficiency of genome engineering.

[0172] When the RKD2 or RKD4 polypeptide is expressed in a plant cell together with a transgene, the RKD2 or RKD4 polypeptide can increase the expression of the transgene and the polypeptide encoded by the transgene. When the RKD2 or RKD4 polypeptide is expressed in a plant cell together with a genome engineering component and a transgene, the activity of the genome engineering component can be increased. This increase may result in more efficient integration of the transgene into the genome of the plant cell.

[0173] The RKD4 polypeptide coding sequence can be from any number of plants known in the art. Such plants include, but are not limited to, corn, Arabidopsis thaliana, and common wheat. In some embodiments, the RKD4 polypeptide coding sequence is from RKD4 of common wheat. In some embodiments, the RKD4 polypeptide coding sequence is from RKD4 of Arabidopsis thaliana. In some embodiments, the RKD4 polypeptide coding sequence is from RKD4 of corn. In some embodiments, the RKD2 polypeptide coding sequence is from RKD2 of common wheat. In some embodiments, the RKD2 polypeptide coding sequence is from RKD2 of Arabidopsis thaliana. In some embodiments, the RKD2 polypeptide coding sequence is from RKD2 of corn.

[0174] For the purposes of the present invention, the "sequence identity" of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions (×100) with identical residues in the two optimally aligned sequences divided by the number of positions compared. Gaps, i.e. positions where residues are present in one sequence but not in the other sequence in the alignment, are considered to be positions with non-identical residues. The alignment of two sequences is performed by the Needleman and Wunsch algorithm (Needleman and Wunsch 1970). The above-mentioned computer-assisted sequence alignment can be conveniently performed using standard software programs, such as the program NEEDLE implemented in the European Molecular Biology Open Software Suite (EMBOSS), such as version 6.3.1.2 (Trends in Genetics 16 (6), 276 (2000)), with default parameters: for example, protein matrix = EBLOSUM62, gapopen = 10.0 and gapextend = 0.5.

[0175] As used herein, the term "hybridization" refers to the formation of a hybrid between two nucleic acid molecules by base pairing of complementary nucleotides. The term "hybridization under stringent conditions" refers to hybridization under specific conditions. An example of such conditions includes conditions under which substantially complementary chains, i.e., chains consisting of nucleotide sequences having at least 80% complementarity, hybridize with a specified chain, while chains with poor complementarity do not hybridize. Or, such conditions refer to specific hybridization conditions of sodium salt concentration, temperature, and washing conditions. As an example, highly stringent conditions include incubation at 42°C, 50% formamide, 5×SSC (150mMNaCl, 15mM trisodium citrate), 50mM sodium phosphate, 5×Denhardt solution, 10×dextran sulfate, 20mg / ml sheared salmon sperm DNA, and washing at about 65°C in 0.2×SSC (SSC stands for 0.15M sodium chloride and 0.015M trisodium citrate buffer). Alternatively, highly stringent conditions may mean hybridization at 68° C. in 0.25 M sodium phosphate, pH 7.2, 7% SDDS, 1 mM EDTA and 1% BSA for 16 hours, and washing twice with 2×SSC and 0.1% SDDS at 68° C. In addition, highly stringent hybridization conditions are, for example, hybridization at 65° C. in 4×SSC, followed by multiple washes at 65° C. in 0.1×SSC for a total of about 1 hour, or hybridization at 68° C. in 0.25 M sodium phosphate, pH 7.2, 7% SDS, 1 mM EDTA and 1% BSA for 16 hours, followed by washing twice with 2×SSC and 0.1% SDS at 68° C.

[0176] Chemicals that regulate epigenetics

[0177] Chemical substances that regulate epigenetic, such as protein deacetylase inhibitors (ii.1), can be co-introduced with genome engineering components. Exemplary epigenetic regulatory chemicals used according to the present invention include, but are not limited to, histone deacetylase inhibitors (HDACi), such as trichostatin A (TSA) and DNA methyltransferase inhibitors.

[0178] It is generally believed that the co-delivered epigenetic regulatory chemicals (ii.1) (especially HDACi) relax the plant chromatin structure, promote the accessibility of DNA to the genome engineering components in the bombarded cells, and thus promote the efficiency of genome engineering (i.e., transformation and genome editing). Without wishing to be bound by theory, the basic structural and functional unit of genetic material is the nucleosome, in which negatively charged DNA is wrapped around the positively charged histone octamer and associated connecting histones. The nucleosomal unit is further folded and assembled into chromatin (Andrews, AJ, and Luger, K. (2011). Nucleosome structure (s) and stability: Variations on a theme. Annu. Rev. Biophys. 40: 99-117.). The accessibility of DNA depends largely on the compactness of nucleosomes and chromatin. Chromatin remodeling enzymes dynamically modify lysine or other amino acids in histones, resulting in changes in their charge and interactions with DNA and other proteins, and thus causing chromatin to fold or unfold (Bannister AJ, Kouzarides T. (2011) Regulation of chromatin by histone modifications. Cell Res 21: 381-95.). By adding or removing acetyl groups, acetylation and deacetylation of lysine residues in histones are generally involved in the reversible regulation of eukaryotic chromatin structure and mediate the regulation of chromatin accessibility and gene expression. Histone deacetylase (HDAC) is an enzyme that removes acetyl groups from lysine residues on the N-terminal tail of histones to make histones more positively charged, thereby allowing histones to wrap DNA more tightly. Inhibiting HDAC may help unfold chromatin and make DNA more accessible.

[0179] Chromatin remodeling and other epigenetic modifications undoubtedly play an important role in regulating cell totipotency and regeneration (Zhang, H., and Ogas, J. (2009). An epigenetic perspective on developmental regulation of seed genes. Mol. Plant 2: 610-627.). Inhibition of histone deacetylase (HDAC) activity has been shown to be associated with plant regeneration and microspore embryo formation (Miguel, C., and Marum, L., 2011. Anepigenetic view of plant cells cultured in vitro: somaclonal variation and beyond. J. Exp. Bot. 62: 3713-3725., Li Hui et al. (2014) The Histone Deacetylase Inhibitor Trichostatin A Promotes Totipotency in the Male Gametophyte Plant Cell, 26: 195-209.). Inhibition of HDAC activity or downstream HDAC-mediated pathways plays a major role in initiating stress-induced haploid embryo formation. One such HDACi is trichostatin A (TSA). Studies have shown that TSA induces a large number of embryonic cell proliferation in the male gametophyte of Brassica napus (B. napus). TSA treatment leads to a high frequency of sporophytic cell divisions in cultured microspores and pollen.

[0180] In the presence of one or more epigenetic regulatory chemicals (e.g., protein deacetylase inhibitors, especially HDACi), a variety of methods can be used to further improve genome engineering efficiency. Such HDACi can be trichostatin A (TSA), N-hydroxy-7-(4-dimethylaminobenzoyl)-aminoheptylamide (M344), suberoylanilide hydroxamic acid (SAHA), etc. These HDACis are selected from hydroxamic acid-based chemicals targeting zinc-dependent HDACs.

[0181] Plant hormones

[0182] In various embodiments, one or more plant hormones, such as auxins and cytokinins, such as 2,4-D, 6-benzylaminopurine (6-BA) and zeatin, are co-delivered with one or more of the nucleic acids encoding RKD2 or RKD4, genomic engineering components and transgenes.

[0183] The ability of plant somatic cells to resume cell division and regenerate into complete plants in in vitro culture through somatic embryogenesis or organogenesis is largely dependent on plant hormones such as auxins and cytokinins.

[0184] One of the auxins is 2,4-dichlorophenoxyacetic acid (2,4-D), which is almost indispensable for somatic embryo formation and cell regeneration in monocots such as corn and wheat. Meanwhile, cytokinins such as 6-benzylaminopurine (6-BA) or Zeatin are essential for plant organogenesis and the initiation and development of shoot meristems. Methods for improving the efficiency of genome engineering may include co-delivering one or more plant hormones (2,4-D, 6-BA, Zeatin, etc.) with genome engineering components.

[0185] The genome engineering components and at least one epigenetic regulatory chemical and a plant hormone can be co-introduced into a plant cell.

[0186] As used herein, "co-delivery" or "co-delivery" and "co-introduction" or "co-introduction" are used interchangeably. For the purposes of the present invention, "co-introduction" refers to the process of delivering at least two different components into the same plant cell at the same time. Thus, the genome engineering component and at least one of the epigenetic regulatory chemical and the plant hormone can be introduced into the same plant cell together.

[0187] Co-introduction into plant cells can be by particle bombardment, microinjection, Agrobacterium-mediated transformation, electroporation, Agrobacterium infiltration or vacuum infiltration. According to the present invention, physical delivery-based methods such as particle bombardment, microinjection, electroporation, nanoparticles and cell penetrating peptides (CPP) are particularly preferred for co-introduction of nucleic acids encoding RKD2 or RKD4, genome engineering components and / or transgenes. Co-introduction by particle bombardment is particularly preferred.

[0188] Plant cells regenerate into whole plants

[0189] According to another aspect of the present invention, the genetically modified plant cells can be regenerated into complete (fertile) plants. Therefore, in a preferred aspect of the present invention, the step of regenerating plants is performed after the genetic modification of the plant cells. Accordingly, the present invention provides a method for producing a genetically modified plant, comprising the following steps:

[0190] a) genetically modifying a plant cell according to any of the methods for genetic modification in a plant cell as described above, and

[0191] b) regenerating a plant from the modified plant cell of step a).

[0192] Single or multiple cells proliferate and develop into tissues, organs, and ultimately complete plants. In some embodiments, the resulting plant does not contain any genome engineering components, nucleic acids encoding RKD2 or RKD4 introduced or co-introduced in step a). Step b) of regenerating the plant may, for example, include culturing the genetically modified plant cells from step a) on a regeneration medium.

[0193] By introducing any of the nucleic acids, recombinant genes and DNA constructs described herein encoding RKD2 or RKD4 into plant cells, the efficiency of plant regeneration or the efficiency of increasing the regeneration capacity of plant cells can be improved.

[0194] Production of genetically modified plants

[0195] The present invention also provides a genetically modified plant obtained or obtainable by the above method for producing a genetically modified plant or a progeny plant thereof.The genetically modified plant may comprise any genetically modified plant cell described herein.

[0196] In various embodiments, the plants produced do not contain any genome engineered components or nucleic acids encoding RKD2 or RKD4 introduced or co-introduced into the plant cells for production thereof.

[0197] The present invention also provides plants or seeds that are not derived from the above-mentioned genetically modified cells by conventional selection. As used herein, "conventional selection" refers to any process of selecting and purifying transformed cells from wild-type cells by using integrated selection markers, such as antibiotics (such as kanamycin (kanamycin), hygromycin (hygromycin)) or herbicides (such as phosphine, glyphosate) resistance genes. If there is no conventional selection, this plant or seed may not integrate any genome engineering components, thus resulting in genetically modified plants that do not contain transgenics.

[0198] Genetic modification can be a permanent, heritable change in the genome of a plant cell. Plant tissue culture and genome engineering can be performed using currently available methods, including microprojectile bombardment, Agrobacterium transformation, electroporation, and the like. Transformation and transgenic expression can be monitored using visible reporter genes, for example, the red fluorescent tDTomato gene (tDT), which encodes an exceptionally bright red fluorescent protein with a maximum excitation at 554 nm and a maximum emission at 581 nm. Genome editing efficiency can be analyzed by methods such as next-generation sequencing (NGS), qPCR, labeled capillary electrophoresis analysis, and Droplet DigitalPCR. Sanger sequencing further confirmed site-specific modification.

[0199] Cultivation steps

[0200] Plant cells into which nucleic acids encoding RKD2 or RKD4, genome engineering components and / or transgenes have been introduced or co-introduced can be cultured under conditions that allow genetic modification of the genome of the plant cells through the activity of the genome engineering components in the presence of one or more nucleic acids encoding RKD2 or RKD4 and one or more transgenes.

[0201] As used herein, "genetic modification of a genome" includes any type of manipulation so that endogenous nucleotides are altered to include mutations, such as deletions, insertions, conversions, transversions, or combinations thereof. For example, an endogenous coding region can be deleted. Such mutations may result in a polypeptide having an amino acid sequence that is different from the amino acid sequence encoded by the endogenous polynucleotide. Another example of a genetic modification is a change in a regulatory sequence such as a promoter, resulting in an increase or decrease in the expression of an operably linked endogenous coding region.

[0202] Conditions that are "suitable" for genetic modification of the plant genome (e.g., cleavage of a polynucleotide), or "suitable" conditions are conditions that do not prevent such an event from occurring. Thus, these conditions allow, enhance, promote and / or favor the event. Depending on the respective genome engineering component (i), these conditions may vary.

[0203] In the method of the present invention, preferably the plant cell is transiently transformed with genome engineering component (i) and at least one compound (ii). "Transient transformation" used herein refers to transferring foreign substances [i.e. nucleic acid fragments, proteins, ribonucleoproteins (RNPs), etc.] into host cells, thereby causing gene expression and / or activity without integrating and stabilizing genetic foreign substances. Therefore, the genome engineering component (i) is transiently active and / or transiently present in plant cells. The genome engineering component is not permanently incorporated into the cell genome, but provides a temporary effect that causes genome modification. For example, the transient activity and / or transient presence of the genome engineering component in the plant cell can lead to one or more double-strand breaks in the plant cell genome, one or more single-strand breaks in the plant cell genome, one or more base editing events in the plant cell genome, or one or more DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ubiquitination, histone ribosylation or histone citrullination in the plant cell genome.

[0204] Following the introduction of one or more double-strand breaks or one or more single-strand breaks, the breaks are repaired by non-homologous end joining (NHEJ) and / or homology-directed repair via homologous recombination mechanisms (HDR).

[0205] The modification produced in the genome of the plant cell can be selected, for example, from: the insertion of a transgene, preferably an expression cassette comprising a transgene of interest, the substitution of at least one nucleotide, the deletion of at least one nucleotide, the insertion of at least one nucleotide, changes in DNA methylation, changes in histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone benzoylation, histone ribosylation or histone citrullination, or any combination thereof. According to a particularly preferred aspect of the present invention, no exogenous genetic material associated with the gene editing machine / system used is stably integrated into the genome of the plant cell.

[0206] Genetic modifications can be permanent, heritable changes in the genome of plant cells.

[0207] The gist of the present invention also lies in the plant cells obtained or obtainable by the above method. Therefore, one embodiment of the present invention is a genetically modified plant cell obtained or obtainable by the above method for genetic modification in plant cells. Compared with the original plant cell, the genetic modification in these plant cells may for example include: the insertion of a transgene, preferably the insertion of an expression cassette containing the target transgene, the replacement of at least one nucleotide, the deletion of at least one nucleotide, the insertion of at least one nucleotide, the change of DNA methylation, the change of histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone benzoylation, histone ribosylation or histone citrullination, or any combination thereof. Preferably, the genetically modified plant cell does not contain any exogenous genetic material stably integrated into the plant cell genome.

[0208] The genetically modified plant cell can be a part of the whole plant, or a part of the part. Therefore, the present invention also relates to a plant or plant part comprising the genetically modified plant cell.

[0209] According to another aspect of the present invention, the plant cells of genetic modification can be regenerated into complete (fertile) plants. Therefore, in a preferred aspect of the present invention, the step of regenerating plants is carried out after the plant cells are genetically modified. Accordingly, the present invention provides a method for producing a genetically modified plant, comprising the following steps:

[0210] a) genetically modifying a plant cell according to the above method for genetic modification in a plant cell, and

[0211] b) regenerating a plant from the modified plant cell of step a).

[0212] Step b) of regenerating the plant may for example comprise culturing the genetically modified plant cells from step a) on a regeneration medium.

[0213] Regeneration techniques rely on manipulation of certain plant hormones in tissue culture growth media, and sometimes rely on biocides and / or herbicide markers that can be introduced. Regeneration can be obtained from plant somatic cells, callus cells or embryonic cells and protoplasts from different explants, such as callus, immature or mature embryos, leaves, branches, roots, flowers, microspores, embryonic tissue, meristems, organs or any part thereof. Such regeneration techniques are generally described in Klee (1987) Ann. Rev. of Plant Phys. 38: 467-486. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, Macmillan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. To obtain a complete plant from the transformed or gene-edited cells, the cells can be grown in a culture medium containing a range of nutrients and hormones under controlled environmental conditions, a process known as tissue culture. Once a whole plant is generated and produces seeds, evaluation of the progeny begins.

[0214] The present invention also provides a genetically modified plant obtained or obtainable by the above-mentioned method for producing a genetically modified plant or a progeny plant thereof.

[0215] Another subject matter of the present invention is plant cells or seeds derived from the above-mentioned genetically modified plants.

[0216] Another main point of the present invention is that without the selection based on marker genes, the plant, plant cell or seed derived from the above-mentioned genetically modified cell. As used herein, "selection based on marker genes" refers to selecting, identifying and / or purifying modified cells from wild-type cells by using integrated selection markers (genes), such as antibiotic resistance genes (such as kanamycin resistance genes, hygromycin resistance genes) or herbicide resistance genes (such as phosphine resistance genes, glyphosate resistance genes), especially any process of cells transformed, gene edited or base edited. If this selection is not performed, this plant, plant cell or seed may not integrate any genome engineering components, thereby possibly producing (i) genetically modified plants without transgenics or (ii) modified plants with only the transgenics of interest integrated.

[0217] Unless otherwise indicated in the examples, all recombinant DNA techniques were performed according to standard protocols, such as those described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY and Ausubel et al. (1994) Current Protocols in Molecular Biology, Volumes 1 and 2 of Current Protocols, USA. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by RDD Ray, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK. Other references to standard molecular biology techniques include Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; Brown (1998) Molecular Biology LabFax, Second Edition, Volumes I and II of Academic Press (UK). Standard materials and methods for polymerase chain reaction can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCR-Basics: From Background to Bench, First Edition, Springer Verlag, Germany.

[0218] sequence

[0219]

[0220]

[0221] All patents, patent applications, and publications or disclosures (including publications on the Internet) mentioned or cited herein are incorporated by reference in their entirety.

[0222] Example

[0223] The present invention is further illustrated by the following examples. However, it should be understood that the present invention is not limited to such examples. The use of these and other examples anywhere in the specification is illustrative only and does not limit the scope and meaning of the present invention or any exemplary term in any way. Likewise, the present invention is not limited to any particular preferred embodiment described herein. In fact, many modifications and variations of the present invention are obvious to those skilled in the art who read this specification, and such changes can be made without departing from the spirit or scope of the present invention. Therefore, the present invention is limited only by the terms of the appended claims and the full scope of the equivalents of these claims.

[0224] Example 1. Preparation of pZY ZZ-TOP, a plasmid containing a bidirectional promoter pOp6 operably linked to a developmental gene and a GUS reporter gene and a dexamethasone-inducible transcription factor that activates pOp6

[0225] A plasmid (pZY ZZ-TOP) was generated, which carries a chemical (dexamethasone, Dex) inducible promoter system (Zuo, J., & Chua, NH (2000). Chemical-inducible systems for regulated expression of plant genes. Current Opinion in Biotechnology, 11 (2), 146-151.). The map of the plasmid is shown in Figure 1 The plasmid contains the pOp6 promoter (SEQ ID NO: 15). The pOp6 promoter is bidirectional and upon exposure to dexamethasone (Sigma-Aldrich. Product # D4902-500MG), both developmental genes and the GUS gene are expressed ( Figure 1 ). The plasmid also contains the gene LhGR (DNA (SEQ ID NO: 16 and amino acids (SEQ ID NO: 17)). LhGR is constitutively expressed (eg, pUbil promoter + introns). LhGR is a transcription factor that enters the nucleus only in the presence of dexamethasone. Once in the nucleus, LhGR activates pOp6. Thus, pZY ZZ-TOP provides dexamethasone-inducible expression of GUS and developmental genes.

[0226] The expression system was used for stable transformation. GUS staining was used to identify leaky expression without chemical induction. In all subsequent examples, only plants that did not express the GUS gene without chemical induction were considered. Plants that expressed GUS without chemical induction were not used.

[0227] Example 2. Evaluation of the ability of transcription factors to induce plant regeneration via somatic embryogenesis

[0228] In another example, five different transcription factors were tested for their efficiency in inducing plant regeneration via somatic embryogenesis. The coding sequences of AtLEC2 (SEQ ID NO: 6), AtWUS (SEQ ID NO: 8), AtBBM (SEQ ID NO: 10), AtAGL15 (SEQ ID NO: 12), and AtRKD4 (SEQ ID NO: 1) were cloned into the inducible promoter system pZY ZZ-TOP of Example 1. Dexamethasone can induce the expression of each of AtLEC2, AtWUS, AtBBM, AtAGL15, and AtRKD4.

[0229] These dexamethasone-inducible binary constructs based on the pOp6 / LhGR transactivation system were stably transformed into Arabidopsis Col-0 by the floral dip method (Craft et al. (2005). New pOp / LhG4 vectors for stringent glucocorticoid-dependent transgene expression in Arabidopsis. The Plant Journal, 41 (6), 899-918.). Arabidopsis Col-0 was grown under controlled environmental conditions (16 hours light / 8 hours dark, 22°C) on plates containing 50% MS medium supplemented with 1% sucrose. Leaky expression in 40 independent transgenic lines was detected by GUS staining.

[0230] Non-leaky transformants were induced 5-7 days after germination. Chemical induction of gene expression was performed by growing on plates containing 20 μM dexamethasone for 7 days, and then the plants were transferred to inducer-free medium. The frequency of somatic embryos was determined by microscopic imaging after staining with Sudan Red 7B.

[0231] The results are shown in Figure 2 Middle. RKD4 had the highest efficiency in forming embryonic structures after exposure to dexamethasone.

[0232] Example 3. RKD4 expressed in the pOp6 / LHGR transactivation system has the ability to promote dexamethasone-inducible somatic embryogenesis

[0233] The function of the inducible promoter system controlling RKD4 was tested in Arabidopsis. Arabidopsis seeds were germinated until primary roots were formed. The plantlets were then transferred to plates containing Dex (as described in Example 2). The plantlets were imaged and the data are shown in Figure 2. Figure 3 As shown. In the root ( Figure 3, left), leaf( Figure 3 , medium) or both ( Figure 3 Somatic embryo formation was observed in the right panel (right panel). Chlorophyll loss was also observed. After the somatic embryo structure was moved to a DEX-free medium, the somatic embryo structure began to turn green again. These data indicate that RKD4 expression can induce somatic embryo formation in the absence of hormones.

[0234] Example 4. AtRKD4 expressed in the pOp6 / LhGR transactivation system can induce somatic embryogenesis in horticulturally relevant species

[0235] Horticulturally relevant species of Phalaenopsis were transformed using Agrobacterium tumefaciens GV3101 and a dexamethasone-inducible AtRKD4 binary construct as described in Example 1. The bases of leaves of stably transformed plants were incubated for two days in plates containing 50% MS medium containing 20 μM dexamethasone and then transferred to medium without dexamethasone. The presence of somatic embryos was determined at 0, 7, and 14 days after transplantation, and the data are shown in Table 1. Figure 4 shown.

[0236] Example 5. AtRKD4 expressed in the pOp6 / LhGR transactivation system can induce somatic embryogenesis in horticulturally relevant species of common wheat

[0237] The effect of inducible RKD4 expression in agriculturally relevant species of common wheat was determined. Immature wheat embryos were transformed with Agrobacterium EHA105 carrying a binary construct of estradiol-inducible TaRKD2 (SEQ ID NO: 3) (Valdivia et al., 2013). Transformed embryos were isolated from seeds 12 days after pollination and cultured in 50% MS medium containing 30 μM β-estradiol for 7 days. Induction of embryonic structures (callus formation; Figure 5 , left panel). The embryonic structures were transferred to a medium without induction agents to induce somatic embryos. Chlorosis was observed ( Figure 5 , middle), and then new leaves were observed ( Figure 5 , right panel). The examples demonstrate the effects of RKD4 expression in agriculturally relevant species.

[0238] Example 6. Expression of TaRKD2 in barley immature embryos can induce somatic embryo formation

[0239] In another example, barley immature embryos were transformed with Agrobacterium EHA105 carrying an estradiol-inducible TaRKD2 (SEQ ID NO: 3) binary construct (Valdivia et al., 2013). Transformed barley immature embryos were isolated from seeds and grown in 50% MS medium containing 30 μM β-estradiol for 7 days ( Figure 6 , upper left panel), and then transferred to induction medium without inducer to induce somatic embryos. After removing the embryonic structures from the induction medium, shoot and root development can be observed ( Figure 6 , upper right). When the structures were then moved under light, the tissue began to turn green ( Figure 6 , lower left). About 60 days after the initial immature embryo separation, the seedlings can form ( Figure 6 , lower right).

[0240] Example 7. Co-expression of RKD2 and RKD4 in corn

[0241] The benefit of expressing RKD4 (from Arabidopsis thaliana) and RKD2 (from wheat (SEQ ID NO: 4)) can be demonstrated in maize callus. Both sequences are cloned into the construct described in Example 1 and co-bombarded with the red fluorescent tdTomato gene (DNA: SEQ ID NO: 18; amino acids: SEQ ID NO: 19) in the presence of a constitutive promoter, such as the double 35S promoter (SEQ ID NO: 21) and the ubiquitin intron (SEQ ID NO: 20). After exposure to dexamethasone, the induction of embryogenesis is measured by the formation of numerous callus structures and stable tdTomato integration. Callus structures showing red fluorescence can be observed after 33 days ( Figure 7 , AtRKD4 on the left and TaRKD2 on the right). The constructs were derived from a single cell knocked into with both constructs, resulting in embryo formation and expression of a red fluorescent marker.

[0242] ***

[0243] The scope of the present invention is not limited by the specific embodiments described herein. In fact, various modifications of the present invention, in addition to those described herein, will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims. It should also be understood that all values ​​are approximate and are provided for description.

[0244] Throughout this application, patents, patent applications, publications, product descriptions, and protocols are cited, the disclosures of which are incorporated herein by reference in their entirety for all purposes. Sequence Listing <110> University of Warwick <120> I have a strong sense of humor <130> KWS0304US-P <160> 23 <170> PatentIn version 3.5 <210> 1 <211> 771 <212> DNA <213> Artificial Sequence <220> <223> cDNA of AtRKD4 encoding SEQ ID NO: 2 <400> 1 atgagttcgt caaaacattc ctctgttttt aactattctg ctctgtttct atcactgttt 60 cttcaacaaa tggatcagaa ctcttcat catctcgatt ctccaaaaat cgaaaacgag 120 tatgaaccag attcgtta cgacatgtta gataagttgc ctccgcttga ttctctccta 180 gatatggaag atttgaaacc aaatgcaggg ttgcactttc agttccatta caatagcttt 240 gaagatttct tcgaaaacat tgaagtggat aacacaattc catctgatat tcacttgttg 300 acacaagagc cctacttctc aagtgactcc tcttcctctt caccattggc tatccaaaac 360 gacggtctca tttccaacgt gaaagttgaa aaggtaacag ttaagaagaa gaggaacctt 420 aagaaaaaga ggcaagacaa attggagatg tctgagatca aacaattttt cgataggccg 480 atcatgaaag cggctaaaga actgaacgtg ggactcactg tgttgaagaa gcgatgcagg 540 gattaggaa tttaccggtg gcctcaccgg aagctcaaga gtctaactc tcttataaag 600 aatctcaaga atgttggaat ggaagaggaa gtgagaact tggaggaca taggttctt 660 attgaacaag aacctgatgc agaaccagt gatgaacca agaagctaag gcaagcttgt 720 ttcaaagcca attaagag aagaaaatca cttggtgatg attattattg a 771 <210> 2 <211> 256 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Ser Ser Ser Lys His Ser Val Phe Asn Tyr Ser Ala Leu Phe 1 5 10 15 Leu Ser Leu Phe Leu Gln Gln Met Asp Gln Asn Ser Leu His His Leu 20 25 30 Asp Ser Pro Lys Ile Glu Asn Glu Tyr Glu Pro Asp Ser Leu Tyr Asp 35 40 45 Met Leu Asp Lys Leu Pro Leu Pro Leu Asp Ser Leu Asp Met Glu Asp 50 55 60 Leu Lys Pro Asn Ala Gly Leu His Phe Gln Phe His Tyr Asn Ser Phe 65 70 75 80 Glu Asp Phe Phe Glu Asn Ile Glu Val Asp Asn Thr Ile Pro Ser Asp 85 90 95 Ile His Leu Leu Thr Gln Glu Pro Tyr Phe Ser Ser Asp Ser Ser Ser 100 105 110 Ser Ser Pro Leu Ala Ile Gln Asn Asp Gly Leu Ile Ser Asn Val Lys 115 120 125 Val Glu Lys Val Thr Val Lys Lys Lys Arg Asn Leu Lys Lys Lys Arg 130 135 140 Gln Asp Lys Leu Glu Met Ser Glu Ile Lys Gln Phe Phe Asp Arg Pro 145 150 155 160 Ile Met Lys Ala Ala Lys Glu Leu Asn Val Gly Leu Thr Val Leu Lys 165 170 175 Lys Arg Cys Arg Glu Leu Gly Ile Tyr Arg Trp Pro His Arg Lys Leu 180 185 190 Lys Ser Leu Asn Ser Leu Ile Lys Asn Leu Lys Asn Val Gly Met Glu 195 200 205 Glu Glu Val Lys Asn Leu Glu Glu His Arg Phe Leu Ile Glu Gln Glu 210 215 220 Pro Asp Ala Glu Leu Ser Asp Gly Thr Lys Lys Leu Arg Gln Ala Cys 225 230 235 240 Phe Lys Ala Asn Tyr Lys Arg Arg Lys Ser Leu Gly Asp Asp Tyr Tyr 245 250 255 <210> 3 <211> 1104 <212> DNA <213> Artificial Sequence <220> <223> cDNA of TaRKD2 genotype 1 encoding SEQ ID NO: 5 <400> 3 atggagatgc aacaacaata cttcgggggg gacggcgatg cggactggtt ccatcaactc 60 gcattgcttc ccccacttcc aatctcatcg tctctccccc cactcccgat gtcagagggc 120 tcatgtctcc ctatggcagc agcagctgca gctgcactcc cccttggcga ttgctcgagc 180 gccctcatga tacgccctga ggaacagatg tcttgccttc caatgaaccc ctctccagcg 240 gtcgtcgacg atgtctactc ttcctacgca ccgaacaatg tcgacgtgtt gccgccattc 300 ccggcaggac ttgacgacgc tctgttgatg gagtcttttt ctgacatcga cctcgaggag 360 tttgctgacg catttggcca caagatcaag acagaacccc tcgacgatgc catggtcccc 420 gcggaccacg acttcgcggc tcaagcccaa caggcctgcc ctgtggtcat catgaatcag 480 caacaactca acgcacccag agacgtgcgc ctgctcattg acccggatga tgatgacagc 540 accgtggtgg ccgggggcta tgaagctgca gcggtggggt gcgccgagca gaaacaggtc 600 aggccagcac cacgtagggt gagaaagagc tcaggcggcg caagaccagc cgcggggagga 660 aagtccctcg atcacatcgg attcgaggaa ctcaggacct attctatat gccaatcacc 720 aaggcagcga gggaaatgaa cgtggggctg acagtcctga agaagagatg ccgggaactg 780 ggggtggcgc gctggccaca cagaaagatg aagtctctga gaagcctgat cctcaacatt 840 caggagatgg ggaagggcgc aacatctccc gcagccgtgc agggggaact tgaagcgctt 900 gagaggtatt gcgccattat ggaggagaac ccggctatag agctcaccga gcaaacgaag 960 aagctcaggc aggcttgttt caaagagaat tataagcggc gtagagccgc cgcttctgtt 1020 aatcttctcg atcactgcta taacgatctg gcatctcatg agcagcaaat gcctctccca 1080 caaatgggat tctttggatt tag 1104 <210> 4 <211> 1104 <212> DNA <213> Artificial Sequence <220> <223> cDNA of TaRKD2 genotype 2 encoding SEQ ID NO: 5 <400> 4 atggagatgc aacagcaata cttcggcggt gatggcgatg ctgactggtt ccaccagctc 60 gccttgctcc cgcctttgcc gatctcttcg tctctgccgc ctctccccat gagcgagggc 120 agctgcttac ccatggccgc cgccgccgcg gcggcgcttc ctcttgggga ttgctcatca 180 gctctcatga ttaggccgga agaacagatg agctgcctgc cgatgaaccc ttcgccagct 240 gttgtcgatg atgtgtacag cagctacgcc cccaacaatg tcgacgtcct cccgccgttt 300 cctgcaggtc tcgacgacgc gctgctcatg gagtccttca gcgatatcga cctggaggag 360 ttcgccgacg ccttcggcca caagattaag accgagcctc tcgacgacgc tatggtgccg 420 gcggatcacg atttcgcggc gcaagcgcaa caggcgtgcc cagtggtgat catgaaccag 480 cagcagctga atgcaccacg cgacgtgcgc ctgctcatag atcccgacga cgatgactca 540 actgtcgtcg ccgggggcta tgaggctgcg gccgttgggt gcgctgagca gaagcaggtg 600 aggccggcgc cacgtcgtgt gcgcaagagc agcggtgggg cacgcccagc cgccggtggg 660 aaaagcctcg atcacatagg gtttgaggag ctacgtacgt atttctacat gcctatcacc 720 aaggcggcgc gggagatgaa cgtggtctc accgtgctca agaagcgctg ccgagagctc 780 ggggcgccc gctggcctca ccggaagatg aagagcctca ggtcactcat cctcaacatc 840 caggagatgg ggaagggcgc aacgtcgccg gcggctgtgc aaggggaact agaggcgctt 900 gagaggtatt gcgccataat ggaggagaac ccggcgatcg agctgactga gcagaccaag 960 aagctgcggc aggcctgctt taaggagaac tacaagagga ggagagcggc ggcctccgtc 1020 aacttgctcg accattgcta caacgacttg gccagtcatg agcagcagat gccattgcca 1080 cagatgggtt tctttgggtt ctaa 1104 <210> 5 <211> 367 <212> PRT <213> Triticum aestivum <400> 5 Met Glu Met Gln Gln Gln Tyr Phe Gly Gly Asp Gly Asp Ala Asp Trp 1 5 10 15 Phe His Gln Leu Ala Leu Leu Pro Pro Leu Pro Ile Ser Ser Ser Leu 20 25 30 Pro Pro Leu Pro Met Ser Glu Gly Ser Cys Leu Pro Met Ala Ala Ala 35 40 45 Ala Ala Ala Ala Leu Pro Leu Gly Asp Cys Ser Ser Ala Leu Met Ile 50 55 60 Arg Pro Glu Glu Gln Met Ser Cys Leu Pro Met Asn Pro Ser Pro Ala 65 70 75 80 Val Val Asp Asp Val Tyr Ser Ser Tyr Ala Pro Asn Asn Val Asp Val 85 90 95 Leu Pro Pro Phe Pro Ala Gly Leu Asp Asp Ala Leu Leu Met Glu Ser 100 105 110 Phe Ser Asp Ile Asp Leu Glu Glu Phe Ala Asp Ala Phe Gly His Lys 115 120 125 Ile Lys Thr Glu Pro Leu Asp Asp Ala Met Val Pro Ala Asp His Asp 130 135 140 Phe Ala Ala Gln Ala Gln Gln Ala Cys Pro Val Val Ile Met Asn Gln 145 150 155 160 Gln Gln Leu Asn Ala Pro Arg Asp Val Arg Leu Leu Ile Asp Pro Asp 165 170 175 Asp Asp Asp Ser Thr Val Val Ala Gly Gly Tyr Glu Ala Ala Ala Val 180 185 190 Gly Cys Ala Glu Gln Lys Gln Val Arg Pro Ala Pro Arg Arg Val Arg 195 200 205 Lys Ser Ser Gly Gly Ala Arg Pro Ala Ala Gly Gly Lys Ser Leu Asp 210 215 220 His Ile Gly Phe Glu Glu Leu Arg Thr Tyr Phe Tyr Met Pro Ile Thr 225 230 235 240 Lys Ala Ala Arg Glu Met Asn Val Gly Leu Thr Val Leu Lys Lys Arg 245 250 255 Cys Arg Glu Leu Gly Val Ala Arg Trp Pro His Arg Lys Met Lys Ser 260 265 270 Leu Arg Ser Leu Ile Leu Asn Ile Gln Glu Met Gly Lys Gly Ala Thr 275 280 285 Ser Pro Ala Ala Val Gln Gly Glu Leu Glu Ala Leu Glu Arg Tyr Cys 290 295 300 Ala Ile Met Glu Glu Asn Pro Ala Ile Glu Leu Thr Glu Gln Thr Lys 305 310 315 320 Lys Leu Arg Gln Ala Cys Phe Lys Glu Asn Tyr Lys Arg Arg Arg Ala 325 330 335 Ala Ala Ser Val Asn Leu Leu Asp His Cys Tyr Asn Asp Leu Ala Ser 340 345 350 His Glu Gln Gln Met Pro Leu Pro Gln Met Gly Phe Phe Gly Phe 355 360 365 <210> 6 <211> 1092 <212> DNA <213> Artificial Sequence <220> <223> cDNA of AtLEC2 encoding SEQ ID NO: 7 <400> 6 atggataact tcttaccctt tccctcttct aacgcaaact ctgtccaaga actctctatg 60 gatcctaaca acaatcgctc gcacttcaca acagcccta cttatgatca tcatcaggct 120 cagcctcatc acttcttgcc tccgttttca tacccggtgg agcagatggc ggcggtgatg 180 aatcctcagc cggtttactt atcggagtgt tatcctcaga tcccggttac gcaaaccgga 240 agtgaattcg gttctctggt tggtaatcct tgtttgtggc aagagagagg tggttttctt 300 gatccgcgta tgacgaagat ggcaaggatc aacaggaaaa acgccatgat gagatcaaga 360 aacaactcta gccctaattc tagtccaagt gagttggttg attcaaagag acagctgatg 420 atgcttaact tgaaaaataa cgtgcagatc tccgacaaga aagatagcta ccaacagtcc 480 acatttgata acaagaagct taggttttg tgtgagaagg aattgagaa cagcgatgtt 540 gggtcactcg ggaggatagt tctaccaaag agagatgcag aagcaatct tccgaagcta 600 tctgataaag aaggaatcgt tgtacagatg agagatgttt tcttatgca gtcttggtct 660 ttcaataca agttttggtc cataacaag agcagaatgt atgtcctcga gaacacagga 720 gatttgtga agcaaatgg agctgagata ggactttt taacaata cgaggacgaa 780 agcaagaatc tctacttcgc catgaatgga aattcgggaa aacaaatga aggagagaa 840 aatgagtcga gggaaggaa ccactacgaa gaggcaatgc ttgattacat accagagac 900 gagaggaag cttccattgc aatgctcatc ggaaatctaa acgatcacta tcccatccct 960 aacgatctca tggacctcac cactgacctt cagcaccatc aagccacgtc ctcatcaatg 1020 ccacctgagg atcacgcgta cgtggttca tccgatgatc aggtgagctt taacgacttt 1080 gagtggtggt ga 1092 <210> 7 <211> 363 <212> PRT <213> Arabidopsis thaliana <400> 7 Met Asp Asn Phe Leu Pro Phe Pro Ser Ser Asn Ala Asn Ser Val Gln 1 5 10 15 Glu Leu Ser Met Asp Pro Asn Asn Asn Arg Ser His Phe Thr Thr Val 20 25 30 Pro Thr Tyr Asp His His Gln Ala Gln Pro His His Phe Leu Pro Pro 35 40 45 Phe Ser Tyr Pro Val Glu Gln Met Ala Ala Val Met Asn Pro Gln Pro 50 55 60 Val Tyr Leu Ser Glu Cys Tyr Pro Gln Ile Pro Val Thr Gln Thr Gly 65 70 75 80 Ser Glu Phe Gly Ser Leu Val Gly Asn Pro Cys Leu Trp Gln Glu Arg 85 90 95 Gly Gly Phe Leu Asp Pro Arg Met Thr Lys Met Ala Arg Ile Asn Arg 100 105 110 Lys Asn Ala Met Met Arg Ser Arg Asn Asn Ser Ser Pro Asn Ser Ser 115 120 125 Pro Ser Glu Leu Val Asp Ser Lys Arg Gln Leu Met Met Leu Asn Leu 130 135 140 Lys Asn Asn Val Gln Ile Ser Asp Lys Lys Asp Ser Tyr Gln Gln Ser 145 150 155 160 Thr Phe Asp Asn Lys Lys Leu Arg Val Leu Cys Glu Lys Glu Leu Lys 165 170 175 Asn Ser Asp Val Gly Ser Leu Gly Arg Ile Val Leu Pro Lys Arg Asp 180 185 190 Ala Glu Ala Asn Leu Pro Lys Leu Ser Asp Lys Glu Gly Ile Val Val 195 200 205 Gln Met Arg Asp Val Phe Ser Met Gln Ser Trp Ser Phe Lys Tyr Lys 210 215 220 Phe Trp Ser Asn Asn Lys Ser Arg Met Tyr Val Leu Glu Asn Thr Gly 225 230 235 240 Glu Phe Val Lys Gln Asn Gly Ala Glu Ile Gly Asp Phe Leu Thr Ile 245 250 255 Tyr Glu Asp Glu Ser Lys Asn Leu Tyr Phe Ala Met Asn Gly Asn Ser 260 265 270 Gly Lys Gln Asn Glu Gly Arg Glu Asn Glu Ser Arg Glu Arg Asn His 275 280 285 Tyr Glu Glu Ala Met Leu Asp Tyr Ile Pro Arg Asp Glu Glu Glu Ala 290 295 300 Ser Ile Ala Met Leu Ile Gly Asn Leu Asn Asp His Tyr Pro Ile Pro 305 310 315 320 Asn Asp Leu Meet Asp Leu Thr Asp Leu Gln His His Gln Ala Thr 325 330 335 Ser Ser Ser Met Pro Pro Glu Asp His Ala Tyr Val Gly Ser Ser Asp 340 345 350 Asp Gln Val Ser Phe Asp Phe Glu Trp Trp 355,360 <210> 8 <211> 879 <212> DNA <213> Artificial Sequence <220> <223> cDNA of AtWUS encoding SEQ ID NO: 9 <400> 8 atggagccgc cacagcatca gcatcatcat catcaagccg accaagaag cggcacacac 60 aacaacaa agtccggctc tggtggttac acgtgtcgcc agaccagcac gaggtggaca 120 ccgacgacgg agcaaatcaa aatcctcaa gaactttact acaaatgc aatccggtca 180 ccaacagccg atcagatcca gaagattcact gcaaggctga gagagttcgg aagattgag 240 ggcaagaacg tctttactg gttccagaac cataaggctc gtgagcgtca gagaagaga 300 ttcaacggaa caaacatgac cacacatct tcatcaccca actcggttat gatggcggct 360 aacgatcatt atcatcctct acttcaccat catcacggtg ttcccatgca gagacctgct 420 aattccgtca acgttaaact taaccaagac catcatctct atcatcataa caagccatat 480 cccagcttca ataacgggaa tttaaatcat gcaagctcag gtactgaatg tggtgttgtt 540 aatgcttcta atggctacat gagtagccat gtctatggat ctatggaaca agactgttct 600 atgaattaca acaacgtagg tggaggatgg gcaaacatgg atcatcatta ctcatctgca 660 ccttacaact tcttcgatag agcaaagcct ctgtttggtc tagaaggtca tcaagaagaa 720 gaagaatgtg gtggcgatgc ttatctggaa catcgacgta cgcttcctct cttccctatg 780 cacggtgaag atcacatcaa cggtggtagt ggtgccatct ggaagtatgg ccaatcggaa 840 gttcgccctt gcgcttct tgagctacgt ctgaactag 879 <210> 9 <211> 292 <212> PRT <213> Arabidopsis thaliana <400> 9 Met Glu Pro Pro Gln His Gln His His His Gln Ala Asp Gln Glu 1 5 10 15 Ser Gly Asn Asn Asn Asn Asn Lys Ser Gly Ser Gly Gly Tyr Thr Cys 20 25 30 Arg Gln Thr Ser Thr Arg Trp Thr Pro Thr Thr Glu Gln Ile Lys Ile 35 40 45 Leu Lys Glu Leu Tyr Tyr Asn Asn Ala Ile Arg Ser Pro Thr Ala Asp 50 55 60 Gln Ile Gln Lys Ile Thr Ala Arg Leu Arg Gln Phe Gly Lys Ile Glu 65 70 75 80 Gly Lys Asn Val Phe Tyr Trp Phe Gln Asn His Lys Ala Arg Glu Arg 85 90 95 Gln Lys Lys Arg Phe Asn Gly Thr Asn Met Thr Thr Pro Ser Ser Ser 100 105 110 Pro Asn Ser Val Met Met Ala Ala Asn Asp His Tyr His Pro Leu Leu 115 120 125 His His His His Gly Val Pro Met Gln Arg Pro Ala Asn Ser Val Asn 130 135 140 Val Lys Leu Asn Gln Asp His His Leu Tyr His His Asn Lys Pro Tyr 145 150 155 160 Pro Ser Phe Asn Asn Gly Asn Leu Asn His Ala Ser Ser Gly Thr Glu 165 170 175 Cys Gly Val Val Asn Ala Ser Asn Gly Tyr Met Ser Ser His Val Tyr 180 185 190 Gly Ser Met Glu Gln Asp Cys Ser Met Asn Tyr Asn Asn Val Gly Gly 195 200 205 Gly Trp Ala Asn Met Asp His His Tyr Ser Ser Ala Pro Tyr Asn Phe 210 215 220 Phe Asp Arg Ala Lys Pro Leu Phe Gly Leu Glu Gly His Gln Glu Glu 225 230 235 240 Glu Glu Cys Gly Gly Asp Ala Tyr Leu Glu His Arg Arg Thr Leu Pro 245 250 255 Leu Phe Pro Met His Gly Glu Asp His Ile Asn Gly Gly Ser Gly Ala 260 265 270 Ile Trp Lys Tyr Gly Gln Ser Glu Val Arg Pro Cys Ala Ser Leu Glu 275 280 285 Leu Arg Leu Asn 290 <210> 10 <211> 1755 <212> DNA <213> Artificial Sequence <220> <223> cDNA of AtBBM encoding SEQ ID NO: 11 <400> 10 atgaactcga tgaataactg gttaggcttc tctctctctc ctcatgatca aaatcatcac 60 cgtacggatg ttgactcctc caccaccaga accgccgtag atgttgccgg agggtactgt tttgatctgg ccgctccctc cgatgaatct tctgccgttc aaacatcttt tctttctcct 240. ttcggtgtca ccctcgaagc ttcggtgtca ccctcgaagc ttcggtgtca ccctcgaagc atcaatggtg gtgcatgcaa taacattaac aatacgaac aaaatggacc aaagcttgag aatttcctcg gccgcaccac cacgatttac aataccaacg agaccgttgt agatggaaat ggcgattgtg gaggagga cggtggtggt ggcggctcac tagcctttc gatgataaaa 420 acatggctga gtaatcattc ggttgctat gctaatcatc aagacaatgg taacggtgca cgaggcttgt ccctctctat gaattcatct actagtgata gcaacaacta caacaacaat 600. 600. 600. 600. 600. 600. 600. 600. 600. 600. 600 attgagagtt ttggacaaag gacgtctata taccgcggtg ttacaaggca tcggtggaca 660 ggtagatacg aggcacattt atgggacaat agttgcaaaa gagaaggcca gactcgcaaa 780. ggaagacaag tttatctggg aggttatgac aaagaagaaa aagcagctag ggcttacgat ttagccgcac taaagtattg gggaaccacc actacta acttcccctt gagtgaatat 840 gagaaagagg tagagagat gaagcacatg acgaggcaag agtatgttgc ctctctgcgc 900 aggaaaagta gtggttctc tcgtggtgca tcgatttac gaggagtaac aaggcatcac 960 siacatggaa gtggcaagc taggatcgga agagtcgccg gtaacaaga ccttacttg 1020 ggaacttcg gcacacagga agaggctgct gaggcttatg acatgcagc cattaattc 1080 agaggattaa gcgcagtgac taacttcgac atgacagat acatgttaa agcaatccctc 1140 gagagcccga gtctacctat tggtagttct gcgaaacgtc tcaggacgt taataatccg 1200 gttccagcta tgatgattag taataacgtt tcagagagtg caataatgt tagcggttgg 1260 caaaacactg cgtttcagca tcatcaggga atggatttga gcttattgca gcaacagcag 1320 gagaggtacg ttggttatta caatggagga aacttgtcta ccgagagtac taggttttgt 1380 ttcaacaag aggaggaaca acaacttc tgagaact cgccgagtca catgactaat 1440 gttgatcatc atagctcgac ctctgat tctgttaccg ttgtggaaa tgttgttagt 1500 <h2 style=";text-align:left;direction:ltr">tatggtggtt atcaaggatt cgcaatccct gttggaacat cggttaatta cgatcccttt 1560<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> actgctgctg agattgctta caacgcaaga aatcattatt actatgctca gcatcagcaa 1620<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> caacagcaga ttcagcagtc gccgggagga gattttccgg tggcgatttc gaataaccat 1680<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agctctaaca tgtactttca cggggaaggt ggtggagaag gggctccaac gttttcagtt 1740<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tggaacgaca cttag 1755<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 11<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 584<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <212> PRT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <213> Arabidopsis thaliana<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <400> 11<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Met Asn Ser Met Asn Asn Trp Leu Gly Phe Ser Leu Ser Pro His Asp<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 1 5 10 15<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Gln Asn His His Arg Thr Asp Val Asp Ser Ser Thr Thr Arg Thr Ala<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 20 25 30<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Val Asp Val Ala Gly Gly Tyr Cys Phe Asp Leu Ala Ala Pro Ser Asp<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 35 40 45<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Glu Ser Ser Ala Val Gln Thr Ser Phe Leu Ser Pro Phe Gly Val Thr<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 50 55 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Leu Glu Ala Phe Thr Arg Asp Asn Asn Ser His Ser Arg Asp Trp Asp<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 65 70 75 80<h2 style=";text-align:left;direction:ltr"> Ile Asn Gly Gly Ala Cys Asn Asn Ile Asn Asn Asn Glu Gln Asn Gly 85 90 95 Pro Lys Leu Glu Asn Phe Leu Gly Arg Thr Thr Thr Ile Tyr Asn Thr 100 105 110 Asn Glu Thr Val Val Asp Gly Asn Gly Asp Cys Gly Gly Gly Asp Gly 115 120 125 Gly Gly Gly Gly Ser Leu Gly Leu Ser Met Ile Lys Thr Trp Leu Ser 130 135 140 Asn His Ser Val Ala Asn Ala Asn His Gln Asp Asn Gly Asn Gly Ala 145 150 155 160 Arg Gly Leu Ser Leu Ser Met Asn Ser Ser Thr Ser Asp Ser Asn Asn 165 170 175 Tyr Asn Asn Asn Asp Asp Val Val Gln Glu Lys Thr Ile Val Asp Val 180 185 190 Val Glu Thr Thr Pro Lys Lys Thr Ile Glu Ser Phe Gly Gln Arg Thr 195 200 205 Ser Ile Tyr Arg Gly Val Thr Arg His Arg Trp Thr Gly Arg Tyr Glu 210 215 220 Ala His Leu Trp Asp Asn Ser Cys Lys Arg Glu Gly Gln Thr Arg Lys 225 230 235 240 Gly Arg Gln Val Tyr Leu Gly Gly Tyr Asp Lys Glu Glu Lys Ala Ala 245 250 255 Arg Ala Tyr Asp Leu Ala Ala Leu Lys Tyr Trp Gly Thr Thr Thr Thr 260 265 270 Thr Asn Phe Pro Leu Ser Glu Tyr Glu Lys Glu Val Glu Glu Met Lys 275 280 285 His Met Thr Arg Gln Glu Tyr Val Ala Ser Leu Arg Arg Lys Ser Ser 290 295 300 Gly Phe Ser Arg Gly Ala Ser Ile Tyr Arg Gly Val Thr Arg His His 305 310 315 320 Gln His Gly Arg Trp Gln Ala Arg Ile Gly Arg Val Ala Gly Asn Lys 325 330 335 Asp Leu Tyr Leu Gly Thr Phe Gly Thr Gln Glu Glu Ala Ala Glu Ala 340 345 350 Tyr Asp Ile Ala Ala Ile Lys Phe Arg Gly Leu Ser Ala Val Thr Asn 355 360 365 Phe Asp Met Asn Arg Tyr Asn Val Lys Ala Ile Leu Glu Ser Pro Ser 370 375 380 Leu Pro Ile Gly Ser Ser Ala Lys Arg Leu Lys Asp Val Asn Asn Pro 385 390 395 400 Val Pro Ala Met Met Ile Ser Asn Asn Val Ser Glu Ser Ala Asn Asn 405 410 415 Val Ser Gly Trp Gln Asn Thr Ala Phe Gln His His Gln Gly Met Asp 420 425 430 Leu Ser Leu Leu Gln Gln Gln Gln Glu Arg Tyr Val Gly Tyr Tyr Asn 435 440 445 Gly Gly Asn Leu Ser Thr Glu Ser Thr Arg Val Cys Phe Lys Gln Glu 450 455 460 Glu Glu Gln Gln His Phe Leu Arg Asn Ser Pro Ser His Met Thr Asn 465 470 475 480 Val Asp His His Ser Ser Thr Ser Asp Asp Ser Val Thr Val Cys Gly 485 490 495 Asn Val Val Ser Tyr Gly Gly Tyr Gln Gly Phe Ala Ile Pro Val Gly 500 505 510 Thr Ser Val Asn Tyr Asp Pro Phe Thr Ala Ala Glu Ile Ala Tyr Asn 515 520 525 Ala Arg Asn His Tyr Tyr Tyr Ala Gln His Gln Gln Gln Gln Gln Ile 530 535 540 Gln Gln Ser Pro Gly Gly Asp Phe Pro Val Ala Ile Ser Asn Asn His 545 550 555 560 Ser Ser Asn Met Tyr Phe His Gly Glu Gly Gly Gly Glu Gly Ala Pro 565 570 575 Thr Phe Ser Val Trp Asn Asp Thr 580 <210> 12 <211> 807 <212> DNA <213> Artificial Sequence <220> <223> cDNA of AtAGL15 encoding SEQ ID NO: 13 <400> 12 atgggtcgtg gaaaaatcga gataaagagg atcgagaatg cgaatagcag acaagtcact 60 ttttccaaga ggcgttctgg gttacttaag aaagctcgtg agctctctgt tctttgtgat 120 gctgaagttg ctgtcatcgt cttctctaag tctggcaagc tcttcgagta ctccagtact 180 ggaatgaagc aaacactttc cagatacggt aatcaccaga gttcttcagc ttctaaagca 240 gaggaggatt gtgcagaggt ggatatttta aaggatcaac tttcaaagct tcaagagaaa 300 catttacaac tgcagggcaa gggcttgaat cctctgacct ttaaagagct gcaaagcctt 360 gagcagcaac tatatcatgc attgattact gtcagagagc gaaaggaacg attgctgact 420 aaccaacttg aagaatcacg cctcaggaa caacgagcag agttggaaa cgagaccttg 480 cgtagacagg ttcaagact gaggagcttt ctcccgtcgt tcaccacta tgttccatcc 540 tacatcaat gctttgctat agatccaag aacgctctca taaaccacga cagtaaatgc 600 agcctccaga acaccgattc agacacaact ttgcaattag ggttgccggg agaggcacat 660 gagaagga cgaatgaagg agaagag agcccgtca gcgattcagt gaacaac 720 acgagcagcg aactgcaga aagagggat cagtctagtt tagcaatttc tccacctgaa 780 gccaaaagac aaggttctc tgtttag 807 <210> 13 <211> 268 <212> PRT <213> Arabidopsis thaliana <400> 13 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Ala Asn Ser 1 5 10 15 Arg Gln Val Thr Phe Ser Lys Arg Ser Gly Leu Leu Lys Ala 20 25 30 Arg Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Val Ile Val Phe 35 40 45 Ser Lys Ser Gly Lys Leu Phe Glu Tyr Ser Ser Thr Gly Met Lys Gln 50 55 60 Thr Leu Ser Arg Tyr Gly Asn His Gln Ser Ser Ser Ala Ser Lys Ala 65 70 75 80 Glu Glu Asp Cys Ala Glu Val Asp Ile Leu Lys Asp Gln Leu Ser Lys 85 90 95 Leu Gln Glu Lys His Leu Gln Leu Gln Gly Lys Gly Leu Asn Pro Leu 100 105 110 Thr Phe Lys Glu Leu Gln Ser Leu Glu Gln Gln Leu Tyr His Ala Leu 115 120 125 Ile Thr Val Arg Glu Arg Lys Glu Arg Leu Leu Thr Asn Gln Leu Glu 130 135 140 Glu Ser Arg Leu Lys Glu Gln Arg Ala Glu Leu Glu Asn Glu Thr Leu 145 150 155 160 Arg Arg Gln Val Gln Glu Leu Arg Ser Phe Leu Pro Ser Phe Thr His 165 170 175 Tyr Val Pro Ser Tyr Ile Lys Cys Phe Ala Ile Asp Pro Lys Asn Ala 180 185 190 Leu Ile Asn His Asp Ser Lys Cys Ser Leu Gln Asn Thr Asp Ser Asp 195 200 205 <h2 style=";text-align:left;direction:ltr">Thr Thr Leu Gln Leu Gly Leu Pro Gly Glu Ala His Asp Arg Arg Thr<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 210 215 220<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Asn Glu Gly Glu Arg Glu Ser Pro Ser Ser Asp Ser Val Thr Thr Asn<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 225 230 235 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Thr Ser Ser Glu Thr Ala Glu Arg Gly Asp Gln Ser Ser Leu Ala Asn<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 245 250 255<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Ser Pro Pro Glu Ala Lys Arg Gln Arg Phe Ser Val<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 260 265<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 16296<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <212> DNA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <213> Artificial Sequence<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <220><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <223> Plasmid pERV1-hygro carrying TaRKD2 as CDS<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <400> 14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggtttacccg ccaatatatc ctgtcaaaca ctgatagttt aaaccgaagg cgggaaacga 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> caatctgatc gggtaccggg cccaagatct ggcccttaag gccttactag gctgcagtgc 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agcgtgaccc ggtcgtgccc ctctctagag ataatgagca ttgcatgtct aagttataaaa 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aaattaccac atattttttt tgtcacactt gtttgaagtg cagtttatct atctttatac 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atatatttaa actttactct acgaataata taatctatag tactacaata atatcagtgt 300<h2 style=";text-align:left;direction:ltr"> tttagagaat catataatg aacagttaga catggtctaa aggacattg agtattttga 360 caacaggact ctacagtttt atcttttag tgtgcatgtg ttctcctttt ttttgcaaa 420 tagctcacc tatatatac tcatcatt tagcttac tagcttag ggtttaggtt 480 taatggtttt tatagactaa ttttttt acatctattt tattctttt tagccctctaa 540 attaaaaaa ctaaaactct attagtttt ttttatttta taatttagat aaaataga 600 aaaaaaa gtgactaaaaaaaaaa taccctttaa gaattaaaaaaaagga 660 aacattttc ttgtttcgag tagataatgc cagcctgtta aacgccgtcg atcgacgagt 720 ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 780 cggcatctct gtcgctgcct ctggaccct ctcgagagtt ccgctccacc gttggacttg 840 ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 900 gcggcctcct cctccctca cggcaccggc agctacgggg gattccttc cccaccgctcc 960 ttcgctttcc cttcctcgcc cgccgtataata atagacacc ccctccacac cctctttccc 1020 caacctcgtg ttgttcggag cgcacacaca cacaaccaga tctcccccaa atccacccgt 1080 cggcacctcc gcttcaaggt acgccgctcg tctcccccc cccccctct ctaccttctc 1140 tagatcggcg ttccggtcca tggttagggc ccggtagttc tacttctgtt catgtttgtg 1200 ttagatccgt gttgtgtta gatccgtgct gctagcgttc gtacacggat gcgacctgta 1260 cgtcagacac gttctgattg ctaacttgcc agtgtttctc tttggggaat cctgggatgg 1320 ctctagccgt tccgcagacg ggatcgatct aggataggta tacatgttga tgtgggtttt 1380 actgatgcat atacatgatg gcatatgcag catctattca tatgctctaa ccttgagtac 1440 ctatctatta tataaacaa gtatgtttta taattatttt gatcttgata tacttggatg 1500 atggcatatg cagcagctat atgtggattt ttttagccct gccttcatac gctatttatt 1560 tgcttggtac tgtttctttt gtcgatgctc accctgttgt ttggtgttac ttctgcaggt 1620 actagtattc cgggcggaat gaaagcgtta acggccaggc aacaagaggt gtttgatctc 1680 atccgtgatc acatcagcca gacaggtatg ccgccgacgc gtgcggaaat cgcgcagcgt 1740 ttggggttcc gttccccaaa cgcggctgaa gaacatctga aggcgctggc acgcaaaggc 1800 gttattgaaa ttgtttccgg cgcatcacgc gggattcgtc tgttgcagga agaggaagaa 1860 gggttgccgc tggtaggtcg tgtggctgcc ggtgaaccgt cgagcgcccc cccgaccgat 1920 gtcagcctgg gggacgagct ccacttagac ggcgaggacg tggcgatggc gcatgccgac 1980 gcgctagacg atttcgatct ggacatgttg ggggacgggg attccccggg tccgggattt 2040 accccccacg actccgcccc ctacggcgct ctggatatgg ccgacttcga gtttgagcag 2100 atgtttaccg atgcccttgg aattgacgag tacggtgggg atccgtctgc tggagacatg 2160 agagctgcca acctttggcc aagcccgctc atgatcaaac gctctaagaa gaacagcctg 2220 gccttgtccc tgacggccga ccagatggtc agtgccttgt tggatgctga gccccccata 2280 ctctattccg agtatgatcc taccagaccc ttcagtgaag cttcgatgat gggcttactg 2340 accaacctgg cagacaggga gctggttcac atgatcaact gggcgaagag ggtgccaggc 2400 tttgtggatt tgaccctcca tgatcaggtc caccttctag aatgtgcctg gctagagatc 2460 ctgatgattg gtctcgtctg gcgctccatg gagcacccag ggaagctact gtttgctcct 2520 aacttgctct tggagagaa ccagggaaaa tgtgtagagg gcatggtgga gatcttggac 2580 atgctgctgg ctacatcatc tcggttccgc atgatgaatc tgcagggaga ggagtttgtg 2640 tgcctcaaat ctattatttt gcttaattct ggagtgtaca catttctgtc cagcaccctg 2700 aagtctctgg aagagaaagga ccatatccac cgagtcctgg acaagatcac agacactttg 2760 atccacctga tggccaaggc aggcctgacc ctgcagcagc agcaccagcg gctggcccag 2820 ctcctcctca tcctctccca catcaggcac atgagtaaca aaggcatgga gcatctgtac 2880 agcatgaagt gcaagaacgt ggtgcccctc tatgacctgc tgctggagat gctggacgcc 2940 caccgcctac atgcgcccac tagccgtgga ggggcatccg tggaggagac ggaccaaagc 3000 cacttggcca ctgcgggctc tacttcatcg cattccttgc aaaagtatta catcacgggg 3060 gaggcagagg gtttccctgc cacagtctga gagctccctg gcggaattcc cagagatgtt 3120 agctgaaaatc atcactaatc agataccaaa atattcaaat ggaaatatca aaaagcttct 3180 gtttcatcaa aaatgactcg acctactga gtaagctagc ttgttcgagt attatggcat 3240 tgggaaaact gttttcttg taccattgt tgtgcttgta atttactg tttttattc 3300 ggttttcgct atcgaactgt gaatgaaa tggatggaga agagttaatg atgaatgg 3360 tccttttgtt cattctcaaa ttaatattat ttgttttttc tcttatttgt tgtgtgttga 3420 atttgaaattt atagagata tgcaacatt ttgttttgag taaaaatgtg tcaatcgtg 3480 gcctctaatg accgaagtta attgaggag taaaacacta gatccccaaa caagcttgga 3540 aactgaaggc gctcgagtta ctagatcggg gattgatcc cccctcgaca gcttgcatgc 3600 cgcttgggct gcaggtcgag gctaaaaaac taatcgcatt atcatcccct cgacgtactg 3660 tacatataac cactggtttt atatacagca gtactgtaca tataaccact ggttttatat 3720 acagcagtcg acgtactgta catataacca ctggttttat atacagcagt actgtacata 3780 taaccactgg ttttatac agcagtcgag gtaagattag atatggatat gtatatggat 3840 atgtatatgg tggtaatgcc atgtaatg ctcgactcta ggatcttcgc aagacccttc 3900 ctctatataa ggaagttcat ttcatttgga gaggacacgc tgaagctagt cgactctagc 3960 ctccctaggc tgccggacga cgagctcctc ccccctcccc ctccgccgcc gccgcgccgg 4020 taaccacccc gcccctctcc tctttctttc tccgtttttt tttccgtctc ggtctcgatc 4080 tttggccttg gtagtttggg tgggcgagag gcggcttcgt gcgcgcccag atcggtgcgc 4140 gggaggggcg ggatctcgcg gctggggctc tcgccggcgt ggatccggcc cggatctcgc 4200 ggggaatggg gctctcggat gtagatctgc gatccgccgt tgttggggga gatgatgggg 4260 ggtttaaaat ttccgccatg ctaaacaaga tcaggaagag gggaaaaggg cactatggtt 4320 tatattttta tatatttctg ctgcttcgtc aggcttagat gtgctagatc ttcttctttc 4380 tttcttcttt ttgtgggtag aatttgaatc cctcagcatt gttcatcggt agtttttctt 4440 ttcatgattt gtgacaaatg cagcctcgtg cggagctttt ttgtaggcgc gggctgcagg 4500 aattcaagct tacgcgtgtc atcacaagtt tgtacaaaaa agcaggctat ggagatgcaa 4560 caacaatact tcggggggga cggcgatgcg gactggttcc atcaactcgc attgcttccc 4620 ccacttccaa tctcatcgtc tctcccccca ctccccgatgt cagagggctc atgtctccct 4680 atggcagcag cagctgcagc tgcactcccc cttggcgatt gctcgagcgc cctcatgata 4740 cgccctgagg aacagatgtc ttgccttcca atgaacccct ctccagcggt cgtcgacgat 4800 gtctactctt cctacgcacc gaacaatgtc gacgtgttgc cgccattccc ggcaggactt 4860 gacgacgctc tgttgatgga gtcttttct gacatcgacc tcgaggagtt tgctgacgca 4920 tttggccaca agatcaagac agaacccctc gacgatgcca tggtccccgc ggaccacgac 4980 ttcgcggctc aagcccaaca ggcctgccct gtggtcatca tgaatcagca aaactcaac 5040 gcacccagag acgtgcgcct gctcattgac ccggatgatg atgacagcac cgtggtggcc 5100 ggggggctatg aagctgcagc ggtggggtgc gccgagcaga aacaggtcag gccagcacca 5160 cgtagggtga gaagagctc aggcggcgca agaccagccg cgggagaaa gtccctcgat 5220 cacatcggat tcgaggaact caggacctat ttctatatgc caatcaccaa ggcagcgagg 5280 gaaatgaacg tggggctgac agtcctgaag aagagatgcc gggaactggg ggtggcgcgc 5340 tggccacaca gaagatgaa gtctctgaga agcctgatcc tcaacattca ggagatgggg aagggcgcaa catctcccgc agccgtgcag ggggaacttg aagcgcttga gaggtattgc gccattatgg aggagaaccc ggctatagag ctcaccgagc aaacgaaga gctcaggcag 5520 gcttgtttca aagagaatta tagcggcgt agagccgccg cttctgttaa tcttctcgat cactgctata acgatctggc atctcatgag cagcaaatgc ctctcccaca aatgggattc tttggatttt agacccagct ttcttgtaca aagtggtgat gactcgaatt tccccgatcg ttcaaacatt tggcaataaa gtttcttaag attgaatcct gttgccggtc ttgcgatgat tatcatata tttctgttga attack gcatgtaata attack aatgcatgac gttatttatg agatgggttt ttatgattag agtcccgcaa ttacattt aatacgcgat 5880. agaaaacaaa atatagcgcg caaactagga taattatcg cgcgcggtgt catctatgtt actagatcgc tcgacgcggc cgccatggcc tctagtggat cagcttgcat gcctgcaggt 6000 cactggattt tggttttagg aattagaaat tttattgata aattatttt acaaatacaa atacatacta agggtttct atatgctcaa cacatgagcg aaaccctata agaaccctaa 6120 ttcccttatc tgggaactac tcacacatta ttctggagaa aatagagag agatagattt 6180 gtagagagag actggtgatt tttgcggact ccggtcggca tctactctat tcctttgccc 6240 tcggacgagt gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg 6300 tccagacggc cgcgcttg cgggcgattt gtgtacgccc gacagtcccg gctccggatc 6360 ggacgattgc gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca 6420 agctctgata gagttggtca agaccaatgc ggagcatata cgcccggagc cgcggcgatc 6480 ctgcaagctc cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc 6540 acggcctcca gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc 6600 tccagtcaat gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat 6660 ccgcgtgcac gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga 6720 gagcctgcgc gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat 6780 ggggatcagc aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg 6840 gtccgaatgg gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatgg 6900 cctccgcgac cggctgcaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga 6960 caccctgtgc acggcgggag atgcaatagg tcaggctctc gctgaattcc ccaatgtcaa 7020 gcacttccgg aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt 7080 agaaaccatc ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc 7140 tgaaagcacg agattcttcg cctccgaga gctgcatcag gtcggagacg ctgtcgaact 7200 tttcgatcag aaacttctcg acagacgtcg cggtgagttc aggctttttc atatcttatt 7260 gccccccggg gccctcgacc tgcagaagta acaccaaaca acagggtgag catcgacaaa 7320 agaaacagta ccaagcaaat aatagcgta tgaaggcagg gctaaaaaaa tccacatata 7380 gctgctgcat atgccatcat ccaagtatat caagatcaaa ataattataa aacatacttg 7440 tttattataa tagataggta ctcaaggtta gagcatatga atagatgctg catatgccat 7500 catgtatatg catcagtaaa acccacatca acatgtatac ctatcctaga tcgatcccgt 7560 ctgcggaacg gctagagcca tcccaggatt ccccaaagag aaacactggc aagttagcaa 7620 tcagaacgtg tctgacgtac aggtcgcatc cgtgtacgaa cgctagcagc acggatctaa 7680 cacaaacacg gatctaacac aaacatgaac agaagtagaa ctaccgggcc ctaaccatgg 7740 accggaacgc cgatctagag aaggtagaga gggggggggg gggaggacga gcggcgtacc 7800 ttgaagcgga ggtgccgacg ggtggatttg ggggagatct ggttgtgtgt gtgtgcgctc 7860 cgaacaacac gaggttgggg aaagagggtg tggagggggt gtctatttat tacggcgggc 7920 gaggaaggga aagcgaagga gcggtgggaa aggaatcccc cgtagctgcc ggtgccgtga 7980 gaggaggagg aggccgcctg ccgtgccggc tcacgtctgc cgctccgcca cgcaatttct 8040 ggatgccgac agcggagcaa gtccaacggt ggagcggaac tctcgagagg ggtccagagg 8100 cagcgacaga gatgccgtgc cgtctgcttc gcttggcccg acgcgacgct gctggttcgc 8160 tggttggtgt ccgttagact cgtcgatcga cggcgtttaa caggctggca ttatctactc 8220 gaaacaagaaaatgttttcc ttagttttt taatttctta aagggtattt gtttaatttt 8280 tagtcacttt attttattct attttatatc taaattatta aaaaaaaa ctaaaataga 8340 gttttagttt tcttaattta gaggctaaaa tagaaaaa tegtgtact aaaaaaatta 8400 gtcttaaaa accattaacc ctaaacccta aatggatgta ctataaaat ggatgaagta 8460 ttatataggt gaagctattt gcaaaaaaa aggacac atgcacacta aaagataa 8520 actgtagagt cctgttgtca aaatactcaa ttgtccttta gaccatgtct aactgttcat 8580 ttatatgatt ctctaaaaca ctgatattat tgtagtacta tattatat tattcgtaga 8640 gtaaagttta atatatgta windowataga taaactgcac ttcaacaag tgtgacaaaa 8700 aaaatatgtg gtaattttt ataacttaga catgcaatgc tcattactc tagagagggg 8760 cacgaccggg tcacgctgca ctgcagacta ctagagccga tcgtgaagtt tctcatctaa 8820 gcccccattt ggacgtgaat gtagacacgt cgaataag atttccgaat tagaatatt 8880 tgtttattgc ttcgcctat aaatacgacg gatcgtaatt tgtcgtttta tcaaatgta 8940 ctttcatttt samaaacgc tgcggagacatc tacatttttg aattgaaaaa aaattggtaa 9000 ttactctttc tttttctcca tattgaccat catactcatt gctgatccat gtagatttcc 9060 cggacatgaa gccatttaca attgaatata tcctgccgcc gctgccgctt tgcaccccggt 9120 ggagcttgca tgttggtttc tacgcagaac tgagccggtt aggcagataa tttccattga 9180 gaactgagcc atgtgcacct tccccccaac acggtgagcg acggggcaac ggagtgatcc 9240 acatgggact tttaaacatc atccgtcgga tggcgttgcg agagaagcag tcgatccgtg 9300 agatcagccg acgcaccggg caggcgcgca acacgatcgc aaagtatttg aacgcaggta 9360 caatcgagcc gacgttcacg cggaacgacc aagcaagcta tgttgcgatt acttcgccaa 9420 ctattgcgat aacaagaaaa agccagcctt tcatgatata tctcccaatt tgtgtagggc 9480 ttattatgca cgcttaaaaa taataaaagc agacttgacc tgatagtttg gctgtgagca 9540 attatgtgct tagtgcatct aacgcttgag ttaagccgcg ccgcgaagcg gcgtcggctt 9600 gaacgaattg ttagacatta tttgccgact accttggtga tctcgccttt cacgtagtgg 9660 acaaattctt ccaactgatc tgcgcgcgag gccaagcgat cttcttcttg tccaagataa 9720 gcctgtctag cttcaagtat gacgggctga tactgggccg gcaggcgctc cattgcccag 9780 tcggcagcga catccttcgg cgcgattttg ccggttactg cgctgtacca aatgcgggac 9840 aacgtaagca ctacatttcg ctcatcgcca gcccagtcgg gcggcgagtt ccatagcgtt 9900 aaggtttcat ttagcgcctc aaatagatcc tgttcaggaa ccggatcaaa gagttcctcc 9960 gccgctggac ctaccaaggc aacgctatgt tctcttgctt ttgtcagcaa gatagccaga 10020 tcaatgtcga tcgtggctgg ctcgaagata cctgcaagaa tgtcattgcg ctgccattct 10080 ccaaattgca gttcgcgctt agctggataa cgccacggaa tgatgtcgtc gtgcacaaca 10140 atggtgactt ctacagcgcg gagaatctcg ctctctccag gggaagccga agtttccaaa 10200 aggtcgttga tcaaagctcg ccgcgttgtt tcatcaagcc ttacggtcac cgtaaccagc 10260 aaatcaatat cactgtgtgg cttcaggccg ccatccactg cggagccgta caaatgtacg 10320 gccagcaacg tcggttcgag atggcgctcg atgacgccaa ctacctctga tagttgagtc 10380 gatacttcgg cgatcaccgc ttccctcatg atgtttaact ttgttttagg gcgactgccc 10440 tgctgcgtaa catcgttgct gctccataac atcaaacatc gacccacggc gtaacgcgct 10500 tgctgcttgg atgcccgagg catagactgt accccaaaaa aacagtcata acaagccatg 10560 aaaaccgcca ctgcgccgtt accaccgctg cgttcggtca aggttctgga ccagttgcgt 10620 gagcgcatac gctacttgca ttacagctta cgaaccgaac aggcttatgt ccactgggtt 10680 cgtgccttca tccgtttcca cggtgtgcgt cacccggcaa ccttgggcag cagcgaagtc 10740 gaggcatttc tgtcctggct ggcgaacgag cgcaaggttt cggtctccac gcatcgtcag 10800 gcatacccac cggtgccttg atgtgggcgc cggcggtcga gtggcgacgg cgcggcttgt 10860 ccgcgccctg gtagattgcc tggccgtagg ccagccattt ttgagcggcc agcggccgcg 10920 ataggccgac gcgaagcggc ggggcgtagg gagcgcagcg accgaagggt aggcgctttt 10980 tgcagctctt cggctgtgcg ctggccagac agttatgcac aggccaggcg ggttttaaga 11040 gttttaataa gttttaaaga gttttaggcg gaaaaatcgc cttttttctc ttttatatca 11100 gtcacttaca tgtgtgaccg gttcccaatg tacggctttg ggttcccaat gtacgggttc 11160 cggttcccaa tgtacggctt tgggttccca atgtacgtgc tatccacagg aaagagacct 11220 tttcgacctt tttcccctgc tagggcaatt tgccctagca tctgctccgt acattaggaa 11280 ccggcggatg cttcgccctc gatcaggttg cggtagcgca tgactaggat cgggccagcc 11340 tgccccgcct cctccttcaa atcgtactcc ggcaggtcat ttgacccgat cagcttgcgc 11400 acggtgaaac agaacttctt gaactctccg gcgctgccac tgcgttcgta gatcgtcttg 11460 aacaaccatc tggcttctgc cttgcctgcg gcgcggcgtg ccaggcggta gagaaaacgg 11520 ccgatgccgg gatcgatcaa aaagtaatcg gggtgaaccg tcagcacgtc cgggttcttg 11580 ccttctgtga tctcgcggta catccaatca gctagctcga tctcgatgta ctccggccgc 11640 ccggtttcgc tctttacgat cttgtagcgg ctaatcaagg cttcaccctc ggataccgtc 11700 accaggcggc cgttcttggc cttcttcgta cgctgcatgg caacgtgcgt ggtgtttaac 11760 cgaatgcagg tttctaccag gtcgtctttc tgctttccgc catcggctcg ccggcagaac 11820 ttgagtacgt ccgcaacgtg tggacggaac acgcggccgg gcttgtctcc cttcccttcc 11880 cggtatcggt tcatggattc ggttagatgg gaaaccgcca tcagtaccag gtcgtaatcc 11940 cacacactcg ccatgccggc cggccctgcg gaaacctcta cgtgcccgtc tggaagctcg 12000 tagcggatca cctcgccagc tcgtcggtca cgcttcgaca gacggaaaac ggccacgtcc 12060 atgatgctgc gactatcgcg ggtgcccacg tcatagagca tcggaacgaa aaaatctggt 12120 tgctcgtcgc ccttgggcgg cttcctaatc gacggcgcac cggctgccgg cggttgccgg 12180 gattctttgc ggattcgatc agcggccgct tgccacgatt caccggggcg tgcttctgcc 12240 tcgatgcgtt gccgctgggc ggcctgcgcc gccttcaact tctccaccag gtcatcaccc 12300 agcgccgcgc cgatttgtac cgggccggat ggtttgcgac cgctcacgcc gattcctcgg 12360 gcttgggggt tccagtgcca ttgcagggcc ggcagacaac ccagccgctt acgcctggcc 12420 aaccgcccgt tcctccacac atggggcatt ccacggcgtc ggtgcctggt tgttcttgat 12480 tttccatgcc gcctccttta gccgctaaaa ttcatctact catttattca tttgctcatt 12540 tactctggta gctgcgcgat gtattcagat agcagctcgg taatggtctt gccttggcgt 12600 accgcgtaca tcttcagctt ggtgtgatcc tccgccggca actgaaagtt gacccgcttc 12660 atggctggcg tgtctgccag gctggccaac gttgcagcct tgctgctgcg tgcgctcgga 12720 cggccggcac ttagcgtgtt tgtgcttttg ctcattttct ctttacctca ttaactcaaa 12780 tgagttttga tttaatttca gcggccagcg cctggacctc gcgggcagcg tcgccctcgg 12840 gttctgattc aagaacggtt gtgccggcgg cggcagtgcc tgggtagctc acgcgctgcg 12900 tgatacggga ctcaagaatg ggcagctcgt acccggccag cgcctcggca acctcaccgc 12960 cgatgcgcgt gcctttgatc gcccgcgaca cgacaaaggc cgcttgtagc cttccatccg 13020 tgacctcaat gcgctgctta accagctcca ccaggtcggc ggtggcccat atgtcgtaag 13080 ggcttggctg caccggaatc agcacgaagt cggctgcctt gatcgcggac acagccaagt 13140 ccgccgcctg gggcgctccg tcgatcacta cgaagtcgcg ccggccgatg gccttcacgt 13200 cgcggtcaat cgtcgggcgg tcgatgccga caacggttag cggttgatct tcccgcacgg 13260 ccgcccaatc gcgggcactg ccctggggat cggaatcgac taacagaaca tcggccccgg 13320 cgagttgcag ggcgcgggct agatgggttg cgatggtcgt cttgcctgac ccgcctttct 13380 ggttaagtac agcgataacc ttcatgcgtt ccccttgcgt atttgtttat ttactcatcg 13440 catcatatac gcagcgaccg catgacgcaa gctgttttac tcaaatacac atcacctttt 13500 tagacggcgg cgctcggttt cttcagcggc caagctcgcc ggccaggccg cgagcttggc 13560 atcagacaaa ccggccagga tttcatgcag ccgcacggtt gagacgtgcg cgggcggctc 13620 gaacacgtac ccggccgcga tcatctccgc ctcgatctct tcggtaatga aaaacggttc 13680 gtcctggccg tcctggtgcg gtttcatgct tgttcctctt ggcgttcatt ctcggcggcc 13740 gccagggcgt cggcctcggt caatgcgtcc tcacggaagg caccgcgccg cctggcctcg 13800 gtgggcgtca cttcctcgct gcgctcaagt gcgcggtaca gggtcgagcg atgcacgcca 13860 agcagtgcag ccgcctcttt cacggtgcgg ccttcctggt cgatcagctc gcgggcgtgc 13920 gcgatctgtg ccggggtgag ggtagggcgg gggccaaact tcacgcctcg cgccttggcg 13980 gcctcgcgcc cgctccgggt gcggtcgatg attagggaac gctcgaactc ggcaatgccg 14040 gcgaacacgg tcaacaccat gcggccggcc ggcgtggtgg tgtcggccca cggctctgcc 14100 aggctacgca ggcccgcgcc ggcctcctgg atgcgctcgg caatgtccag taggtcgcgg 14160 gtgctgcggg ccaggcggtc tagcctggtc actgtcacaa cgtcgccagg gcgtaggtgg 14220 tcaagcatcc tggccagctc cgggcggtcg cgcctggtgc cggtgatctt ctcggaaaac 14280 agcttggtgc agccggccgc gtgcagttcg gcccgttggt tggtcaagtc ctggtcgtcg 14340 gtgctgacgc gggcatagcc cagcaggcca gcggcggcgc tcttgttcat ggcgtaatgt 14400 ctccggttct agtcgcaagt attctacttt atgcgactaa aacacgcgac aagaaaacgc 14460 caggaaaagg gcagggcggc agcctgtcgc gtaacttagg acttgtgcga catgtcgttt 14520 tcagaagacg gctccactga acgtcagaag ccgactgcac tatagcagcg gaggggttgg 14580 atcgacctcg acgtacccct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca 14640 catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc 14700 ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg 14760 tagcgatagc ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga 14820 gtgcaccata tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg 14880 cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 14940 gtatcagctc actcaaaggc ggtaatcggt tatccacaga atcaggggat aacgcaggaa 15000 agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 15060 cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 15120 ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 15180 tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 15240 gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 15300 gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 15360 gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 15420 ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 15480 ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg ctgaagccag 15540 ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 15600 gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 15660 ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 15720 tggtcatgag attatcaaaa aggatcttca cctagatcct tttcggcgtc cacatcaacg 15780 gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg cgatatcttg ctgcgttcgg 15840 atattttcgt ggagttcccg ccacagaccc ggattgaagg cgagatccag caactcgcgc 15900 cagatcatcc tgtgacggaa ctttggcgcg tgatgactgg ccaggacgtc ggccgaaaga 15960 gcgacaagca gatcacgctt ttcgacagcg tcggatttgc gatcgaggat ttttcggcgc 16020 tgcgctacgt ccgcgaccgc gttgagggat caagccacag cagcccactc gaccttctag 16080 ccgacccaga cgagccaagg gatctttttg gaatgctgct ccgtcgtcag gctttccgac 16140 gtttgggtgg ttgaacagaa gtcattatcg cacggaatgc caagcactcc cgaggggaac 16200 cctgtggttg gcatgcacat acaaatggac gaacggataa accttttcac gcccttttaa 16260 atatccgatt attctaataa acgctctttt ctctta 16296 <210> 15 <211> 707 <212> DNA <213> Artificial Sequence <220> <223> W pOp6 W promoter <400> 15 ctagctgtag ttgtagaatg taaaatgtaa tgttgttgtt gtttgttgtt gttgttggta 60 attgttgtaa aaatacgcgc gtctagcttc agcgtgtcct ctccaaatga aatgaacttc 120 cttatataga ggaagggtct tgcgaagatc gatccactag tctttcaatt gtgagcgctc 180 acaattcttt ctcttccctt tcttctttct agtctagtct ttcaattgtg agcgctcaca 240 attctttctc ttccctttct tctttctagt ctagtctttc aattgtgagc gctcacaatt 300 ctttctcttc cctttcttct ttctagtcta gtctttcaat tgtgagcgct cacaattctt 360 tctcttccct ttcttctttc tagtctagtc tttcaattgt gagcgctcac aattctttct 420 cttccctttc ttctttctag tctagtcttt caattgtgag cgctcacaat tctttctctt 480 ccctttcttc tttctagtct ttcaattgtg agcgctcaca attctttctc ttccctttct 540 tctttctagc tccaccgcgg tggcggccgg ccgctctagt ggatcgatct tcgcaagacc 600 cttcctctat ataaggaagt tcatttcatt tggagaggac acgctgaagc tagacgcgcg 660 tatttttaca acaattacca acaacaacaa caaacaacaa caacatt 707 <210> 16 <211> 2226 <212> DNA <213> Artificial Sequence <220> <223> cDNA of LhGR encoding SEQ ID NO: 17 <400> 16 atggctagtg aagctcgaaa aacaaagaaa aaaatcaaag ggattcagca agccactgca 60 ggagtctcac aagacacttc ggaaaatcct aacaaaacaa tagttcctgc agcattacca 120 cagctcaccc ctaccttggt gtcactgctg gaggtgattg aacccgaggt gttgtatgca 180 ggatatgata gctctgttcc agattcagca tggagaatta tgaccacact caacatgtta 240 ggtgggcgtc aagtgattgc agcagtgaaa tgggcaaagg cgataccagg cttcagaaac 300 ttacacctgg atgaccaaat gaccctgcta footactcat ggatgtttct catggcattt 360 gccctgggtt ggagatcata cagacaatca agtggaaacc tgctctgctt tgctcctgat 420 ctgattatta atgagcagag aatgtctcta ccctgcatgt atgaccaatg taaacacatg 480 ctgttcgtct cctctgagct ccagcgattg caggtatcct atgaagagta tctctgtatg 540 aaaaccttac tgcttctctc ctcagttcct aaaggtc tgaagagcca agagttattt 600 gatgagattc gaatgactta tatcaaagag ctaggaaaag ccatcgtcaa aagggaaggg 660 aactccagtc agaactggca acggttttac caactgacaa agcttctgga ctccatgcat 720 gaggtggttg agaatctcct tacctactgc ttccagacat ttttggataa gaccatgagt 780 attgaattcc cagagatgtt agctgaaatc atcactaatc agataccaaa gtactcaaac 840 ggtaatatca agaagcttct gtttcatcaa aaatctacta gcaaaccggt aacgttatac 900 gacgtcgctg aatacgccgg cgtttctcat caaaccgttt ctagagtggt taaccaggct 960 tcacatgtta gcgctaaaac ccgggaaaaa gttgaagctg ccatggctga gctcaactac 1020 atcccgaacc gtgttgcgca gcagctggct ggtaaacaaa gcttgctgat cggtgtcgcg 1080 acctcgagct tggccctgca cgcgccgtcg caaattgtcg cggcgattaa atctcgcgcc 1140 gatcaactgg gtgccagcgt ggtggtgtcg atggtagaac gaagcggcgt cgaagcctgt 1200 aaagcggcgg tgcacaatct tctcgcgcaa cgcgtcagtg ggctgatcat taactatccg 1260 ctggatgacc aggatgccat tgctgtggaa gctgcctgca ctaatgttcc ggcgttattt 1320 cttgatgtct ctgaccagac acccatcaac agtattattt tctcccatga agacggtacg 1380 cgactgggcg tggagcatct ggtcgcattg ggtcaccagc aaatcgcgct gttagcgggc 1440 ccattaagtt ctgtctcggc gcgtctgcgt ctggctggct ggcataaata tctcactcgc 1500 aatcaaattc agccgatagc ggaacggggaa ggcgactgga gtgccatgtc cggttttcaa 1560 caaaccatgc aaatgctgaa tgagggcatc gttcccactg cgatgctggt tgccaacgat 1620 cagatggcgc tgggcgcaat gcgcgccatt accgagtccg ggctgcgcgt tggtgcggat 1680 atctcggtag tgggatacga cgataccgaa gacagctcat gttatatccc gccgttaacc 1740 accatcaaac aggattttcg cctgctgggg caaaccagcg tggaccgctt gctgcaactc 1800 tctcagggcc aggcggtgaa gggcaatcag ctgttgccg tctcactggt gaaaagaaaa 1860 accactagtg gatcggaatt cgccaatttt aatcaaagtg ggaatattgc tgatagctca 1920 ttgtccttca ctttcactaa cagtagcaac ggtccgaacc tcataacaac tcaaacaaat 1980 tctcaagcgc tttcacaacc aattgcctc tctaacgttc atgataactt catgaataat 2040 gaaatcacgg ctagtaaaat tgatgatggt aataattcaa aaccactgtc acctggttgg 2100 acggaccaaa ctgcgtataa cgcgtttgga atcactacag ggatgtttaa taccactaca 2160 atggatgatg tatataacta tctattcgat gatgaagata ccccaccaaa cccaaaaaaa 2220 gagtaa 2226 <210> 17 <211> 741 <212> PRT <213> Artificial Sequence <220> <223> LhGR protein <400> 17 Met Ala Ser Glu Ala Arg Lys Thr Lys Lys Lys Ile Lys Gly Ile Gln 1 5 10 15 Gln Ala Thr Ala Gly Val Ser Gln Asp Thr Ser Glu Asn Pro Asn Lys 20 25 30 Thr Ile Val Pro Ala Ala Leu Pro Gln Leu Thr Pro Thr Leu Val Ser 35 40 45 Leu Leu Glu Val Ile Glu Pro Glu Val Leu Tyr Ala Gly Tyr Asp Ser 50 55 60 Ser Val Pro Asp Ser Ala Trp Arg Ile Met Thr Thr Leu Asn Met Leu 65 70 75 80 Gly Gly Arg Gln Val Ile Ala Ala Val Lys Trp Ala Lys Ala Ile Pro 85 90 95 Gly Phe Arg Asn Leu His Leu Asp Asp Gln Met Thr Leu Leu Gln Tyr 100 105 110 Ser Trp Met Phe Leu Met Ala Phe Ala Leu Gly Trp Arg Ser Tyr Arg 115 120 125 Gln Ser Ser Gly Asn Leu Leu Cys Phe Ala Pro Asp Leu Ile Ile Asn 130 135 140 Glu Gln Arg Met Ser Leu Pro Cys Met Tyr Asp Gln Cys Lys His Met 145 150 155 160 Leu Phe Val Ser Ser Glu Leu Gln Arg Leu Gln Val Ser Tyr Glu Glu 165 170 175 Tyr Leu Cys Met Lys Thr Leu Leu Leu Leu Ser Ser Val Pro Lys Glu 180 185 190 Gly Leu Lys Ser Gln Glu Leu Phe Asp Glu Ile Arg Met Thr Tyr Ile 195 200 205 Lys Glu Leu Gly Lys Ala Ile Val Lys Arg Glu Gly Asn Ser Ser Gln 210 215 220 Asn Trp Gln Arg Phe Tyr Gln Leu Thr Lys Leu Leu Asp Ser Met His 225 230 235 240 Glu Val Val Glu Asn Leu Leu Thr Tyr Cys Phe Gln Thr Phe Leu Asp 245 250 255 Lys Thr Met Ser Ile Glu Phe Pro Glu Met Leu Ala Glu Ile Ile Thr 260 265 270 Asn Gln Ile Pro Lys Tyr Ser Asn Gly Asn Ile Lys Lys Leu Leu Phe 275 280 285 His Gln Lys Ser Thr Ser Lys Pro Val Thr Leu Tyr Asp Val Ala Glu 290 295 300 Tyr Ala Gly Val Ser His Gln Thr Val Ser Arg Val Val Asn Gln Ala 305 310 315 320 Ser His Val Ser Ala Lys Thr Arg Glu Lys Val Glu Ala Ala Met Ala 325 330 335 Glu Leu Asn Tyr Ile Pro Asn Arg Val Ala Gln Gln Leu Ala Gly Lys 340 345 350 Gln Ser Leu Leu Ile Gly Val Ala Thr Ser Ser Leu Ala Leu His Ala 355 360 365 Pro Ser Gln Ile Val Ala Ala Ile Lys Ser Arg Ala Asp Gln Leu Gly 370 375 380 Ala Ser Val Val Val Ser Met Val Glu Arg Ser Gly Val Glu Ala Cys 385 390 395 400 Lys Ala Ala Val His Asn Leu Leu Ala Gln Arg Val Ser Gly Leu Ile 405 410 415 Ile Asn Tyr Pro Leu Asp Asp Gln Asp Ala Ile Ala Val Glu Ala Ala 420 425 430 Cys Thr Asn Val Pro Ala Leu Phe Leu Asp Val Ser Asp Gln Thr Pro 435 440 445 Ile Asn Ser Ile Ile Phe Ser His Glu Asp Gly Thr Arg Leu Gly Val 450 455 460 Glu His Leu Val Ala Leu Gly His Gln Gln Ile Ala Leu Leu Ala Gly 465 470 475 480 Pro Leu Ser Ser Val Ser Ala Arg Leu Arg Leu Ala Gly Trp His Lys 485 490 495 Tyr Leu Thr Arg Asn Gln Ile Gln Pro Ile Ala Glu Arg Glu Gly Asp 500 505 510 Trp Ser Ala Met Ser Gly Phe Gln Gln Thr Met Gln Met Leu Asn Glu 515 520 525 Gly Ile Val Pro Thr Ala Met Leu Val Ala Asn Asp Gln Met Ala Leu 530 535 540 Gly Ala Met Arg Ala Ile Thr Glu Ser Gly Leu Arg Val Gly Ala Asp 545 550 555 560 Ile Ser Val Val Gly Tyr Asp Asp Thr Glu Asp Ser Ser Cys Tyr Ile 565 570 575 Pro Pro Leu Thr Thr Ile Lys Gln Asp Phe Arg Leu Leu Gly Gln Thr 580 585 590 Ser Val Asp Arg Leu Leu Gln Leu Ser Gln Gly Gln Ala Val Lys Gly 595 600 605 Asn Gln Leu Leu Pro Val Ser Leu Val Lys Arg Lys Thr Thr Ser Gly 610 615 620 Ser Glu Phe Ala Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser 625 630 635 640 Leu Ser Phe Thr Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr 645 650 655 Thr Gln Thr Asn Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn 660 665 670 Val His Asp Asn Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp 675 680 685 Asp Gly Asn Asn Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr 690 695 700 Ala Tyr Asn Ala Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr 705 710 715 720 Met Asp Asp Val Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro 725 730 735 Asn Pro Lys Lys Glu 740 <210> 18 <211> 717 <212> DNA <213> Artificial Sequence <220> <223> cDNA of tdTomato encoding SEQ ID NO: 19 <400> 18 atggtgagca agggcgagga ggtcatcaaa gagttcatgc gcttcaaggt gcgcatggag 60 ggctccatga acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag 120 ggcacccaga ccgccaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac 180 atcctgtccc cccagttcat gtacggctcc aaggcgtacg tgaagcaccc cgccgacatc 240 cccgattaca agaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc 300 gaggacggcg gtctggtgac cgtgacccag gactcctccc tgcaggacgg cacgctgatc 360 tacaaggtga agatgcgcgg caccaacttc ccccccgacg gccccgtaat gcagaagaag 420 accatgggct gggaggcctc caccgagcgc ctgtaccccc gcgacggcgt gctgaagggc 480 gagatccacc aggccctgaa gctgaaggac ggcggccact acctggtgga gttcaagacc 540 atctacatgg ccaagaagcc cgtgcaactg cccggctact actacgtgga caccaagctg 600 gacatcacct cccacaacga ggactacacc atcgtggaac agtacgagcg ctccgagggc 660 cgccaccacc tgttcctgta cggcatggac gagctgtaca agtctagagg tacctga 717 <210> 19 <211> 238 <212> PRT <213> Artificial Sequence <220> <223> tdTomato protein <400> 19 Met Val Ser Lys Gly Glu Glu Val Ile Lys Glu Phe Met Arg Phe Lys 1 5 10 15 Val Arg Met Glu Gly Ser Met Asn Gly His Glu Phe Glu Ile Glu Gly 20 25 30 Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu Lys 35 40 45 Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro 50 55 60 Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val Lys His Pro Ala Asp Ile 65 70 75 80 Pro Asp Tyr Lys Lys Leu Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg 85 90 95 Val Met Asn Phe Glu Asp Gly Gly Leu Val Thr Val Thr Gln Asp Ser 100 105 110 Ser Leu Gln Asp Gly Thr Leu Ile Tyr Lys Val Lys Met Arg Gly Thr 115 120 125 Asn Phe Pro Pro Asp Gly Pro Val Met Gln Lys Lys Thr Met Gly Trp 130 135 140 Glu Ala Ser Thr Glu Arg Leu Tyr Pro Arg Asp Gly Val Leu Lys Gly 145 150 155 160 Glu Ile His Gln Ala Leu Lys Leu Lys Asp Gly Gly His Tyr Leu Val 165 170 175 Glu Phe Lys Thr Ile Tyr Met Ala Lys Lys Pro Val Gln Leu Pro Gly 180 185 190 Tyr Tyr Tyr Val Asp Thr Lys Leu Asp Ile Thr Ser His Asn Glu Asp 195 200 205 Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ser Glu Gly Arg His His Leu 210 215 220 Phe Leu Tyr Gly Met Asp Glu Leu Tyr Lys Ser Arg Gly Thr 225 230 235 <210> 20 <211> 515 <212> DNA <213> Artificial Sequence <220> <223> Ubiquitin intron <400> 20 cgccgctcgt cctccccccc cccccctctc taccttctct agatcggcgt tccggtccat 60 ggttagggcc cggtagttct acttctgttc atgtttgtgt tagatccgtg tttgtgttag 120 atccgtgctg ctagcgttcg tacacggatg cgacctgtac gtcagacacg ttctgattgc 180 taacttgcca gtgtttctct ttggggaatc ctgggatggc tctagccgtt ccgcagacgg 240 gatcgatcta ggataggtat acatgttgat gtgggtttta ctgatgcata tacatgatgg 300 catatgcagc atctattcat atgctctaac cttgagtacc tatctattat aataaacaag 360 tatgttttat aattattttg atcttgatat acttggatga tggcatatgc agcagctata 420 tgtggatttt tttagccctg ccttcatacg ctatttattt gcttggtact gtttcttttg 480 tcgatgctca ccctgttgtt tggtgttact tctgc 515 <210> 21 <211> 693 <212> DNA <213> Artificial Sequence <220> <223> double 35S promoter <400> 21 gtctcagaag accaaagggc tattgagact tttcaacaaa gggtaatatc gggaaacctc 60 ctcggattcc attgcccagc tatctgtcac ttgatcaaaa ggacagtaga aaaggaaggt 120 ggcacctaca aatgccatca ttgcgataaaa ggaaaggcta tcgttcaaga tgcctctgcc 180 gacagtggtc ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt 240 ccaaccacgt cttcaaagca agtgaattga tgtgataaca tggtggagca cgacactctc 300 gtctactcca agaatatcaa agatacagc tcagaagacc aaagggctat tgagactttt 360 caacaaaggg tatatcggg aaacctcctc ggattccatt gcccagctat cggtcacttg 420 atcaaaagga cagtagaaaa ggaaggtggc acctacaaat gccatcattg cgataaagga 480 aaggctatcg ttcaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg 540 aggagcatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt 600 gatatctcca ctgacgtaag ggatgacgca caatcccact atccttcgca agacccttcc 660 tctatataag gaagttcatt tcatttggag agg 693 <210> 22 <211> 4075 <212> DNA <213> Artificial Sequence <220> <223> XVE / OLexA promoter system <400> 22 ttttgcaat agctcacct atataatact tcatcatttt tattagtaca tccatcacct 60 gtttagggtt aatggtttt atagactaat tttttagta catctatttt attctatttt 120 agcctctaaa ttaagaaac taaaactcta ttttagtttt tttatttaat aatttagata 180 taaaatagaaaaaaaag tgactaaaaaaaaaaaaacctttaag aaaaaaaaa 240 aactaaggaa acatttttct tgttcgagt agataatgcc agcctgttaa acgccgtcga 300 tcgacgagtc taacggacac caaccagcga accagcg tcgcgtcggg ccaagcgaag 360 cagacggcac ggcatctctg tcgctgcctc tggaccctc tcgagagttc cgctccaccg 420 ttggacttgc tccgctgtcg gcatccagaa attgcgtggc ggagcggcag acgtgagccg 480 gcacggcagg cggcctccctc ctcctcac ggcaccggca gctacgggg attccttcc 540 caccgctcct tcgcttccc ttcctcgccc gccgtaataa atagacaccc cctccacacc 600 ctctttcccc aacctcgtgt tgttcggagc gcacacac acaccagat ctcccccaaa 660 tccacccgtc ggcacctccg cttcaaggta cgccgctcgt cctccccccc cccccctctc 720 taccttctct agatcggcgt tccggtccat ggttagggcc cggtagttct acttctgttc 780 atgtttgtgt tagatccgtg tttgtgttag atccgtgctg ctagcgttcg tacacggatg 840 cgacctgtac gtcagacacg ttctgattgc taacttgcca gtgtttctct ttggggaatc 900 ctgggatggc tctagccgtt ccgcagacgg gatcgatcta ggataggtat acatgttgat 960 gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat atgctctaac 1020 cttgagtacc tatctattat aataaacaag tatgttttat aattattttg atcttgatat 1080 acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg ccttcatacg 1140 ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt tggtgttact 1200 tctgcaggta ctagtattcc gggcggaatg aaagcgttaa cggccaggca acaagaggtg 1260 tttgatctca tccgtgatca catcagccag acaggtatgc cgccgacgcg tgcggaaatc 1320 gcgcagcgtt tggggttccg ttccccaaac gcggctgaag aacatctgaa ggcgctggca 1380 cgcaaaggcg ttattgaaat tgtttccggc gcatcacgcg ggattcgtct gttgcaggaa 1440 gaggaagaag ggttgccgct ggtaggtcgt gtggctgccg gtgaaccgtc gagcgccccc 1500 ccgaccgatg tcagcctggg ggacgagctc cacttagacg gcgaggacgt ggcgatggcg 1560 catgccgacg cgctagacga tttcgatctg gacatgttgg gggacgggga ttccccgggt 1620 ccgggattta ccccccacga ctccgccccc tacggcgctc tggatatggc cgacttcgag 1680 tttgagcaga tgtttaccga tgcccttgga attgacgagt acggtgggga tccgtctgct 1740 ggagacatga gagctgccaa cctttggcca agcccgctca tgatcaaacg ctctaagaag 1800 aacagcctgg ccttgtccct gacggccgac cagatggtca gtgccttgtt ggatgctgag 1860 ccccccatac tctattccga gtatgatcct accagaccct tcagtgaagc ttcgatgatg 1920 ggcttactga ccaacctggc agacagggag ctggttcaca tgatcaactg ggcgaagagg 1980 gtgccaggct ttgtggattt gaccctccat gatcaggtcc accttctaga atgtgcctgg 2040 ctagagatcc tgatgattgg tctcgtctgg cgctccatgg agcacccagg gaagctactg 2100 ttgctccta acttgctctt ggacaggaac cagggaaat gtgtagaggg catggtggag 2160 atcttcgaca tgctgctggc tacatcatct cggttccgca tgatgaatct gcagggagag 2220 gagtttgtgt gcctcaatc tattattg cttaattctg gagtgtacac atttctgtcc 2280 agcaccctga agtctctgga agagaggac catatccacc gagtcctgga agatcaca 2340 gandactttga tccacctgat ggccaggca ggcttgaccc tgcagcagca gcaccaggcgg 2400 ctggcccagc tcctcctcat cctcccac atcaggcaca tgagtaaca aggcatggag 2460 catctgtaca gcatgaagtg caagaacgtg gtgcccctct atgacctgct gctggagatg 2520 ctggacgccc accgcctaca tgcgcccact agccgtggag gggcatccgt ggaggagacg 2580 gaccaaagcc acttggccac tgcgggctct acttcatcgc attccttgca aaagtattac 2640 atcacggggg aggcagaggg ttcctgcc acagtctgag agctccctgg cggaattccc 2700 agagatgtta gctgaaatca tcactaatca gatcaaaa tattcaatg gaatatca 2760 aaagcttctg ttcatcaa atgactcga cctactgag taagctagct tgttcgagta 2820 tttggcatt gggaaaactg ttttctttgt accatttgtt gtgcttgtaa tttactgtgt 2880 ttttattcg gttttcgcta tcgaactgtg aaatggaaat ggatggagaa gagttaatga 2940 atgatatggt ccttttgttc attctcaaat tatattatt tgttttttct cttatttgtt 3000 gtgtgttgaa tttgaaattta taagagatat gcaaacattt tgttttgagt aaaaatgtgt 3060 caaatcgtgg cctctaatga ccgaagttaa tatgaggagt aaaacactag atccccaaac 3120 aagcttggaa actgaaggcg ctcgagttac tagatcgggg aattgatccc ccctcgacag 3180 cttgcatgcc gcttgggctg caggtcgagg ctaaaaaact aatcgcatta tcatcccctc 3240 gacgtactgt acatataacc actggtttta tatacagcag tactgtacat ataaccactg 3300 gttttatata cagcagtcga cgtactgtac atataaccac tggttttata tacagcagta 3360 ctgtacatat aaccactggt tttatataca gcagtcgagg taagattaga tatggatatg 3420 tatatggata tgtatatggt ggtaatgcca tgtaatatgc tcgactctag gatcttcgca 3480 agacccttcc tctatataag gaagttcatt tcatttggag aggacacgct gaagctagtc 3540 gactctagcc tccctaggct gccggacgac gagctcctcc cccctccccc tccgccgccg 3600 ccgcgccggt aaccaccccg cccctcct cttctttct ccgttttttt ttccgtctcg 3660 gtctcgatct ttggccttgg tagtttgggt gggcgagagg cggcttcgtg cgcgcccaga 3720 tcggtgcgcg ggaggggcgg gatctcgcgg ctggggctct cgccggcgtg gatcggccc 3780 ggatctcgcg gggaatgggg ctctcggatg tagatctgcg atccgccgtt gttggggg 3840 atgatggggg gtttaaaatt tccgccatgc taaacaagat caggaagagg ggaaaagggc 3900 actatggttt atatttttat atattctgc tgcttcgtca ggcttagatg tgctagatct 3960 tcttctttct ttcttcttt tgtgggtaga atttgaatcc ctcagcattg ttcatcggta 4020 gttttcttt tcatgatttg tgacaaatgc agcctcgtgc ggagcttttt tgtag 4075 <210> 23 <211> 687 <212> DNA <213> Zea mays <400> 23 ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 60 gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 120 agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 180 taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 240 aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 300 tcgacgagtc taacggacac caaccagcga accagcagcg tcgcgtcggg ccaagcgaag 360 cagacggcac ggcatctctg tcgctgcctc tggacccctc tcgagagttc cgctccaccg 420 ttggacttgc tccgctgtcg gcatccagaa attgcgtggc ggagcggcag acgtgagccg 480 gcacggcagg cggcctcctc ctcctctcac ggcaccggca gctacggggg attcctttcc 540 caccgctcct tcgctttccc ttcctcgccc gccgtaataa atagacaccc cctccacacc 600 ctctttcccc aacctcgtgt tgttcggagc gcacacacac acaaccagat ctcccccaaa 660 tccacccgtc ggcacctccg cttcaag 687

Claims

1. A method for genetic modification in a plant cell, the method comprising (a) introducing into the plant cell (i) a nucleic acid comprising a polynucleotide sequence encoding an RKD2 polypeptide and an RKD4 polypeptide, a recombinant gene comprising the nucleic acid, or a DNA construct comprising the nucleic acid; and (ii) a transgene and / or a genome engineering component of interest, the genome engineering component being used to edit the genome of the plant cell; wherein, The polynucleotide sequences encoding the RKD2 polypeptide and the RKD4 polypeptide are operably linked to a heterologous promoter, which is directly chemically inducible or indirectly chemically inducible; wherein the RKD2 polypeptide consists of the amino acid sequence of SEQ ID NO: 5, and the RKD4 polypeptide consists of the amino acid sequence of SEQ ID NO:

2.

2. The method of claim 1, wherein the heterologous promoter is indirectly chemically inducible via an intermediary transcription factor.

3. The method of claim 1, wherein the method further comprises (b) culturing the plant cell under conditions that allow synthesis of the RKD2 polypeptide and the RKD4 polypeptide from the nucleic acid after chemical induction; or (c) culturing the plant cell under conditions that allow genetic modification of the genome of the plant cell by integration of the transgene of interest and the activity of the genome engineering components in the presence of the RKD2 polypeptide and the RKD4 polypeptide.

4. The method of claim 1, wherein the method is effective to increase the efficiency of plant regeneration.

5. The method of claim 1 or 2, wherein the method is effective to increase the regenerative capacity of the plant cells.

6. The method of claim 3, wherein in step (b), the RKD2 polypeptide or RKD4 polypeptide is synthesized from the nucleic acid following direct or indirect chemical induction of the heterologous promoter.

7. The method of claim 6, wherein the RKD2 polypeptide or the RKD4 polypeptide is synthesized from the nucleic acid after adding β-estradiol or a glucocorticoid to the plant cell.

8. The method of claim 7, wherein the glucocorticoid is dexamethasone.

9. The method of claim 1, wherein the heterologous promoter is the XVE / OLexA system for chemical β-estradiol inducibility.

10. The method of claim 9, wherein the XVE / OLexA system consists of the nucleic acid sequence of SEQ ID NO:

22.

11. The method of claim 1, wherein the heterologous promoter is an inducible bidirectional promoter.

12. The method of claim 11, wherein the inducible bidirectional promoter is operably linked to a second nucleic acid sequence encoding a desired polypeptide.

13. The method of claim 12, wherein the second nucleic acid sequence comprises a reporter gene and a polynucleotide encoding a reporter protein.

14. The method of claim 13, wherein the reporter is GUS or tdTomato.

15. The method of claim 11, wherein the inducible bidirectional promoter is a dexamethasone-inducible promoter.

16. The method of claim 15, wherein the promoter is pOp1, pOp2, pOp4 or pOp6.

17. The method of claim 16, wherein the pOp6 consists of the nucleic acid sequence of SEQ ID NO:

15.

18. The method of claim 16 or 17, wherein in step (a)(i), another nucleic acid comprising a polynucleotide sequence encoding a transcription factor operably linked to a strong constitutive promoter is introduced into the plant cell, wherein the transcription factor activates pOp6 upon binding to dexamethasone.

19. The method of claim 18, wherein the transcription factor is LhGR or LhG4.

20. The method of claim 19, wherein said LhGR consists of the amino acid sequence of SEQ ID NO: 17; or wherein said nucleic acid encoding LhGR consists of the coding sequence of SEQ ID NO:

16.

21. The method of claim 18, wherein the strong constitutive promoter is a ubiquitin promoter or a double 35S promoter.

22. The method of claim 21, wherein the double 35S promoter consists of the nucleotide sequence of SEQ ID NO:

21.

23. The method of claim 21, wherein the ubiquitin promoter consists of the nucleotide sequence of SEQ ID NO:

23.

24. The method of claim 23, wherein the ubiquitin promoter additionally comprises a ubiquitin intron consisting of the nucleotide sequence of SEQ ID NO:

20.

25. The method of claim 1, wherein the cultured plant cells do not express the reporter gene in the absence of a chemical agent effective to induce the chemically inducible promoter.

26. The method of claim 25, wherein the plant cells are cultured to produce embryonic structures.

27. The method of claim 26, wherein the embryonic structure is cultured to produce a regenerated plant.

28. The method of claim 1, wherein the RKD2 polypeptide and the RKD4 polypeptide are transiently present, transiently active and / or transiently expressed in the plant cell, and / or wherein a nucleic acid encoding a RKD2 polypeptide is transiently present, transiently active and / or transiently expressed in the plant cell, or a nucleic acid encoding a RKD4 polypeptide is transiently present, transiently active and / or transiently expressed in the plant cell.

29. The method of claim 1, wherein the nucleic acid encoding the RKD2 polypeptide consists of a nucleic acid having a coding sequence selected from the group consisting of: a) a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 3 or 4; and b) a nucleic acid that hybridizes to the complementary strand of the nucleic acid defined in a) under stringent hybridization conditions.

30. The method of claim 1, wherein the nucleic acid encoding the RKD4 polypeptide consists of a nucleic acid having a coding sequence selected from the group consisting of: a) a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 1; and b) a nucleic acid that hybridizes to the complementary strand of the nucleic acid defined in a) under stringent hybridization conditions.

31. The method of claim 1, wherein the genome engineering component comprises e) an enzyme that induces double-strand breaks or a nucleic acid encoding the same; f) an enzyme that induces single-strand breaks or a nucleic acid encoding the same; g) a base editing enzyme; or h) an enzyme that achieves DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ribosylation, or histone citrullination.

32. The method of claim 31, wherein the genome engineering component comprises e) an enzyme that induces double-strand breaks or a nucleic acid encoding the same, and a nucleic acid molecule that serves as a template for modifying genomic DNA or RNA near or at the cleavage site; or f) an enzyme that induces single-strand breaks or a nucleic acid encoding the same, and a nucleic acid molecule that serves as a template for modifying genomic DNA or RNA near or at the cleavage site.

33. The method of claim 31 or 32, wherein the base editing enzyme or the enzyme that achieves DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ribosylation or histone citrullination is fused to a disarming double-strand break or single-strand break inducing enzyme.

34. The method of claim 31 or 32, wherein the double-strand break inducing enzyme, the single-strand break inducing enzyme, the base editing enzyme, or the enzyme that effects DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ribosylation, or histone citrullination recognizes a predetermined site in the genome of the cell.

35. The method of claim 1, wherein the genome engineering component comprising a DSB or SSB inducing enzyme or a variant thereof is a CRISPR / Cas endonuclease, a zinc finger nuclease, a homing endonuclease, a meganuclease, or a TAL effector nuclease.

36. The method of claim 35, wherein the CRISPR / Cas endonuclease is selected from the group consisting of a CRISPR / Cas9 endonuclease, a CRISPR / Cpf1 endonuclease, a CRISPR / Csm1 endonuclease, a CRISPR / MAD7 endonuclease, a CRISPR / CasX endonuclease, or a CRISPR / CasY endonuclease.

37. The method of claim 1, wherein the activity of the genome engineering component in step (c) comprises inducing one or more double-strand breaks in the genome of the plant cell, one or more single-strand breaks in the genome of the plant cell, one or more base editing events in the genome of the plant cell, or one or more of DNA methylation, histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ubiquitination, histone ribosylation, or histone citrullination in the genome of the plant cell.

38. The method of claim 37, wherein after inducing the one or more double-strand breaks or the one or more single-strand breaks, non-homologous end joining is performed or the breaks are subjected to homology-directed repair (HDR) by a homologous recombination mechanism.

39. The method of claim 1, wherein the transgene in step (a)(ii) is selected from: genes encoding resistance or tolerance to abiotic stress, including drought stress, osmotic stress, heat stress, cold stress, oxidative stress, heavy metal stress, nitrogen deficiency, phosphate deficiency, salt stress or waterlogging, herbicide resistance, including resistance to glyphosate, glufosinate / phosphinothricin, hygromycin, protoporphyrinogen oxidase inhibitors, ALS inhibitors and dicamba; genes encoding resistance or tolerance to biotic stress, including viral resistance genes, fungal resistance genes, bacterial resistance genes, insect resistance genes; or genes encoding yield-related traits, including lodging resistance, flowering time, seed shattering resistance, seed color, endosperm composition or nutritional content.

40. The method of claim 1, wherein in step (c), the modification of the genome is selected from i) substitution of at least one nucleotide; ii) deletion of at least one nucleotide; iii) insertion of at least one nucleotide; iv) change in DNA methylation; v) change in histone acetylation, histone methylation, histone ubiquitination, histone phosphorylation, histone ubiquitination, histone ribosylation or histone citrullination; and vi) any combination of i)-v).

41. The method of claim 1, wherein the method is effective to promote cell proliferation or cell regeneration.

42. The method of claim 41, wherein the method is effective to promote cell proliferation or cell regeneration after genetic modification.

43. The method of claim 1, wherein the method is effective to induce embryo formation from a single cell.

44. The method of claim 43, wherein the method is effective to induce embryo formation from a single cell following genetic modification.

45. The method of claim 1, wherein said method is effective to increase the efficiency of stable transformation of said transgene into said plant cell.

46. ​​The method of claim 1, wherein said method is effective to increase the efficiency with which said genome engineering components edit the genome of said plant cell.

47. A method for producing a genetically modified plant cell, the method comprising introducing a DNA construct into the plant cell, wherein the DNA construct comprises a) a nucleic acid comprising polynucleotides encoding RKD2 and RKD4 polypeptides, the polynucleotides being operably linked to a chemically inducible bidirectional promoter, b) a reporter gene operably linked to the bidirectional promoter, and c) a third recombinant gene encoding a transcription factor, which is operably linked to a strong constitutive promoter.

48. A method for producing a genetically modified plant comprising the steps of: (c) genetically modifying a plant cell according to the method of any one of claims 1 to 46, and (d) regenerating a plant from the modified plant cell of step (a).

49. The method of claim 48, wherein the produced plant is free of any genome engineering components stably integrated into the genome of the plant.

50. Use of a nucleic acid comprising a polynucleotide encoding a RKD2 polypeptide and a RKD4 polypeptide, a recombinant gene comprising the nucleic acid, or a DNA construct comprising the nucleic acid for improving the efficiency of plant regeneration or increasing the regeneration capacity of plant cells after chemical induction, wherein the polynucleotide encoding the RKD2 polypeptide and the RKD4 polypeptide is operably linked to a heterologous promoter, and the heterologous promoter is directly chemically inducible or indirectly chemically inducible.

51. The method of claim 50, wherein the heterologous promoter is indirectly chemically inducible via an intermediary transcription factor.

52. A method for regenerating a plant comprising the steps of: a) genetically modifying a plant cell according to the method of claim 47, and b) regenerating a plant from the modified plant cell of step a).

Images