Bispecific Antibodies

Abstract

The present invention relates to a bispecific antibody comprising a first antigen binding site capable of binding to Factor VII(a) and a second antigen binding site capable of binding to TLT-1, a pharmaceutical preparation comprising such a bispecific antibody and uses thereof.

Description

[0001] Technical Field of the Invention

[0002] The present invention relates to bispecific antibodies exhibiting improved pharmaceutical properties, compositions comprising such antibodies, and uses of such antibodies and compositions, such as pharmaceutical and therapeutic uses.

[0003] Sequence Listing

[0004] This application is submitted with a sequence listing in electronic form. The entire contents of the sequence listing are incorporated herein by reference. Background of the Invention

[0006] The blood coagulation process involves several proteins that work together to produce a blood clot after vascular injury, which prevents severe loss of body fluids and / or invasion of pathogens. The cascade of events leading to blood clot formation can be initiated by two pathways known as the intrinsic (contact) and extrinsic (tissue factor) pathways. Each pathway consists of a series of zymogen activation steps, in which the newly activated enzyme catalyzes the activation of the next zymogen in the series until prothrombin is converted to thrombin. Thrombin converts fibrinogen to a fibrin mesh and activates platelets to form a platelet plug, which together lead to the formation of a stable blood clot. Initiation of the extrinsic coagulation pathway is mediated by the formation of a complex between membrane-bound tissue factor (TF), which is exposed by injury to the blood vessel wall, and low levels of circulating factor VIIa (FVIIa). The FVIIa:TF complex initiates the coagulation cascade by activating small amounts of coagulation factor IX (FIX) and factor X (FX). In the initial stage, low concentrations of FXa generate trace amounts of thrombin, which can activate factor XI and cofactors VIII and V. In the amplification phase, procoagulant complexes are assembled, which are activated by tenase (FIXa, FVIIIa, Ca 2+ , phospholipids) and prothrombinase (FXa, FVa, Ca 2 + , phospholipid) complex significantly enhances the generation of FXa and thrombin.

[0007] In patients with hemophilia A and B (HA and HB, respectively), various steps of the coagulation cascade malfunction due to the absence or deficiency of functional FVIII and FIX, respectively. This leads to impaired and insufficient coagulation, as well as potentially life-threatening bleeding, or damage to internal organs such as joints.

[0008] Recombinant FVIIa (rFVIIa) has been widely used as a bypassing agent for the on-demand (OD) treatment of bleeding in hemophilia (A and B) patients with inhibitors (HwI). rFVIIa has a short systemic half-life of 2-3 hours when administered intravenously (IV) and low bioavailability when administered subcutaneously (SC). The short systemic half-life of rFVIIa is thought to be due to several mechanisms, including the involvement of the plasma inhibitor antithrombin III (AT) ( H et al. (2010) J.Thromb.Haemost.9:333-8) and inhibition caused by α-2-macroglobulin (α2M) and renal clearance. The short systemic half-life and low SC bioavailability of rFVIIa make it challenging to use rFVIIa for preventive treatment. In addition, the low intrinsic activity of rFVIIa requires the use of higher rFVIIa dosages.

[0009] Therefore, there is a need for improved compounds that can support less frequent dosing and subcutaneous administration for prophylactic treatment.

[0010] Roche recently launched a bispecific antibody, emicizumab, which is indicated for routine prophylaxis in patients with HA and HA with inhibitors (HAwI) via subcutaneous administration once weekly. Nevertheless, the development of safe and effective molecules with alternative mechanisms of action remains an area of ​​particular interest in order to improve and supplement the standard of care for patients with hemophilia. Summary of the invention

[0011] The present invention relates to bispecific antibodies exhibiting improved pharmaceutical properties, in particular to bispecific antibodies that can be used to treat subjects with congenital and / or acquired coagulopathy, for example, for treating patients with hemophilia A or B with or without inhibitors. In addition, the present invention particularly relates to bispecific antibodies capable of binding to coagulation factor VII (FVII (a)) and TREM-like transcript 1 (TLT-1).

[0012] In one aspect, the bispecific antibody of the invention comprises (i) a first antigen binding site that binds FVII(a), and (ii) a second antigen binding site that binds TLT-1.

[0013] In one aspect of the invention, the bispecific antibody prolongs the active circulating half-life of endogenous FVIIa without losing endogenous FVIIa activity and stimulates endogenous FVIIa activity by selectively localizing it to activated platelets.

[0014] In an embodiment of the present invention, the bispecific antibody comprises an Fc region. The Fc region mediates the circulation of the bispecific antibody, thereby extending its half-life in the circulation.

[0015] In an embodiment of the invention, the first antigen binding site competes for binding to FVII(a) in a competitive ELISA assay with any one of the anti-FVII(a) antibodies comprising a light chain variable domain (VL) and a heavy chain variable domain (VH) as shown below:

[0016] mAb0522 (VL: SEQ ID NO: 846 and VH: SEQ ID NO: 850),

[0017] · Fab0883 (VL: SEQ ID NO:814 and VH: SEQ ID NO:818),

[0018] mAb0005 (VL: SEQ ID NO:750 and VH: SEQ ID NO:754),

[0019] mAb0004 (VL: SEQ ID NO:14 and VH: SEQ ID NO:18),

[0020] mAb0013 (VL: SEQ ID NO:46 and VH: SEQ ID NO:50),

[0021] mAb0018 (VL: SEQ ID NO:62 and VH: SEQ ID NO:66),

[0022] mAb0544 (VL: SEQ ID NO: 694 and VH: SEQ ID NO: 698),

[0023] mAb0552 (VL: SEQ ID NO: 702 and VH: SEQ ID NO: 706),

[0024] mAb0001 (VL: SEQ ID NO:710 and VH: SEQ ID NO:714),

[0025] mAb0007 (VL: SEQ ID NO:718 and VH: SEQ ID NO:722),

[0026] mAb0578 (VL: SEQ ID NO: 726 and VH: SEQ ID NO: 730),

[0027] mAb0701 (VL: SEQ ID NO: 734 and VH: SEQ ID NO: 738), and

[0028] • mAb0587 (VL: SEQ ID NO: 742 and VH: SEQ ID NO: 746).

[0029] In a further embodiment of the invention, the first antigen binding site of the bispecific antibody is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of FVII(a) (SEQ ID NO: 1).

[0030] In one aspect of the present invention, the bispecific antibody is formulated into a pharmaceutical preparation comprising the bispecific antibody of the present invention and a pharmaceutically acceptable carrier.

[0031] In one aspect of the invention, the bispecific antibody is administered parenterally, e.g., intravenously, intramuscularly or subcutaneously. In one aspect of the invention, the bispecific antibody allows for the prophylactic treatment of subjects with congenital and / or acquired coagulopathy such as hemophilia A, hemophilia B, hemophilia A with inhibitors, or hemophilia B with inhibitors. Therefore, the bispecific antibody is designed to provide hemostatic coverage for bleeding. In one aspect of the invention, the bispecific antibody is designed, e.g., to be suitable for weekly, monthly, or less frequent administration.

[0032] Medical treatment with the bispecific antibodies of the invention may provide a number of advantages, such as longer duration between injections, more convenient dosing, and potentially improved hemostatic protection between injections. Thus, the bispecific antibodies described herein may have a significant impact on the quality of life of individuals with hemophilia A or B with or without inhibitors.

[0033] Brief description of sequence listing

[0034] Table 1 is an overview of the corresponding SEQ ID NOs of the antibodies and their corresponding VL and VL domain sequences. The types of heavy chain constant domains are as defined in Table 2a ("M" indicates a murine IgG1 constant domain).

[0035] Table 2a is an overview of different formats for recombinant expression of bivalent antibodies, monovalent (OA) antibodies and bispecific antibodies. The SEQ ID NOs corresponding to the first heavy chain (HC-1) and the second heavy chain (HC-2, or truncated heavy chain (trHC) for OA antibodies) are listed. The light chain constant domain is in all cases a human kappa corresponding to SEQ ID NO: 12.

[0036] Table 2b is an overview of the murine anti-FVII(a) antibodies of the invention. Correspondence between clone names, abbreviations of fully murine (except hybridoma-derived, recombinantly expressed mAb0765) antibodies and corresponding murine / human chimeric variants (murine variable domains, human IgG4 S228P constant domains).

[0037] Table 2c is an overview of the antibodies in the murine and humanized 11F2 repertoire.

[0038] Table 2d is an overview of the antibodies of the anti-TLT-1 mAb0012 lineage.

[0039] Table 1:

[0040]

[0041]

[0042]

[0043]

[0044]

[0045] Table 2a:

[0046] Table 2b:

[0047]

[0048]

[0049] Table 2c:

[0050] Antibody Variable fields Constant domain mAb0005 Mouse VL / VH M mAb0048 Mouse VL / VH A Fab0076 Mouse VL / VH G mAb0077(OA) Mouse VL / VH E mAb0705(OA) Humanized VL / VH F Fab0883 Humanized VL / VH G mAb0865 Humanized VL / VH B mAb0522 Humanized VL / VH K

[0051] Table 2d:

[0052] Antibody Variable fields Constant domain mAb0012 Mouse VL / VH M mAb0082 Mouse VL C41A / VH T61A A mAb1076 Humanized VL / VH A mAb0524 Humanized VL / VH J

[0053] In the present invention, the recombinantly produced antibodies are all expressed in a human IgG4 background and all contain a standard hinge stabilizing substitution S228P (EU numbering). In some variants, the C-terminal lysine of the heavy chain (K447, rapidly cleaved in vivo; see Cai et al., Biotechnol. Bioeng. 2011 vol. 108, pp 404-412) is omitted (referred to as delta-lys). Additional substitutions were introduced into the heavy chain constant domain according to Table 2a to ensure the desired chain pairing in bispecific and monovalent antibodies (Duobody mutations F405L R409K (Labrijn et al. PNAS 2013, vol. 110, pp. 5145–5150) and knob-hole mutations (see Carter et al. J. Imm. Methods 2001, vol. 248, pp. 7-15) T366W (knob) and T366S L368A Y407V (hole)), or to extend the in vivo half-life (YTE mutations, M252Y S254T T256E (Dall'Acqua et al. J. Biol. Chem. 2006, vol. 18, pp. 23514-23524)). All recombinantly produced antibodies of the invention have a human kappa light chain constant domain (SEQ ID NO: 12). DETAILED DESCRIPTION OF THE INVENTION

[0055] The present invention relates to the design and use of antibody compositions showing improved pharmaceutical properties. In particular, it relates to bispecific antibodies capable of binding to coagulation FVII(a) and TLT-1.

[0056] Antibody

[0057] The term "antibody" herein refers to a protein derived from an immunoglobulin sequence that is capable of binding to an antigen or a portion thereof. The term antibody includes, but is not limited to, full-length antibodies of any class (or isotype), i.e., IgA, IgD, IgE, IgG, IgM and / or IgY.

[0058] Of particular interest for therapeutic antibodies is the IgG subclass, which is divided into four subclasses in humans based on the sequence of its heavy chain constant region: IgG1, IgG2, IgG3, and IgG4. Light chains can be divided into two types based on differences in their sequence composition: κ and λ chains. IgG molecules consist of two heavy chains interconnected by two or more disulfide bonds and two light chains each connected to a heavy chain by a disulfide bond. An IgG heavy chain may contain a heavy chain variable domain (V H ) and up to three heavy chain constant (C H ) Domain: C H 1. C H 2 and C H3. The light chain may include a light chain variable domain (V L ) and the light chain constant domain (C L ). H and V L The regions can be further subdivided into hypervariable regions, known as complementarity determining regions (CDRs), interspersed with more conserved regions, known as framework regions (FRs). VH and VL domains are usually composed of three CDRs and four FRs, which are arranged in the following order from amino terminus to carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The heavy and light chain variable domains containing the hypervariable regions (CDRs) constitute a structure capable of interacting with antigens, while the constant region of the antibody can mediate the binding of the antibody to the Fc receptor and the first component C1q of the C1 complex of the classical complement system.

[0059] The term "antigen binding site" or "binding portion" refers to the part of an antibody that allows antigen binding.

[0060] The term "antigen-binding fragment" of an antibody refers to a fragment of an antibody that retains the ability to bind to its cognate antigen, such as FVII(a), TLT-1, or another target molecule as described herein. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', Fab2, Fab'2, Fv, single-chain Fv (scFv), or a single V H or V L Structural domain.

[0061] The term "one-armed antibody" as used herein refers to a specific type of monovalent antibody fragment consisting of an antibody heavy chain, a truncated heavy chain lacking the Fab region, and a single light chain.

[0062] As used herein, the term "monospecific" antibody refers to an antibody (including but not limited to bivalent antibodies) that is capable of binding to one specific epitope.

[0063] The terms "bispecific antibody" and "biAb" herein refer to an antibody that is capable of binding to two different antigens, such as FVII(a) and TLT-1, or two different epitopes on the same antigen.

[0064] The bispecific antibodies of the present invention are derived from antibodies or antigen-binding fragments thereof. The bispecific antibodies of the present invention can be fusions or conjugates of antibodies and antigen-binding fragments of antibodies such as Fab, Fab', Fab2, Fab'2 or scFv. The bispecific antibodies of the present invention can also be fusions or conjugates of antibody fragments. Numerous molecular forms of bispecific antibodies derived from antibodies and antibody fragments are known in the art, see, for example (Spiess et al.: Molecular Immunology 67, (2015), pp.95–106) and (Brinkmann and Kontermann: MABS, 9 (2017), pp182–212).

[0065] Bispecific antibodies can be prepared by a variety of methods described in the art, see, for example (Spiess et al.: Molecular Immunology 67, (2015), pp. 95-106) and (Brinkmann and Kontermann: MABS, 9 (2017), pp 182-212). For example, the desired heavy chain pairing can be achieved by engineering the dimerization interface of the Fc region to promote heterodimerization. One example is the so-called knob-in-hole mutation, in which a sterically bulky side chain (knob) is introduced into an Fc that is matched by a sterically smaller side chain (hole) on the opposite Fc, thereby generating steric complementarity that promotes heterodimerization. Other methods for engineering heterodimeric Fc interfaces are electrostatic complementation, fusion with non-IgG heterodimerization domains, or utilizing the natural Fab-arm exchange phenomenon of human IgG4 to perform heterodimerization in vitro. Examples of heterodimerized bispecific antibodies are well described in the literature, for example (Klein C et al.; MAbs. 2012 4, pp 653–663). Special attention must be paid to the light chain in the heterodimeric antibody. The correct pairing of LC and HC can be achieved by using a common light chain. The engineering of the LC / HC interface can be used to promote heterodimerization or light chain cross-engineering, such as CrossMabs. Under mild reducing conditions, reassembling antibodies from two separate IgG containing appropriate mutations in vitro can also be used to produce bispecific antibodies (e.g., Labrijn et al., PNAS, 110 (2013), pp 5145-5150). Natural Fab-arm exchange methods have also been reported to ensure correct light chain pairing.

[0066] As used herein, the term "multispecific" antibody refers to an antibody that is capable of binding to two or more different antigens or two or more different epitopes on the same antigen. Therefore, multispecific antibodies include bispecific antibodies.

[0067] The antibodies of the invention can be combined with other antibodies and antibody fragments known in the art to generate bispecific, trispecific or multispecific antibody molecules.

[0068] In one aspect, the antibodies of the invention are chimeric antibodies, human antibodies or humanized antibodies. Such antibodies can be produced by using, for example, a suitable antibody display or immunization platform or other suitable platforms or methods known in the art.

[0069] In addition, if the antibody contains a constant region, the constant region or a portion thereof is also derived from human germline immunoglobulin sequences. The human antibodies of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

[0070] Human antibodies can be isolated from sequence libraries that are further diversified with natural and synthetic sequence diversity, established based on the selection of human germline sequences. Human antibodies can be prepared by in vitro immunization of human lymphocytes and subsequently transforming the lymphocytes with Epstein-Barr virus. Human antibodies can be produced by recombinant methods known in the art.

[0071] As used herein, the term "humanized antibody" refers to a human / non-human antibody containing a sequence (CDR region or part thereof) derived from a non-human immunoglobulin. Therefore, a humanized antibody is such a human immunoglobulin (acceptor antibody) in which at least the residues from the hypervariable region of the acceptor are replaced by residues from the hypervariable region of an antibody (donor antibody) of a non-human species such as a mouse, rat, rabbit or non-human primate, which has the desired specificity, affinity, sequence composition and functionality. In some cases, the framework (FR) residues of a human immunoglobulin are replaced by corresponding non-human residues. An example of such modification is the introduction of one or more so-called back mutations, which are generally amino acid residues derived from donor antibodies. The humanization of antibodies can be carried out using recombinant techniques known to those skilled in the art (see, for example, Antibody Engineering, Methods in Molecular Biology, vol. 248, edited by Benny K. Lo). The human acceptor framework suitable for both the light chain and heavy chain variable domains can be identified by, for example, sequence or structural homology. Alternatively, for example, a fixed acceptor framework can be used based on the understanding of structure, biophysics and biochemical properties. The acceptor framework can be germline derived or derived from a mature antibody sequence. The CDR region from the donor antibody can be transferred by CDR transplantation. The humanized antibody of CDR transplantation can be further optimized in terms of, for example, affinity, functionality and biophysical properties by determining the key framework position, and the amino acid residues from the donor antibody are reintroduced (back mutation) at the key framework position to have a favorable effect on the properties of the humanized antibody. In addition to the back mutation derived from the donor antibody, humanized antibodies can also be engineered by introducing germline residues, eliminating immunogenic epitopes, site-directed mutagenesis, affinity maturation, etc. in CDR or framework regions. In addition, humanized antibodies can be included in residues not found in the acceptor antibody or the donor antibody. These modifications are carried out to further improve antibody performance. Humanized antibodies can also optionally include at least a portion (Fc) of an immunoglobulin constant region, which is generally the corresponding portion of a human immunoglobulin.

[0072] As used herein, the term "chimeric antibody" refers to an antibody comprising portions of antibodies derived from two or more species. For example, the genes encoding such antibodies include genes encoding variable domains derived from two different species and genes encoding constant domains derived from two different species. For example, a gene encoding a mouse monoclonal antibody variable domain can be linked to a gene encoding a human antibody constant domain.

[0073] Antibodies or fragments thereof can be defined according to their complementary determining regions (CDRs). The term "complementarity determining region" as used herein refers to the region of an antibody in which the amino acid residues involved in antigen binding are generally located. CDRs can be identified as regions with the highest variability between antibody variable domains. Databases such as the Kabat database can be used for CDR identification, for example, CDRs are defined as amino acid residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) of the light chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) of the heavy chain variable domain; (Kabat et al. 1991; Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242). Typically, the numbering of amino acid residues in this region is performed by the method described by Kabat et al. (supra). Phrases such as "Kabat position", "Kabat residue" and "according to Kabat" herein refer to this numbering system for heavy chain variable domains or light chain variable domains. By using the Kabat numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids, which corresponds to a shortening of the framework (FR) or CDR of the variable domain or an insertion therein. For example, a heavy chain variable domain may contain an insertion of amino acids after residue 52 of CDR H2 (residues 52a, 52b and 52c according to Kabat) and an insertion of residues after heavy chain FR residue 82 (e.g., residues 82a, 82b and 82c according to Kabat, etc.). The Kabat numbering of residues for a given antibody can be determined by aligning regions of homology of the antibody sequence with sequences with "standard" Kabat numbering. Numbering is according to Kabat only when specifically stated, otherwise the numbering is consecutive according to the assigned SEQ ID NO.

[0074] The term "framework region" or "FR" residues refers to those V residues that are not within the CDRs as defined herein. H or V L Amino acid residues.

[0075] The antibodies of the invention may comprise CDR regions from one or more specific antibodies disclosed herein.

[0076] The term "antigen" (Ag) refers to a molecular entity used to immunize an immunocompetent vertebrate to produce antibodies (Ab) that recognize the Ag. Herein, Ag is referred to more broadly and is generally intended to include a target molecule recognized by Ab.

[0077] The present invention includes variants of the antibodies or antigen-binding fragments thereof of the present invention, which may comprise 1, 2, 3, 4 or 5 amino acid substitutions and / or deletions and / or insertions in the respective sequences disclosed herein.

[0078] "Substitution" variants preferably involve the replacement of one or more amino acids with the same number of amino acids.

[0079] The term "epitope" as used herein is defined in the context of molecular interactions between "antigen-binding polypeptides" such as antibodies (Ab) and their corresponding antigens (Ag). Typically, an "epitope" refers to a region or region on Ag that is bound to Ab, i.e., a region or region that is in physical contact with Ab. In the present invention, epitopes are determined using X-ray derived crystal structures that define the spatial coordinates of the complex between Ab such as a Fab fragment and its Ag. Unless otherwise noted or contradictory to context, the term epitope is defined herein as an Ag (here FVII (a) or TLT-1) residue characterized in that it has a distance of 1.5 Å from the heavy atoms in Fab. heavy atoms (i.e. non-hydrogen atoms) within a distance of .

[0080] Epitopes described at the amino acid level, e.g., determined by X-ray structure, are said to be identical if they contain the same set of amino acid residues. Epitopes are said to overlap if they share at least one amino acid residue. Epitopes are said to be different (unique) if they share no amino acid residues.

[0081] The definition of the term "paratope" is derived from the above definition of "epitope" by reversing the perspective. Thus, the term "paratope" refers to the region or area on an antibody or fragment thereof that binds to an antigen, i.e., the region or area that is in physical contact with the antigen. Unless otherwise indicated or contradictory to the context, the term paratope is defined herein as an Ab residue characterized by having a position 100 m from a heavy atom in FVII(a) or TLT-1. heavy atoms (i.e. non-hydrogen atoms) within a distance of .

[0082] The epitope on the antigen may contain one or more hotspot residues, i.e., residues that are particularly important for interaction with homologous antibodies, and wherein the interaction mediated by the side chain of the hotspot residue significantly contributes to the binding energy for antibody / antigen interaction (Peng et al., PNAS 111 (2014), E2656-E2665). Hotspot residues can be identified by testing the binding of antigen variants in which a single epitope residue has been replaced with, for example, alanine to homologous antibodies. If the epitope residue is replaced with alanine, the epitope residue is considered to be a hotspot residue, and is therefore particularly important for the binding of the antibody to the antigen.

[0083] Antibodies that bind to the same antigen can be characterized for their ability to bind to their common antigen simultaneously and can undergo "competitive binding" / "binning". In this context, the term "binning" refers to a method of grouping antibodies that bind to the same antigen. The "binning" of antibodies can be based on the competitive binding of two antibodies to their common antigen in an assay based on standard techniques. A reference antibody is used to define the "bins" of antibodies. If a second antibody cannot bind to the antigen simultaneously with the reference antibody, the second antibody is said to belong to the same "bin" as the reference antibody. In this case, the reference antibody and the second antibody competitively bind to the same part of the antigen and are therefore classified as "competing antibodies". If the second antibody can bind to the antigen simultaneously with the reference antibody, the second antibody is said to belong to a different "bin". In this case, the reference antibody and the second antibody do not competitively bind to the same part of the antigen and are therefore classified as "non-competing antibodies".

[0084] Competition assays for determining whether antibodies compete with anti-FVII (a) or anti-TLT-1 antibodies disclosed herein are known in the art. Exemplary competition assays include immunoassays (e.g., ELISA assays, RIA assays), surface plasmon resonance analysis (e.g., using BIAcore TM Instrumentation), Biolayer Interferometry and flow cytometry.

[0085] In general, competitive assays involve the use of antigens, test FVII- or FVIIa-bound antibodies and reference antibodies that are combined with solid surfaces or expressed on cell surfaces. Reference antibodies are labeled, and test antibodies are not labeled. Competitive inhibition is measured by measuring the amount of the labeled reference antibodies combined with solid surfaces or cells in the presence of test antibodies. Generally, test antibodies are present in excess (e.g., 1, 5, 10, 20, 100, 1000, 10000 or 100000 times). Antibodies identified as having competitiveness in competitive assays (i.e., competitive antibodies) include antibodies that are combined with the same epitope or overlapping epitopes as reference antibodies, and antibodies that are close enough to adjacent epitopes that sterically hindered occur in conjunction with the epitope combined with the reference antibodies.

[0086] In an exemplary competitive assay, commercially available reagents are used to biotinylate a reference anti-FVII or anti-FVIIa antibody. The biotinylated reference antibody is mixed with a serial dilution of a test antibody or an unlabeled reference antibody (from a competitive control) to obtain a mixture of a test antibody (or unlabeled reference antibody) and a labeled reference antibody at various molar ratios (e.g., 1, 5, 10, 20, 100, 1000, 10000 or 100000 times). The antibody mixture is added to an ELISA plate coated with a FVII or FVIIa polypeptide. The plate is then washed and horseradish peroxidase (HRP)-streptavidin is added to the plate as a detection reagent. The amount of labeled reference antibody bound to the target antigen is detected after the addition of a chromogenic substrate known in the art (e.g., TMB (3,3',5,5'-tetramethylbenzidine) or ABTS (2,2"-azino-bis-(3-ethylbenzothiazoline-6-sulfonate)). Optical density readings (OD units) are measured using a spectrometer (e.g., M2 spectrometer (Molecular Devices)). The response (OD unit) corresponding to 0% inhibition was determined from the wells without any competing antibody. The response (OD unit) corresponding to 100% inhibition, i.e., the assay background, was determined from the wells without any labeled reference antibody or test antibody. The percent inhibition of the labeled reference antibody of FVII or FVIIa by the test antibody (or unlabeled reference antibody) at each concentration was calculated as follows: % inhibition = (1-(OD unit-100% inhibition) / (0% inhibition-100% inhibition))*100.

[0087] Those skilled in the art will appreciate that similar assays can be performed to determine whether two or more anti-TLT-1 antibodies have a common binding region, bin and / or competitive binding antigen. Those skilled in the art will also appreciate that various detection systems known in the art can be used to perform competitive assays.

[0088] A test antibody competes with a reference antibody for binding to the antigen if an excess of one antibody (e.g., 1, 5, 10, 20, 100, 1000, 10,000, or 100,000-fold) inhibits binding of the other antibody, e.g., by at least 50%, 75%, 90%, 95%, or 99% as measured in a competitive binding assay.

[0089] Unless otherwise stated, competition was determined using the competition ELISA assay described above and provided in Examples 7 and 32.

[0090] The term "binding affinity" is used herein as a measure of the strength of a non-covalent interaction between two molecules (e.g., an antibody or fragment thereof and an antigen). The term "binding affinity" is used to describe monovalent interactions. The equilibrium dissociation constant (K D), the binding affinity between two molecules (e.g., an antibody or fragment thereof and an antigen) through a monovalent interaction can be quantified. K can be determined by measuring the kinetics of complex formation and dissociation, for example, by surface plasmon resonance (SPR) as performed in Examples 6 and 16, or other methods known in the art. D The rate constants corresponding to the association and dissociation of the monovalent complex are called the association rate constants k and k, respectively. a (or k 结合 ) and the dissociation rate constant k d (or k 解离 ). Through equation K D =k d / k a , K D With k a and k d Associated.

[0091] According to the above definition, by comparing the K of individual antibody / antigen complexes D Values ​​can be used to compare the binding affinities associated with different molecular interactions, such as comparing the binding affinities of different antibodies to a given antigen.

[0092] The K of the antibodies of the present invention against their targets D It may be less than 1pM, for example less than 10pM, for example less than 100pM, for example less than 200pM, for example less than 400pM, for example less than 600pM, for example less than 1nM, for example less than 5nM, for example less than 10nM, for example less than 20nM, for example less than 50nM, for example less than 100nM, for example less than 200nM, for example less than 400nM, for example less than 600nM, for example less than 800nM.

[0093] In one such embodiment, the antibody is a bispecific antibody comprising an anti-FVII(a) arm and a second anti-TLT-1 arm, wherein the anti-FVII(a) arm is antagonistic to the K of FVIIa. D less than 1 pM, such as less than 10 pM, such as less than 100 pM, such as less than 200 pM, such as less than 400 pM, such as less than 600 pM, such as less than 1 nM, such as less than 5 nM, such as less than 10 nM, such as less than 20 nM, such as less than 50 nM, such as less than 100 nM, such as less than 200 nM, such as less than 400 nM, such as less than 600 nM, such as less than 800 nM, and the K of the second anti-TLT-1 arm to TLT-1 DLess than 1pM, for example less than 10pM, for example less than 100pM, for example less than 200pM, for example less than 400pM, for example less than 600pM, for example less than 1nM, for example less than 5nM, for example less than 10nM, for example less than 20nM, for example less than 50nM, for example less than 100nM, for example less than 200nM, for example less than 400nM, for example less than 600nM, for example less than 800nM.

[0094] The term "identity" as known in the art refers to the relationship between the sequences of two or more polypeptides determined by comparing sequences. In the art, "identity" also represents the degree of sequence correlation between polypeptides, as determined by the number of matches between residue strings of two or more amino acid residues. "Identity" measures the percentage of identical matches with the smaller one between two or more sequences with gap alignment (if any) obtained by a specific mathematical model or computer program (i.e., "algorithm"). The identity of related polypeptides can be easily calculated by known methods. In the present invention, Needleman (Needleman et al., J.Mol.Biol.1970; 48:443-453) from EMBOSS-6.6.0 is used to determine similarity and identity, wherein parameters 10 and 0.5 (gapopen=10, gapextend=0.5) are used for gap opening and extension, respectively.

[0095] The fragment crystallizable region ("Fc region" / "Fc domain") of an antibody is the region containing the hinge and constant C H 2 and C H The C-terminal region of a 3-domain antibody.

[0096] The antibody of the present invention may include an Fc region that may have a wild-type amino acid sequence, or it may include amino acid substitutions that modulate antibody effector functions, see, for example (Wang et al.: Protein Cell. 9 (2018), pp. 63-73). A specific example of an Fc variant with modified effector functions is a variant that has reduced binding to Fcγ receptors. A specific example of such a variant is an IgG1 comprising substitutions L234A, L235E, G237A, A330S, and P331S (residue numbering according to the EU index), which has reduced affinity for certain Fcγ receptors and C1q.

[0097] Bispecific molecules

[0098] The term "bispecific molecule" herein refers to a molecule that can bind to different targets such as FVII (a) and TLT-1. The binding portion of the bispecific molecule can be derived from an antibody, or can be non-antibody derived. A specific example of a bispecific molecule is a bispecific antibody.

[0099] In one aspect of the invention, the bispecific molecule comprises a first antigen binding site capable of binding to Factor VII(a) and a second antigen binding site capable of binding to TREM-like transcript 1 (TLT-1).

[0100] The bispecific molecules of the invention may comprise a non-antibody derived binding moiety, also referred to as an alternative scaffold. The bispecific molecules of the invention may be a fusion or conjugate of an alternative scaffold. The bispecific molecules of the invention may be a fusion or conjugate of an antibody and an alternative scaffold. The bispecific molecules of the invention may also be a fusion or conjugate of an antibody fragment and an alternative scaffold.

[0101] Numerous and diverse alternative scaffolds are known in the art, see, for example (Simeon and Chen: Protein Cell 9 (2018), pp. 3–14), ( and Kolmar: Microbial Cell Factories (2018), pp. 17-32) and (Nygren and Skerra: Journal of Immunological Methods 290 (2004), pp 3–28).

[0102] Specific examples of alternative scaffolds are Adnectins, Affilins, Anticalins, Avimers, Atrimers, FN3 scaffolds, Fynomers, OBodies, Kringle domains, Kunitz domains, Knottins, Affibodies, DARPins, bicyclic peptides and Cys-knots.

[0103] Factor VII(a)

[0104] The terms "factor VII" and "FVII" herein refer to the zymogen of coagulation factor VII. The terms "factor VIIa" and "FVIIa" herein refer to activated coagulation factor VII, which is a serine protease. The terms "factor VII (a)" and "FVII (a)" herein include the uncut zymogen, factor VII (FVII), and the cleaved and thus activated protease, factor VIIa (FVIIa). The terms "factor VII (a)" and "FVII (a)" herein include natural allelic variants of FVII (a) that may exist. A wild-type human factor VII (a) sequence is provided in SEQ ID NO: 1.

[0105] Wild-type human coagulation factor VII (a) (SEQ ID NO.1):

[0106]

[0107] Wild-type FVII (a) is composed of 406 amino acid residues and is composed of four domains. There is an N-terminal domain rich in γ-carboxyglutamic acid (Gla), in which 10 glutamic acid residues (highlighted in bold in the sequence above) can be γ-carboxylated. The gla domain is followed by two epidermal growth factor (EGF)-like domains and a C-terminal serine protease domain. Both FVII and FVIIa are present in the circulation, but FVIIa is present only in low abundance (about 1% of the total FVII(a) pool; Morrissey JH, Broze Jr GJ. Tissue factor and the initiation and regulation (TFPI) of coagulation. In: Marder VJ, Aird WC, Bennett JS, Schulman S, White II GC, ed. Hemostasis and thrombosis: basic principles and clinical practice. 6th edition. Wolters Kluwer & Lippincott Williams & Wilkins: Philadelphia; 2013. p. 163–78). FVII can be activated to FVIIa by proteolytic cleavage between residues Arg152 and Ile153, thereby generating a two-chain FVIIa molecule consisting of a light chain and a heavy chain. The two chains in FVIIa are tethered by disulfide bonds. The light chain contains Gla and EGF-like domains, while the heavy chain contains a protease domain. FVIIa requires binding to its cell surface cofactor tissue factor (TF) to achieve its full biological activity.

[0108] The predicted full-length cynomolgus monkey (Macaca fascicularis) FVII isoform X1 consists of 406 amino acids, and the NCBI reference sequence ID is XP_015295043.1. The term "cFVIIa-chimera" herein refers to a chimeric cynomolgus monkey FVIIa construct. The amino acid sequence of the cFVIIa-chimera is such that Gla and the first EGF-like domain (amino acids 1-88 when aligned with the human FVIIa sequence) consist of the human FVII sequence (Uniprot ID P08709); while the second EGF-like and protease domain (amino acids 89-406 when aligned with the human FVIIa sequence) consist of the cynomolgus monkey FVII isoform X1 sequence (NCBI reference sequence ID XP_015295043.1).

[0109] When administered intravenously, recombinant FVIIa (and endogenous FVIIa) has an active half-life of about 2 to 3 hours in humans. Factor VII(a) can be endogenous, plasma-derived, or recombinantly produced using well-known production and purification methods. The extent and location of glycosylation, gamma-carboxylation, and other post-translational modifications can vary depending on the host cell selected and its growth conditions.

[0110] Factor VIIa can exist in different conformations. Factor VIIa circulates in the blood in an inactive conformation or inactive form. This conformation does not have catalytic activity. FVIIa can also exist in an active conformation or active form, also referred to herein as fully active or fully activated FVIIa. The term FVIIa includes FVIIa in an inactive form or conformation and FVIIa in an active form or conformation. For example, the active conformation of FVIIa may include a complex between FVIIa and tissue factor (FVIIa / TF), for example in the form of FVIIa / sTF (1-219), wherein sTF (1-219) is a truncated and soluble form of tissue factor, or the active conformation of FVIIa may include FVIIa (FVIIai) inhibited by the active site. FVIIai is a catalytically inert form of FVIIa that can be generated by treating FVIIa with dansyl-Glu-Gly-Arg chloroketone or Phe-Phe-Arg-chloroketone (FFR-chloroketone) (Wildgoose et al. (1990) Biochemistry 29:3413-3420 and et al. (1997) J Biol Chem 272: 11863-11868). FVIIai retains its affinity for TF and is thought to adopt the same conformation as that induced by TF binding in FVIIa. FVIIai thus has an activated conformation, and binding of the test compound to FVIIai indicates that the test compound will also bind to the activated form of wild-type FVIIa.

[0111] The target molecule of the anti-FVII(a) antibody can be any FVII(a) molecule described herein.

[0112] TREM-like transcript 1 (TLT-1)

[0113] Triggering receptors expressed on myeloid cells (TREM) have a defined role in the biology of various myeloid lineages and play an important role in the regulation of innate and adaptive immunity. TREM-like transcript (TLT)-1 belongs to this protein family, although the TLT-1 gene is only expressed in a single lineage, i.e., megakaryocytes and thrombocytes (platelets), and is only present in the alpha granules of megakaryocytes and platelets. TLT-1 is a transmembrane protein exposed on the surface of activated platelets when alpha granules are released. So far, TLT-1 has not been found on the surface of resting platelets or on the surface of any other cell type.

[0114] TLT-1 comprises an extracellular globular head, a stem region, a transmembrane domain, and an intracellular domain containing an immunoreceptor tyrosine-based inhibitory motif (Washington et al. Blood, 2002; 100: 3822-3824). The extracellular globular head of human TLT-1 (hTLT-1) is a single immunoglobulin-like (Ig-like) domain. It is connected to the platelet membrane through a 37-amino acid linker region called a stem (Gattis et al., Jour Biol Chem, 2006, 281, 19, 13396–13403).

[0115] The putative transmembrane segment of hTLT-1 is 20 amino acids long. TLT-1 also possesses a cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM), which may function as an intracellular signal transduction motif.

[0116] After platelet activation, a portion of TLT-1 is shed to form a soluble form (sTLT-1) (Gattis et al., Jour Biol Chem, 2006, 281, 19, 13396-13403). The cleavage site is adjacent to the platelet membrane. A shorter TLT-1 isoform is also present in platelets, which has a truncated intracellular domain.

[0117] TLT-1 is involved in regulating coagulation, and may also be involved in regulating inflammation at the site of injury. TLT-1 plays a role in platelet aggregation in response to non-optimal concentrations of certain platelet agonists (Giomarelli et al., Thromb Haemost 2007; 97: 955-963). The best described ligand for TLT-1 is fibrinogen (Washington et al. J Clin Invest 2009; 119: 1489-3824). Recently, it has been shown that TLT-1 also binds to von Willebrand factor (Doerr A et al., Abstract PB359 of International Society of Thrombosis and Haemostasis 2019). It is suggested that sTLT-1 plays a role in bleeding associated with sepsis by inhibiting leukocyte activation and regulating platelet-neutrophil crosstalk (Derive, J Immunol 2012, 188: 5585–5592).

[0118] For the purposes of the present invention, TLT-1 can be from any vertebrate, such as any mammal, such as rodents (such as mice, rats or guinea pigs), lagomorphs (such as rabbits), even-toed ungulates (such as pigs, cattle, sheep or camels) or primates (such as monkeys or humans). TLT-1 is preferably human TLT-1. TLT-1 can be translated from any naturally occurring genotype or allele that produces functional TLT-1 protein. A non-limiting example of human TLT-1 is the polypeptide sequence of SEQ ID NO:2.

[0119] The target molecule of the TLT-1 antibody can be any TLT-1 molecule described herein.

[0120] Anti-FVII(a) Antibodies

[0121] The term "anti-FVII(a) antibody" herein refers to an antibody that has FVII(a) as its target. Anti-FVII(a) antibodies are capable of binding to the FVII(a) molecules described herein; including but not limited to endogenous FVII(a) found in human plasma, exogenous FVII(a), such as recombinant wild-type human FVII(a), and endogenous FVII(a) found in animal plasma, such as rabbits, mice, rats, dogs or monkeys.

[0122] An "anti-FVII(a) antibody" may be a monoclonal, monospecific antibody that has FVII(a) as its target. A monospecific anti-FVII(a) antibody generally comprises two identical antigen binding sites that bind to FVII(a); a non-limiting example is a monoclonal IgG4 anti-FVII(a) antibody.

[0123] Suitable anti-FVII(a) antibodies include, but are not limited to, any one of the anti-FVII(a) antibodies shown in Table 3.

[0124] Table 3:

[0125]

[0126] Anti-FVII(a) antibodies may be able to compete with any of the antibodies shown in Table 3 for binding to FVII(a). Whether an anti-FVII(a) antibody competes with any of the antibodies shown in Table 3 for binding to FVII(a) can be determined using known methods (i.e., competitive binding assays), such as surface plasmon resonance (SPR), ELISA, or flow cytometry. Example 7 describes how to determine competitive binding to FVII(a) using a competitive ELISA.

[0127] In one embodiment, the anti-FVII(a) antibody binds to FVII(a) with high affinity. D Can be less than 1pM, for example less than 10pM, for example less than 100pM, for example less than 200pM, for example less than 400pM, for example less than 600pM, for example less than 1nM, for example less than 5nM, for example less than 10nM, for example less than 20nM, for example less than 50nM, for example less than 100nM, for example less than 200nM, for example less than 400nM, for example less than 600nM, for example less than 800nM. In vivo, high-affinity anti-FVII (a) antibodies reduce the removal of FVII (a) by forming a complex with FVII (a). Therefore, it prolongs the half-life of FVII (a) and accumulates it in circulation. In this way, the antibody can provide a steady-state FVII (a) concentration that increases.

[0128] In one embodiment, anti-FVII (a) antibodies do not interfere with the biological function of FVII (a). In one embodiment, anti-FVII (a) antibodies do not prevent endogenous FVII from being activated to FVIIa. For example, anti-FVII (a) antibodies do not interfere with the ability of FVII to be converted into FVIIa (i.e., autoactivation) when bound to TF (as described in Example 12). It is also preferred that anti-FVII (a) antibodies do not prevent FVII (a) from forming a so-called initiation complex with tissue factor (TF) and activating factor X (FX) in a manner that is dependent on or independent of TF (as described in Example 10). In one embodiment, anti-FVII (a) antibodies do not compete with FVII (a) substrates or cofactors. However, anti-FVII (a) antibodies may compete with inhibitors of FVIIa such as antithrombin (AT) and α-2-macroglobulin (as described in Example 11).

[0129] Anti-TLT-1 Antibodies

[0130] The term "anti-TLT-1 antibody" herein refers to an antibody that has TLT-1 as its target. The anti-TLT-1 antibody is capable of binding to the TLT-1 molecule described herein. The "TLT-1 antibody" can be a monoclonal, monospecific antibody.

[0131] Suitable anti-TLT-1 antibodies include, but are not limited to, the anti-TLT-1 antibodies shown in Table 4.

[0132] Table 4:

[0133]

[0134]

[0135] Anti-TLT-1 antibodies may be able to compete with any of the antibodies shown in Table 4 for binding to TLT-1. Whether an anti-TLT-1 antibody competes with any of the antibodies shown in Table 4 for binding to TLT-1 can be determined using known methods (i.e., competitive binding assays), such as surface plasmon resonance (SPR), ELISA, or flow cytometry. Competitive binding to TLT-1 can be determined using competitive ELISA. Example 32 describes how to use competitive ELISA to determine competitive binding to TLT-1.

[0136] K of anti-TLT-1 antibodies against their targets D It may be less than 1pM, for example less than 10pM, for example less than 100pM, for example less than 200pM, for example less than 400pM, for example less than 600pM, for example less than 1nM, for example less than 5nM, for example less than 10nM, for example less than 20nM, for example less than 50nM, for example less than 100nM, for example less than 200nM, for example less than 400nM, for example less than 600nM, for example less than 800nM.

[0137] Preferably, the anti-TLT-1 antibody does not interfere with the function of TLT-1, in particular does not inhibit platelet aggregation.

[0138] In a preferred embodiment, the anti-TLT-1 antibody is capable of binding to TLT-1 without interfering with platelet aggregation.

[0139] In another preferred embodiment, the anti-TLT-1 antibody is capable of binding to TLT-1 without competing with fibrinogen for binding to TLT-1.

[0140] In another preferred embodiment, the TLT-1 antibody does not interfere with the shedding of TLT-1.

[0141] Preferably, the anti-TLT-1 antibody does not bind to, or exhibits very low affinity for, any other triggering receptor expressed on myeloid cells (TREM) or any other receptor on resting or activated platelets other than TLT-1.

[0142] In one embodiment, the anti-TLT-1 antibody binds to the stalk of TLT-1.

[0143] Bispecific anti-FVII(a) / anti-TLT-1 antibody

[0144] The bispecific antibody of the present invention comprises a first antigen binding site capable of binding to FVII(a) and a second antigen binding site capable of binding to TLT-1.

[0145] Anti-FVII(a) antigen binding site

[0146] In one aspect, the bispecific antibody of the invention comprises a first antigen binding site capable of binding to FVII(a).

[0147] In some embodiments of the invention, the first antigen binding site of the bispecific antibody competes for binding to FVII(a) with any one of the anti-FVII(a) antibodies identified in Table 3; has the same epitope as any one of the antibodies identified in Table 3; has the same CDR regions as any one of the antibodies identified in Table 3; and has the same VL and VH regions as any one of the antibodies identified in Table 3.

[0148] Anti-TLT-1 antigen binding site

[0149] In one aspect, the bispecific antibody of the invention comprises a second antigen binding site capable of binding to TLT-1.

[0150] In some embodiments of the invention, the second antigen binding site of the bispecific antibody competes for binding to TLT-1 with any one of the anti-TLT-1 antibodies identified in Table 4; has the same epitope as any one of the antibodies identified in Table 4; has the same CDR regions as any one of the antibodies identified in Table 4; and has the same VL and VH regions as any one of the antibodies identified in Table 4.

[0151] Modified effector function

[0152] The bispecific antibody of the present invention may include an Fc region that may have a wild-type amino acid sequence, or it may include amino acid substitutions that modulate antibody effector functions, see, for example (Wang et al.: Protein Cell. 9 (2018), pp. 63-73). A specific example of an Fc variant with modified effector functions is a variant that has reduced binding to Fcγ receptors. A specific example of such a variant is an IgG1 comprising substitutions L234A, L235E, G237A, A330S, and P331S (residue numbering according to the EU index), which has reduced affinity for certain Fcγ receptors and C1q.

[0153] The desired property of the bispecific antibodies of the present invention is a long in vivo half-life. Bispecific antibodies comprising an Fc region can be recycled and rescued by the FcRn receptor, which in turn can lead to the desired long half-life. For bispecific antibodies of the present invention lacking an Fc region, the half-life can be extended by other means. Different methods and principles for obtaining extended polypeptide and antibody half-lives are known in the art, see, for example, Kontermann: Expert Opinion on Biological Therapy, 16 (2016), pp.903-915 and references therein.

[0154] In addition to Fc-based half-life extension of polypeptides and antibodies, fusion or conjugation with albumin or albumin variants has also been shown to be effective in extending half-life. Another method is to attach polymers such as XTEN or PEG (insert reference). In addition, extended in vivo half-life can be obtained by attaching albumin binding moieties, see, for example, Tan et al.: Current Pharmaceutical Design 24 (2018), pp. 4932-4946; Kontermann: Expert Opinion on Biological Therapy, 16 (2016), pp. 903-915 and Kontermann: Current Opinion in Biotechnology 22 (2011), pp 868–876.

[0155] Features

[0156] By combining with FVII (a), the bispecific antibody of the present invention can extend the active circulation half-life of FVIIa present in the circulation; by combining with TLT-1, the bispecific antibody and the combined FVII (a) are directed to the surface of activated platelets. This in turn leads to an increase in the accumulation of FVIIa on activated platelets, thereby enhancing the FVIIa procoagulant activity at the site of vascular injury. Therefore, the bispecific antibody described herein can confer improved pharmacokinetic (PK) and pharmacodynamic (PD) properties to endogenous FVII (a) pools.

[0157] In humans, the active half-life of the known administered recombinant FVIIa is about 2-3 hours. The short half-life of recombinant FVIIa is believed to be due to the participation of several mechanisms, including the inhibition caused by antithrombin III (AT), the inhibition caused by α-2-macroglobulin (α2M) and renal clearance. It is believed that similar mechanisms apply to endogenous FVIIa, thereby conferring it a similar short half-life.

[0158] In order to extend the active half-life of FVIIa, including the half-life of endogenous FVIIa, the bispecific antibodies described herein are intended to intercept one or more of these clearance mechanisms with the help of their anti-FVII arms or so-called "first antigen binding sites" without losing endogenous FVIIa activity. The Fc portion of the biAb:FVIIa complex will mediate the recycling of the complex in the endosome by binding to FcRn and prevent it from degradation. In addition, the high-affinity anti-FVII arm of the bispecific antibody protects endogenous FVIIa from α2M inhibition and renal clearance by virtue of the molecular size of the biAb:FVIIa complex increased compared to the size of free endogenous FVIIa. The anti-TLT-1 arm of the bispecific antibody selectively positions the endogenous FVIIa with extended action to activated platelets. This positioning of FVIIa to activated platelets strengthens FVIIa activity without increasing its sensitivity to AT inhibition.

[0159] The bispecific antibody of the present invention can increase the mean residence time (MRT) of endogenous or exogenous FVII(a). Preferably, the bispecific antibody is capable of enhancing the activity of FVII(a) in vivo.

[0160] Average stay time

[0161] Mean residence time (MRT) is the average time a molecule remains in the body and is available for therapeutic activity. MRT is calculated as a function of the steady-state volume of distribution (Vss) divided by the systemic clearance (CL) according to Equation 1.

[0162] MRT=Vss / CL Equation 1

[0163] The results are expressed in time. According to Equation 2, MRT is related to the effective plasma half-life (t 1 / 2 ) related.

[0164] MRT=ln(2)*t 1 / 2 Equation 2

[0165] The ability of an antibody to increase the MRT of FVII(a) can be determined by known methods, such as those described in Pharmacokinetic and Pharmacodynamic Data Analysis: Concepts & Applications (Gabrielsson and Weiner). For example, by analyzing the plasma concentration or activity profile of FVII(a) after intravenous or subcutaneous administration to experimental animals, such as mice, rats or monkeys. The ability of an antibody to increase the functional MRT of FVII(a) can be determined by analyzing the plasma activity profile of FVII(a), as measured by an assay such as, but not limited to, the FVIIa activity assay described in Example 8.

[0166] For example, the ability of an antibody to increase the MRT and functional MRT of FVII(a) can be determined as described in Examples 9 and 18.

[0167] In some embodiments, the bispecific antibodies of the invention are capable of increasing the MRT of FVII(a) by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, or at least 40-fold compared to administration of FVII(a) (FVII(a) polypeptide alone) in the absence of an antibody of the invention.

[0168] In some embodiments, the bispecific antibodies of the invention are capable of increasing the functional MRT of FVII(a) by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, or at least 40-fold, as measured using the FVIIa activity assay described in Example 8, compared to administration of FVII(a) in the absence of the bispecific antibodies of the invention.

[0169] Accumulation of endogenous FVIIa

[0170] For example, the ability of the bispecific antibodies of the invention to increase the levels of circulating endogenous functionally active FVIIa can be determined by measuring the levels of endogenous FVIIa before and after administration of the antibodies to an experimental animal, such as a mouse, rat or monkey, using an assay such as, but not limited to, the FVIIa activity assay described in Example 8.

[0171] For example, the ability of an antibody to increase the levels of circulating endogenous functionally active FVIIa can be determined as described in Examples 27 and 28.

[0172] In some embodiments, the bispecific antibodies of the invention are capable of increasing the level of circulating endogenous FVIIa by at least 2-fold, at least 4-fold, at least 10-fold, at least 20-fold, at least 40-fold, at least 80-fold, at least 160-fold, at least 320-fold, at least 640-fold compared to the level of circulating endogenous FVIIa in the absence of administered bispecific antibodies.

[0173] TLT-1- and TF-independent thrombin generation

[0174] In one aspect, the bispecific antibodies of the invention are capable of maintaining or increasing the ability of Factor VIIa to generate thrombin independent of TLT-1 and TF.

[0175] The ability of an antibody to increase thrombin generation of a FVII(a) polypeptide can be determined by methods well known in the art, e.g., a thrombin generation assay as described in Example 5. In this assay, thrombin generation is measured in hemophilia A-induced human plasma in the presence of phospholipids, 25 nM FVIIa, and antibodies at concentrations close to saturation of added FVIIa. Saturation is approached when >90% of FVIIa is bound by the antibody, according to the dissociation constant determined for the FVIIa-antibody interaction, e.g., as measured by SPR as illustrated in Example 6. Antibodies are classified as stimulatory (>120%), inhibitory (<90%), or neutral (90-120%) based on the ratio of peak thrombin formation in the presence and absence of the antibody.

[0176] In some embodiments, the bispecific antibodies of the invention are capable of maintaining (neutralizing) / increasing (stimulating) the ability of a Factor VII(a) polypeptide to generate thrombin as measured in a thrombin generation assay compared to FVII(a) in the absence of the antibody.

[0177] In some embodiments, the bispecific antibodies of the invention are capable of increasing the ability of Factor VII(a) to generate thrombin by at least 20% as measured in a thrombin generation assay compared to FVII(a) in the absence of the antibody.

[0178] Inhibition by antithrombin and / or alpha-2-macroglobulin

[0179] In one aspect, the bispecific antibodies of the invention are capable of reducing the sensitivity of FVIIa to inhibition by antithrombin (AT) and / or α-2-macroglobulin.

[0180] The ability of an antibody to reduce the inhibition of FVIIa by antithrombin (AT) and / or α-2-macroglobulin can be determined by methods known in the art, such as those described in Examples 5 and 11.

[0181] In some embodiments, the bispecific antibodies of the invention are capable of reducing inhibition of FVIIa by antithrombin (AT) and / or alpha-2-macroglobulin compared to inhibition of FVIIa in the absence of the antibody.

[0182] TLT-1-dependent FXa production (stimulatory activity assay)

[0183] In one aspect, the bispecific antibodies of the invention are capable of maintaining or increasing the ability of the FVIIa polypeptide to promote FX activation in the presence of a procoagulant membrane surface containing TLT-1.

[0184] The ability of the bispecific antibody of the present invention to increase the ability of the FVIIa polypeptide to promote FX activation can be determined by methods well known in the art, for example, as described in Example 21 TLT-1 dependent stimulatory activity assay. In this assay, FX activation is measured in the presence of FX (150 nM), FVIIa (2.5 nM), a phospholipid membrane containing TLT-1 (4 nM) and anti-FVII (a) / anti-TLT-1 bispecific antibodies. The so-called stimulatory activity (expressed as an increase fold) of the bispecific antibody is the amount of FXa generated in the presence of 100 nM bispecific antibodies relative to the amount generated by FVIIa in the absence of the bispecific antibody.

[0185] In some embodiments, the stimulatory activity of the bispecific antibodies of the invention is at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 60-fold, at least 80-fold, at least 100-fold, or at least 150-fold.

[0186] TLT-1-dependent whole blood clot formation

[0187] In one aspect, the bispecific antibodies of the invention are capable of promoting clot formation in hemophilia A conditions similar to or better than therapeutically effective concentrations of recombinant FVIIa.

[0188] The ability of bispecific antibodies to improve whole blood clot formation can be determined by methods well known in the art, for example, as described in Example 29 thromboelastography assay. In this assay, as described in Examples 27, 28 and 29, after repeated administration of bispecific antibodies, clot formation is measured in whole blood induced by human hemophilia A, to which bispecific antibodies and FVII, FVIIa and FVIIa:AT are added, and their concentrations simulate the in vivo steady-state plasma levels of the corresponding endogenous factors. Coagulation is induced by adding PAR1 agonist peptide SFLLRN and calcium. The coagulation time under these conditions is compared with the coagulation time reached by adding 25nM FVIIa in the absence of antibody.

[0189] In some embodiments, the bispecific antibodies of the invention are capable of shortening the clotting time in whole blood induced by human hemophilia A to a level similar to or lower than the level achieved by adding 25 nM FVIIa. In some embodiments, the bispecific antibodies of the invention are capable of shortening the clotting time in whole blood induced by human hemophilia A to a level similar to or lower than the level achieved by adding 2 nM FVIIa, 4 nM FVIIa, 6 nM FVIIa, 8 nM FVIIa, 10 nM FVIIa, 12 nM FVIIa, 16 nM FVIIa or 20 nM FVIIa.

[0190] Pharmaceutical preparations

[0191] In one aspect, the present invention provides compositions and formulations comprising the bispecific antibodies described herein. For example, the present invention provides a pharmaceutical composition comprising a bispecific antibody formulated with a pharmaceutically acceptable carrier.

[0192] In an embodiment of the present invention, the pharmaceutical formulation comprises a bispecific antibody present at a concentration of 80 mg / ml to 200 mg / ml, such as 100-180 mg / ml, and wherein the pH of the formulation is 2.0 to 10.0. The formulation may further comprise one or more of a buffer system, a preservative, a tonicity agent, a chelating agent, a stabilizer or a surfactant and various combinations thereof. The use of preservatives, isotonic agents, chelating agents, stabilizers and surfactants in pharmaceutical compositions is well known to those skilled in the art. Reference may be made to Remington: The Science and Practice of Pharmacy, 19th edition, 1995.

[0193] In one embodiment, the pharmaceutical formulation is an aqueous formulation. Such formulations are generally solutions or suspensions, but may also include colloids, dispersions, emulsions, and multiphase materials. The term "aqueous formulation" is defined as a formulation comprising at least 50% w / w water. Similarly, the term "aqueous solution" is defined as a solution comprising at least 50% w / w water, and the term "aqueous suspension" is defined as a suspension comprising at least 50% w / w water.

[0194] In another embodiment, the pharmaceutical preparation is a freeze-dried preparation to which the physician or patient adds solvents and / or diluents prior to use.

[0195] In a further aspect, the pharmaceutical formulation comprises an aqueous solution of a FVII(a) polypeptide bispecific antibody as described herein and a buffer, wherein the antibody is present at a concentration of 1 mg / ml or more, and wherein the pH of the formulation is about 2.0 to about 10.0.

[0196] The composition of the present invention can be administered parenterally, such as intravenously, intramuscularly, or subcutaneously; preferably subcutaneously. The composition of the present invention can be administered prophylactically.

[0197] The pharmaceutical composition of the present invention can be used to treat a subject suffering from a coagulopathy. As used herein, the term "subject" includes any human patient, or non-human vertebrate, suffering from a coagulopathy.

[0198] Medical Uses

[0199] As used herein, the term "treatment" refers to medical treatment of any human or other animal subject in need. The subject is expected to have undergone a physical examination performed by a licensed physician who has given a preliminary or definitive diagnosis indicating that the use of the specific treatment is beneficial to the health of the human or other animal subject. Depending on the current status of the subject's health, the timing and purpose of the treatment may vary from individual to individual. Preventive or prophylactic administration of the procoagulant compounds of the present invention is also contemplated, wherein prevention is defined as delaying or circumventing the manifestation or aggravation of one or more symptoms of a disease or disorder. Therefore, the treatment can be preventive, palliative, symptomatic ("on demand") and / or curative.

[0200] In terms of the present invention, prophylactic, palliative and / or symptomatic treatment may represent separate aspects of the invention.

[0201] The coagulopathy that causes the increased bleeding tendency can be caused by any qualitative or quantitative deficiency of any procoagulant component of the normal coagulation cascade or any upregulation of fibrinolysis. Such coagulopathy can be congenital and / or acquired and / or iatrogenic, and is determined by those skilled in the art.

[0202] Non-limiting examples of congenital hypocoagulopathies are hemophilia A, hemophilia B, factor VII deficiency, factor X deficiency, factor XI deficiency, von Willebrand disease, and thrombocytopenias such as Glanzmann thrombocytopenia and Bernard-Soulier syndrome.

[0203] A non-limiting example of an acquired coagulopathy is a serine protease deficiency caused by vitamin K deficiency; such vitamin K deficiency may be caused by the administration of vitamin K antagonists such as warfarin. Acquired coagulopathy may also occur after extensive trauma. In this case, it is also referred to as a "hemorrhagic vicious cycle", which is characterized by hemodilution (dilution thrombocytopenia and dilution of coagulation factors), hypothermia, consumption of coagulation factors, and metabolic disturbances (acidosis). Fluid therapy and increased fibrinolysis can exacerbate this situation. The bleeding may come from any part of the body.

[0204] Hemophilia A with "inhibitors" (ie, alloantibodies against Factor VIII) and hemophilia B with "inhibitors" (ie, alloantibodies against Factor IX) are non-limiting examples of coagulopathy that are partly congenital and partly acquired.

[0205] A non-limiting example of an iatrogenic coagulopathy is one induced by excessive and / or inappropriate fluid therapy, such as may be induced by blood transfusion.

[0206] In a preferred embodiment of the invention, bleeding is associated with hemophilia A. In another preferred embodiment of the invention, bleeding is associated with hemophilia B. In another preferred embodiment, bleeding is associated with hemophilia A or B with acquired inhibitors. In another preferred embodiment, bleeding is associated with FVII deficiency. In another preferred embodiment, bleeding is associated with Glanzmann thrombocytopenia. In another embodiment, bleeding is associated with von Willebrand disease. In another embodiment, bleeding is associated with severe tissue damage. In another embodiment, bleeding is associated with severe trauma. In another embodiment, bleeding is associated with surgery. In another embodiment, bleeding is associated with hemorrhagic gastritis and / or enteritis. In another embodiment, bleeding is metrorrhagia, such as in placental abruption. In another embodiment, bleeding occurs in organs where the possibility of mechanical hemostasis is limited, such as intracranial, intraauricular or intraocular. In another embodiment, bleeding is associated with anticoagulant therapy.

[0207] In further embodiments, the bleeding may be associated with thrombocytopenia. In individuals suffering from thrombocytopenia, the bispecific antibodies described herein may be co-administered with platelets.

[0208] Route of administration

[0209] The bispecific antibodies described herein may be suitable for parenteral administration, preferably intravenous and / or subcutaneous administration. Subcutaneous administration is a preferred route of administration.

[0210] Dosage regimen

[0211] The bioavailability and half-life of the bispecific antibodies described herein make them particularly attractive drugs for prophylactic subcutaneous treatment of subjects with acquired and / or congenital coagulopathy. The bispecific antibodies described herein can be administered weekly, such as once every two weeks, preferably once a month to subjects with acquired and / or congenital coagulopathy but without bleeding. The bispecific antibodies described herein can be administered preoperatively to subjects with coagulopathy and who should undergo invasive procedures such as surgery. The bispecific antibodies described herein can be administered to subjects with coagulopathy and who are undergoing invasive procedures such as surgery.

[0212] The bispecific antibodies described herein can also be co-administered with exogenous FVIIa, such as plasma-derived or recombinantly produced FVIIa, for on-demand or prophylactic treatment of subjects with coagulopathy or experiencing a bleeding episode.

[0213] The dose administered to a subject with a coagulopathy will depend on the route of administration, whether it is prophylactic or on-demand, and individual variability. Subcutaneous administration requires larger doses than intravenous administration.

[0214] In an embodiment of the invention, the bispecific antibody is administered subcutaneously at a dose of 1.0 to 30.0 nmol / kg.

[0215] Unless otherwise specified in this specification, terms presented in the singular form also include the plural case.

[0216] List of implementation plans

[0217] The present invention is further described by the following non-limiting list of embodiments of the present invention:

[0218] 1. A bispecific antibody comprising

[0219] (i) is capable of binding to the first antigen binding site of Factor VII(a), and

[0220] (ii) a second antigen binding site capable of binding to TREM-like transcript 1 (TLT-1).

[0221] 2. The bispecific antibody according to embodiment 1, wherein the first antigen binding site competes for binding to FVII(a) with any one of the anti-FVII(a) antibodies in Table 3:

[0222]

[0223] 3. The bispecific antibody according to embodiment 1, wherein the antibody competes in a competitive ELISA assay as described in Example 7.

[0224] 4. The bispecific antibody according to embodiment 1, wherein the first antigen binding site is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of FVII(a) (SEQ ID NO: 1).

[0225] 5. The bispecific antibody according to embodiment 1, wherein the first antigen binding site is capable of binding to an epitope comprising one or more of the amino acid residues H115, T130, V131 and R392 of FVII(a) (SEQ ID NO: 1).

[0226] 6. The bispecific antibody of embodiment 1, wherein the first antigen binding site is capable of binding to an epitope comprising the following amino acid residues of FVII(a) (SEQ ID NO: 1): R113, C114, H115, E116, G117, Y118, S119, L120, T130, V131, N184, T185, P251, V252, V253, Q388, M391, and R392.

[0227] 7. The bispecific antibody of embodiment 1, wherein the first antigen binding site is capable of binding to an epitope comprising one or more of the following amino acid residues of FVII(a) (SEQ ID NO: 1): R113, C114, H115, E116, G117, Y118, S119, L120, T130, V131, N184, T185, P251, V252, V253, Q388, M391, and R392.

[0228] 8. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises:

[0229] CDRL1 represented by SEQ ID NO: 847 having 0, 1, 2 or 3 amino acid substitutions

[0230] CDRL2 represented by SEQ ID NO: 848 having 0, 1, 2 or 3 amino acid substitutions

[0231] CDRL3 represented by SEQ ID NO: 849 having 0, 1 or 2 amino acid substitutions

[0232] CDRH1 represented by SEQ ID NO: 851, which has 0 or 1 amino acid substitutions

[0233] CDRH2 represented by SEQ ID NO: 852, which has 0 or 1 amino acid substitutions

[0234] • CDRL3 represented by SEQ ID NO: 853 having 0, 1, 2 and 3 amino acid substitutions.

[0235] 9. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises:

[0236] CDRL1 represented by SEQ ID NO: 847,

[0237] CDRL2 represented by SEQ ID NO: 848,

[0238] CDRL3 represented by SEQ ID NO: 849,

[0239] CDRH1 represented by SEQ ID NO: 851,

[0240] CDRH2 represented by SEQ ID NO: 852, and

[0241] • CDRH3 represented by SEQ ID NO:853.

[0242] 10. The bispecific antibody according to embodiment 1, wherein the first antigen binding site comprises a heavy chain variable domain and a light chain variable domain sequence according to the antibodies listed in Table 13 or Table 14, wherein the affinity (K D ) is 1 nM or lower.

[0243] 11. The bispecific antibody according to embodiment 1, wherein the first antigen binding site comprises a heavy chain variable domain and a light chain variable domain sequence according to the antibodies listed in Table 13 or Table 14, wherein the affinity (K D ) is 5 nM or lower.

[0244] 12. The bispecific antibody according to embodiment 1, wherein the first antigen binding site comprises a heavy chain variable domain and a light chain variable domain sequence according to the antibody listed in Table 13 or Table 14, wherein the affinity (K D ) is 10 nM or lower.

[0245] 13. The bispecific antibody according to embodiment 1, wherein the first antigen binding site comprises a heavy chain variable domain and a light chain variable domain sequence according to the antibody listed in Table 13 or Table 14, wherein the affinity (K D ) is 25 nM or lower.

[0246] 14. The bispecific antibody according to any one of the preceding embodiments, wherein the affinity (K D ) is less than 1pM, for example less than 10pM, for example less than 100pM, for example less than 200pM, for example less than 400pM, for example less than 600pM, for example less than 1nM, for example less than 5nM, for example less than 10nM, for example less than 20nM, for example less than 50nM, for example less than 100nM, for example less than 200nM, for example less than 400nM, for example less than 600nM, for example less than 800nM.

[0247] 15. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a light chain variable domain represented by SEQ ID NO: 846 and a heavy chain variable domain represented by SEQ ID NO: 850.

[0248] 16. The bispecific antibody of embodiment 15, wherein the light chain variable domain and / or heavy chain variable domain sequence has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions.

[0249] 17. The bispecific antibody according to embodiment 1, wherein the second antigen binding site competes for binding to TLT-1 with any one of the anti-TLT-1 antibodies in Table 4:

[0250]

[0251]

[0252] 18. The bispecific antibody of embodiment 17, wherein the antibody competes in a competitive ELISA assay as described in Example 32.

[0253] 19. The bispecific antibody of embodiment 1, wherein the second antigen binding site is capable of binding to an epitope comprising the following amino acid residues of TLT-1 (SEQ ID NO: 13): K8, I9, G10, S11, L12, A13, N15, A16, F17, S18, D19, P20, A21.

[0254] 20. The bispecific antibody of embodiment 1, wherein the second antigen binding site comprises:

[0255] CDRL1 represented by SEQ ID NO: 855 having 0, 1, 2 or 3 amino acid substitutions

[0256] CDRL2 represented by SEQ ID NO: 856 having 0, 1 or 2 amino acid substitutions

[0257] CDRL3 represented by SEQ ID NO: 857 having 0, 1 or 2 amino acid substitutions

[0258] CDRH1 represented by SEQ ID NO: 859, which has 0 or 1 amino acid substitutions

[0259] CDRH2 represented by SEQ ID NO: 860 having 0, 1, 2 or 3 amino acid substitutions

[0260] CDRH3 represented by SEQ ID NO: 861, which has 0 or 1 amino acid substitution

[0261] 21. The bispecific antibody of embodiment 1, wherein the second antigen binding site comprises:

[0262] CDRL1 represented by SEQ ID NO: 855,

[0263] CDRL2 represented by SEQ ID NO: 856,

[0264] CDRL3 represented by SEQ ID NO: 857,

[0265] CDRH1 represented by SEQ ID NO: 859,

[0266] CDRH2 represented by SEQ ID NO: 860,

[0267] • CDRH3 represented by SEQ ID NO:861.

[0268] 22. The bispecific antibody of embodiment 1, wherein the second antigen binding site comprises:

[0269] CDRL1 represented by SEQ ID NO: 871,

[0270] CDRL2 represented by SEQ ID NO: 872,

[0271] CDRL3 represented by SEQ ID NO: 873,

[0272] CDRH1 represented by SEQ ID NO: 875,

[0273] CDRH2 represented by SEQ ID NO: 876, and

[0274] • CDRH3 represented by SEQ ID NO:877.

[0275] 23. The bispecific antibody of embodiment 1, wherein the second antigen binding site comprises:

[0276] CDRL1 represented by SEQ ID NO: 879,

[0277] CDRL2 represented by SEQ ID NO: 880,

[0278] CDRL3 represented by SEQ ID NO: 881,

[0279] CDRH1 represented by SEQ ID NO: 883,

[0280] CDRH2 represented by SEQ ID NO: 884, and

[0281] • CDRH3 represented by SEQ ID NO:885.

[0282] 24. The bispecific antibody of embodiment 1, wherein the second antigen binding site comprises:

[0283] CDRL1 represented by SEQ ID NO: 895,

[0284] CDRL2 represented by SEQ ID NO: 896,

[0285] CDRL3 represented by SEQ ID NO: 897,

[0286] CDRH1 represented by SEQ ID NO: 899,

[0287] CDRH2 represented by SEQ ID NO:900, and

[0288] • CDRH3 represented by SEQ ID NO:901.

[0289] 25. The bispecific antibody according to embodiment 1, wherein the second antigen binding site is contained in the light chain variable domain represented by SEQ ID NO:854 and the heavy chain variable domain represented by SEQ ID NO:858.

[0290] 26. The bispecific antibody of embodiment 25, wherein the light chain variable domain and / or heavy chain variable domain sequence has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acid substitutions.

[0291] 27. The bispecific antibody according to any one of the preceding embodiments, wherein the affinity (K D ) is less than 1pM, for example less than 10pM, for example less than 100pM, for example less than 200pM, for example less than 400pM, for example less than 600pM, for example less than 1nM, for example less than 5nM, for example less than 10nM, for example less than 20nM, for example less than 50nM, for example less than 100nM, for example less than 200nM, for example less than 400nM, for example less than 600nM, for example less than 800nM.

[0292] 28. A bispecific antibody according to embodiment 1, wherein the first antigen binding site comprises a light chain variable domain represented by SEQ ID NO:846 and a heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen binding site is contained in a light chain variable domain represented by SEQ ID NO:854 and a heavy chain variable domain represented by SEQ ID NO:858.

[0293] 29. The bispecific antibody according to any one of the preceding embodiments, wherein the antibody comprises an Fc region.

[0294] 30. The bispecific antibody according to embodiment 29, wherein the Fc region is an Fc variant of the Fc region of IgG1 comprising substitutions L234A, L235E, G237A, A330S and P331S.

[0295] 31. The bispecific antibody according to any one of the preceding embodiments, wherein the antibody is a fusion or conjugate of an antigen-binding fragment of an antibody.

[0296] 32. The bispecific antibody of embodiment 31, wherein one or more of the binding fragments are selected from Fab, Fab', Fab2, Fab'2 and scFv.

[0297] 33. The bispecific antibody according to any one of the preceding embodiments, wherein the antibody is a multispecific antibody.

[0298] 34. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site is contained in a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, and wherein the heavy chain constant domains connected to the first and second heavy chain variable domains are represented by SEQ ID NOs: 5 and 4, respectively, and wherein the light chain constant domains connected to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

[0299] 35. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site is contained in a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, and wherein the heavy chain constant domains connected to the first and second heavy chain variable domains are represented by SEQ ID NOs: 943 and 942, respectively, and wherein the light chain constant domains connected to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

[0300] 36. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site is contained in a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, and wherein the heavy chain constant domains connected to the first and second heavy chain variable domains are represented by SEQ ID NOs: 7 and 6, respectively, and wherein the light chain constant domains connected to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

[0301] 37. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site is contained in a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, and wherein the heavy chain constant domains connected to the first and second heavy chain variable domains are represented by SEQ ID NOs: 4 and 5, respectively, and wherein the light chain constant domains connected to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

[0302] 38. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site is contained in a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, and wherein the heavy chain constant domains connected to the first and second heavy chain variable domains are represented by SEQ ID NOs: 942 and 943, respectively, and wherein the light chain constant domains connected to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

[0303] 39. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site is contained in a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, and wherein the heavy chain constant domains connected to the first and second heavy chain variable domains are represented by SEQ ID NOs: 6 and 7, respectively, and wherein the light chain constant domains connected to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

[0304] 40. The bispecific antibody of embodiment 1, wherein the antibody competes for binding to FVII(a) and for binding to TLT-1 with one or more bispecific antibodies listed in Table 5 (wherein the constant domain abbreviations are defined according to Table 2a):

[0305] Table 5:

[0306]

[0307]

[0308] 41. The bispecific antibody of embodiment 38, wherein the antibody competes for binding to FVII(a) and for binding to TLT-1 in a competitive ELISA with one or more bispecific antibodies listed in Table 5.

[0309] 42. The bispecific antibody of embodiment 38, wherein the antibody competes in a competitive ELISA assay as described in Example 7 and Example 32.

[0310] 43. A bispecific antibody according to embodiment 1, wherein the first antigen binding site is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of FVII(a) (SEQ ID NO: 1), and wherein the second antigen binding site is capable of binding to an epitope comprising the following amino acid residues of TLT-1 (SEQ ID NO: 13): K8, I9, G10, S11, L12, A13, N15, A16, F17, S18, D19, P20, A21.

[0311] 44. The bispecific antibody of embodiment 1, wherein the first antigen binding site comprises:

[0312] CDRL1 represented by amino acid residues (SEQ ID NO: 847) having 0, 1, 2 or 3 amino acid substitutions

[0313] CDRL2 represented by amino acid residues (SEQ ID NO: 848) having 0, 1, 2 or 3 amino acid substitutions

[0314] CDRL3 represented by amino acid residues (SEQ ID NO: 849) having 0, 1 or 2 amino acid substitutions

[0315] CDRH1 represented by the amino acid residues (SEQ ID NO: 851),

[0316] CDRH2 represented by amino acid residues (SEQ ID NO: 852) having 0 or 1 amino acid substitutions

[0317] CDRH3 represented by amino acid residues (SEQ ID NO: 853) having 0, 1, 2, and 3 amino acid substitutions, and

[0318] Wherein the second antigen binding site comprises:

[0319] CDRL1 represented by SEQ ID NO: 855 having 0, 1, 2 or 3 amino acid substitutions

[0320] CDRL2 represented by SEQ ID NO: 856 having 0, 1 or 2 amino acid substitutions

[0321] CDRL3 represented by SEQ ID NO: 857 having 0, 1 or 2 amino acid substitutions

[0322] CDRH1 represented by SEQ ID NO: 859, which has 0 or 1 amino acid substitutions

[0323] CDRH2 represented by SEQ ID NO: 860 having 0, 1, 2 or 3 amino acid substitutions

[0324] • A CDRH3 represented by SEQ ID NO: 861 having 0 or 1 amino acid substitutions.

[0325] 45. The bispecific antibody according to any of the preceding embodiments, wherein the antibody increases the functional MRT of FVII(a) as measured using the FVIIa activity assay described in Example 8.

[0326] 46. ​​The bispecific antibody of embodiment 41, wherein the antibody increases the functional MRT of FVII(a) by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, or at least 40-fold compared to administration of FVII(a) in the absence of the bispecific antibody of the invention.

[0327] 47. The bispecific antibody according to any of the preceding embodiments, wherein the antibody is capable of increasing the level of circulating endogenous functionally active FVIIa as compared to the level of circulating endogenous FVIIa in the absence of the administered bispecific antibody, as determined according to Examples 27 and 28.

[0328] 48. The bispecific antibody of embodiment 45, wherein the antibody increases the level of circulating endogenous functionally active FVIIa by at least 2-fold, at least 4-fold, at least 10-fold, at least 20-fold, at least 40-fold, at least 80-fold, at least 160-fold, at least 320-fold, at least 640-fold.

[0329] 49. The bispecific antibody according to any of the preceding embodiments, wherein the antibody is capable of enhancing the ability of the FVIIa polypeptide to promote FX activation as determined by the stimulation activity assay described in Example 21.

[0330] 50. The bispecific antibody of embodiment 43, wherein the stimulatory activity is at least 2 times, at least 5 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 60 times, at least 80 times, at least 100 times, or at least 150 times.

[0331] 51. A pharmaceutical formulation comprising the bispecific antibody according to any one of the preceding embodiments and a pharmaceutically acceptable carrier.

[0332] 52. The bispecific antibody according to embodiments 1-48, wherein the pharmaceutical formulation according to embodiment 49 is administered by subcutaneous administration.

[0333] 53. The bispecific antibody according to embodiments 1-48 or the pharmaceutical formulation according to embodiment 49 for use as a medicament.

[0334] 54. The bispecific antibody according to any one of embodiments 1-48 and 50-51 or the pharmaceutical formulation according to embodiment 49, for use in treating a coagulopathy, wherein the coagulopathy is congenital and / or acquired.

[0335] 55. The bispecific antibody of embodiment 52, wherein the coagulopathy is selected from hemophilia A with or without inhibitors, or hemophilia B with or without inhibitors, FVII(a) deficiency, and Glanzmann thrombocytopenia.

[0336] 56. A bispecific antibody for treating bleeding according to embodiments 1-48 and 50-51, wherein the bleeding is associated with congenital or acquired hemophilia A, congenital or acquired hemophilia B, hemophilia A with inhibitors, hemophilia B with inhibitors, or factor VII(a) deficiency.

[0337] 57. The use according to any one of embodiments 1-48, wherein the bispecific antibody or pharmaceutical formulation according to embodiment 49 is administered parenterally, such as intravenously, intramuscularly or subcutaneously. Example

[0338] Example 1: Generation of anti-FVII(a) mouse monoclonal antibodies using hybridoma technology

[0339] Monoclonal antibodies were prepared by immunizing NMRCF1 mice (Charles River) with a disulfide-linked complex of FVIIa Q64C-sTF (1-219) G109C described in the international patent application with publication number WO07 / 115953. Mice were initially injected subcutaneously with 20 μg in FCA (complete Freund's adjuvant), followed by a booster intraperitoneal injection with 20 μg antigen in IFA (incomplete Freund's adjuvant). The spleen was removed aseptically and dispersed into a single cell suspension. Splenocytes were fused with X63Ag8.653 myeloma cells using electrofusion. Cells were inoculated in microtiter plates and cultured at 37°C, 5% CO2. Tissue culture medium (RPMI 1640 + 10% fetal bovine serum) containing HAT (Sigma) for selection was replaced twice. After 10 days of growth, hybridoma clones producing specific antibodies were identified by ELISA screening using the following protocol. NUNC Maxisorb plates were coated with FVIIa Q64C-sTF (1-219) G109C disulfide-linked complexes or FVIIa (expressed and purified as described by Thim et al. (1988) Biochemistry 27: 7785-7793 and Persson et al. (1996) FEBS Lett 385: 241-243), 50 μl / well, 1 μg / ml (HEPES buffer containing 5 mM CaCl2), and incubated overnight at 4°C. The plates were washed 5 times and blocked in wash buffer (HEPES buffer, 5 mM CaCl2, 0.05% Tween 20) for 15 minutes. 50 μL of supernatant was transferred to each well and incubated for 1 hour. The plates were washed 5 times and 50 μl of HRP-labeled goat anti-mouse (Fcγ fragment specific; Jackson, working dilution 1 / 10000) was added. The plates were incubated for 1 hour, washed 5 times, and developed with 50 μl TMB (TMB ONE ready-to-use; Kem-En-Tec) for 10 minutes. The reaction was stopped by adding 50 μl 4M H3PO4 and read at 450 and 620 nm in a FLUOStar Optima plate reader.

[0340] Hybridomas yielding positive results were subcloned at least twice by limiting dilution to ensure monoclonality. Antibody purification was performed using standard protein A purification.

[0341] Hybridoma cells producing antibodies for PK studies were scaled up into T flasks or shake flasks in RPMI1640 + 10% FBS medium. Conditioned media were harvested by centrifugation and antibodies were purified by protein A affinity chromatography followed by desalting.

[0342] Example 2: Cloning and sequencing of mouse anti-FVII(a) antibodies

[0343] This example describes the cloning and sequencing of mouse heavy chain (HC) and light chain (LC) cDNA sequences encoding the variable domains of anti-FVII (a) antibodies. Total RNA was extracted from hybridoma cells using the RNeasy-Mini kit from Qiagen and used as a template for cDNA synthesis. cDNA was synthesized in a 5'-RACE reaction using the SMARTer RACE cDNA amplification kit from Clontech. Phusion Hot Start polymerase (Finnzymes) and the 5'-RACE cDNA amplification kit were used as forward primers included in the SMARTer TM Subsequent target amplification of the variable domain of HC (referred to as VH) and the variable domain of LC (referred to as VL) sequences was performed by PCR using the universal primer mix (UPM) in the RACE kit. The sequence of the reverse primer used for VH amplification was 5'agctgggaaggtgtgcacac 3'. The sequence of the reverse primer used for VL amplification was 5'gctctagactaacactcattcctgttgaagctcttg 3'.

[0344] PCR products were separated by gel electrophoresis, extracted using the GFXPCR DNA & Gel Band Purification kit from GE Healthcare Bio-Sciences, and cloned for sequencing using the Zero Blunt TOPO PCR Cloning kit and chemically competent TOP10 Escherichia coli (Invitrogen). Sequencing was performed using the M13uni(-21) / M13rev(-29) sequencing primers at MWG Biotech in Martinsried, Germany. All kits and reagents were used according to the manufacturer's instructions.

[0345] Example 3: Recombinant expression of bivalent antibodies, monovalent antibodies (OA antibodies) and antibody Fab fragments

[0346] Substantially according to the manufacturer's instructions, transient transfection of HEK293 suspension cells (293Expi, Invitrogen) is used to express bivalent antibodies, monovalent antibodies (one-arm is called OA antibody) and antibody Fab fragments. 293Expi cells are subcultured every 3-4 days in Expi293F expression medium (Invitrogen, catalog number A1435104) supplemented with 1% P / S (GIBCO catalog number 15140-122). Expi293F cells are transfected with a cell density of 2.5-3 million / mL using Expifectamine. For every liter of Expi293F cells, a total of 1mg plasmid DNA is diluted into 50ml Optimem (GIBCO, catalog number 51985-026, diluent A) and 2.7ml Expifectamine is diluted into 50ml Optimem (diluent B) for transfection. The bivalent antibody was produced by co-transfection of VH-CH1-CH2-CH3 (HC) and VL-CL (LC) plasmids (1:1 ratio), while for Fab fragments, the plasmids were VH-CH1 and LC (1:1 ratio). To produce the OA antibody, cells were transfected with the following three plasmids: HC plasmid, LC plasmid and a third plasmid encoding a truncated HC (trHC). The HC of the OA-antibody contains a hole mutation (T366S, L368A, Y407V), while the trHC contains a knob (T366W) mutation, but the knob and hole can also be reversed. The knob / hole mutation is described in the international patent EP0979281B1 and is introduced to optimize the formation of the desired heterodimers, i.e. the pairing of HC with trHC, and to inhibit the formation of the unwanted homodimers, i.e. the pairing of trHC with trHC and HC with HC. Dilutions A and B were mixed and incubated at room temperature for 10-20 minutes. The transfection mixture was then added to Expi293F cells and the cells were incubated in a humidified incubator at 37° C. under orbital rotation (85-125 rpm). One day after transfection, the transfected cells were supplemented with 5 ml of ExpiFectamine 293 Transfection Enhancer 1 and 50 ml of ExpiFectamine 293 Transfection Enhancer 2. Cell culture supernatants were harvested 4-5 days after transfection by centrifugation followed by filtration.

[0347] The bivalent and monovalent antibodies are purified by standard protein A affinity chromatography known to those skilled in the art, and if necessary, additional purification steps such as gel filtration or ion exchange chromatography. The Fab fragments are purified by affinity chromatography using an affinity resin that recognizes the kappa chain of the Fab.

[0348] Example 4: Preparation of bispecific antibodies and OA antibodies by in vitro assembly

[0349] Bispecific antibodies prepared by in vitro assembly

[0350] Bispecific antibodies are generated by in vitro assembly of two parental antibodies in a manner similar to that described by Labrijn et al., PNAS 2013, vol. 110, pp. 5145–5150 and are referred to as Technology (Genmab). Rather than the IgG1 subtype used by Labrijn et al. IgG4 is used in the present invention. In the presence of 75mM 2-mercaptoethylamine (2-MEA), the exchange reaction is carried out at 30°C for 4 hours. The resulting bispecific antibody is purified by ion exchange chromatography to separate the residual parent antibody from the bispecific antibody. In this embodiment, the heavy chain constant region of the first parent antibody (anti-FVII (a)) is IgG4 S228P F405L R409K, while the heavy chain constant region of the second parent antibody (anti-TLT-1) is IgG4 S228P (all using EU numbering). The light chain constant domain is human κ. These two parent antibodies are generated as described in Example 3. A bispecific anti-FVII(a) / anti-TLT-1 antibody can also be assembled from a set of parent antibodies, wherein the constant domain of the anti-FVII(a) antibody is IgG4S228P and the constant domain of the anti-TLT-1 antibody is IgG4 S228P F405L R409K.

[0351] Monovalent antibodies prepared by in vitro assembly

[0352] The monovalent antibodies are generated by in vitro assembly as described above for the bispecific antibodies, except that (1) instead of combining two antibodies to form the bispecific antibody, an antibody and a trHC dimer are combined to form the monovalent antibody. In this example, the trHC is IgG4 S228P F405L R409K, and the HC is IgG4 S228P (all using EU numbering). The light chain constant domain is human κ. Typically, the arm exchange reaction is performed with a 20-50% molar excess of trHC dimer to minimize the amount of bivalent antibody in the reaction mixture. The monovalent antibody is purified by size exclusion chromatography, optionally supplemented with additional purification steps, such as ion exchange chromatography, as needed.

[0353] Example 5: In vitro characterization of antagonism to FVIIa(a) in functional assays

[0354] In order to promote the accumulation of endogenous FVIIa and enable it to exert its procoagulant activity, the anti-FVII(a) antibodies of the present invention should preferably not impair the activity of FVIIa, and similarly preferably should not promote the inactivation of FVIIa by antithrombin, its major plasma inhibitor ( H et al. (2011) J Thromb Haemost 9:333–338). To explore these aspects, the effects of anti-FVII(a) antibodies on the procoagulant activity of FVIIa and on the inactivation of FVIIa by antithrombin were determined in vitro using the assay described below.

[0355] Effect of anti-FVII(a) antibodies on thrombin generation in human plasma induced by hemophilia A

[0356] The effect of bivalent or monovalent anti-FVII (a) antibodies on thrombin generation was measured in a kaolin-triggered thrombin generation assay (TGT) in a 96-well setup. In brief, hemophilia A-induced plasma was prepared by adding anti-hFVIII antibody 4F30 (described in the international patent application with publication number WO2012 / 035050) to a final concentration of 37.5 μg / ml. Phospholipids (Rossix) at a final concentration of 10 μM were added to hemophilia A plasma and incubated at 37°C for 15 minutes. Purified antibodies (100 nM) and FVIIa (25 nM) were added to the mixture and incubated at room temperature for 10 minutes. Anti-FVII (a) antibodies were produced as described in Examples 1, 2 and 3. Triggering was performed by adding 10 μl kaolin (Haemonetics) followed by 10 μl FIIa FluCa-kit (Thrombinoscope BV) and fluorescence was measured on an EnVision multilabel reader (excitation at 390 nm and emission at 460 nm) for two hours.

[0357] Thrombin generation test (Thrombogram) is calculated as the first derivative of measured fluorescence. Peak thrombin height is calculated as the maximum value in thrombin generation test. Subsequently by dividing the observed peak height by the peak height corresponding to the observed value of 25nM FVIIa when there is no antibody, it is normalized and expressed as percentage. Based on this, antibody is classified as irritant (>120%), inhibitory (<90%) or neutral (90%-120%). As shown in Table 6, all classes of antibodies have been identified. Preferred antibodies are irritant or neutral in TGT determination.

[0358] Effect of anti-FVII(a) antibodies on FVIIa inactivation by plasma-derived antithrombin

[0359] The inhibition of FVIIa by plasma-derived antithrombin (AT) in the presence of bivalent or monovalent anti-FVII(a) antibodies was measured by incubating FVIIa (200 nM) with low molecular weight heparin (enoxaparin, 12 μM) and antibodies (200-1000 nM) in 50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, 0.1% PEG8000, 1 mg / ml BSA (pH 7.3) for 10 min. AT (5 μM) was then added and samples were transferred to new microtiter plates at 10, 20, 30, 40, 60 and 80 minutes, where residual activity was measured at 405 nm in a Spectramax instrument (Molecular Devices) in the presence of 1 mM S-2288 chromogenic substrate (Chromogenix), 200 nM soluble tissue factor (sTF; produced as described by Freskgard et al. (1996) Protein Sci 5: 1531-1540) and polybrene (0.5 mg / ml) for 5 minutes. Samples with buffer instead of AT provided uninhibited FVIIa activity.

[0360] The residual amidolytic activity is determined as a function of the time relative to the activity in the absence of an inhibitor. The inhibition constant (kinh) is estimated by fitting the data to a single-phase decay model. The percentage of the kinh value when there is FVII (a)-antibody compared to the value measured when there is no antibody is referred to as kinh%, and is reported in Table 6 for each antibody.

[0361] Antibodies with an estimated kinh% <60% were classified as protecting FVIIa from AT inhibition. Antibodies with an estimated kinh% ≤ 60% ≤ 150% were classified as neutral, while antibodies with an estimated kinh% > 150% were classified as accelerating AT inhibition of FVIIa. As reported in Table 6, antibodies from all three categories were identified. Preferred antibodies are neutral or protect FVIIa from AT inhibition.

[0362] Among the antibodies tested, a portion including 11F2 (mAb005 and mAb0048, corresponding to fully murine and murine / human chimeras, respectively) were found to possess the desired in vitro properties as described above.

[0363] Table 6 . Functional characterization of anti-FVII(a) antibodies in thrombin generation (TGT) and antithrombin (AT) inhibition assays as described in Example 2.

[0364]

[0365] Example 6: SPR analysis of antibody binding to FVIIa and the effects of pH and calcium

[0366] The binding of the antibody from Example 5 to FVIIa was detected by surface plasmon resonance (Biacore T200). Anti-mouse IgG (provided by GE Healthcare) was fixed on a CM4 sensor chip (provided by GE Healthcare) using a standard amine coupling chemistry kit. Purified anti-FVII (a) antibodies (0.25 nM) according to Table 7 were injected at a flow rate of 10 μl / min for 1 minute. Subsequently, 5, 15, 45 and 135 nM FVIIa were injected at a flow rate of 30 μl / min for 7 minutes to allow binding to the anti-FVII (a) antibody, followed by a 9-minute buffer injection to allow dissociation from the anti-FVII (a) antibody. The running buffer was prepared by diluting 10 times 10xHBS-P buffer (provided by GE Healthcare) and supplementing 1mg / ml BSA and 5mM CaCl2 to obtain 10mM HEPES, 150mM NaCl, 0.05% v / v polysorbate 20 (P20), pH 7.4, 5mM CaCl2, 1mg / ml bovine serum albumin (BSA). The running buffer was also used to dilute anti-FVII (a) antibodies and FVII samples. The regeneration buffer (provided by GE Healthcare) consisting of 10mM Gly-HCl pH 1.7 was used to achieve the regeneration of the chip. The BiaEvaluation 4.1 provided by the manufacturer (Biacore AB, Uppsala, Sweden) was used to analyze the binding data according to the 1:1 model. The analysis resulted in the binding constants reported in Table 7, demonstrating the high affinity binding of several antibodies to FVIIa, including 11F2 (mAb005 and mAb0048, corresponding to complete mouse and mouse / human chimeras, respectively).

[0367] Table 7 Estimated binding constant for the interaction of anti-FVII(a) antibodies with FVIIa as determined by surface plasmon resonance (SPR) analysis according to Example 6.

[0368]

[0369] The effect of pH and CaCl2 on the binding of the selected antibodies from Example 5 to FVIIa and cFVIIa-chimera was detected by surface plasmon resonance (Biacore T200) at 37°C. The cFVIIa-chimera sequences are indicated in the section entitled Detailed Description of the Invention and expressed as outlined in Examples 16 and 26. Anti-mouse IgG (provided by GE Healthcare) was fixed on a CM4 sensor chip (provided by GE Healthcare) using a standard amine coupling chemistry kit. A pre-equilibrated mixture of 1.2 nM FVIIa and 0.5 nM 4F9 (NN internal anti-FVII mouse Ab bound to the FVIIa EGF1 domain) was injected at a flow rate of 10 μl / min for 1 minute. Subsequently, 540, 180, 60, 20, 6.66, 2.22, 0.74, 0.25nM anti-FVII (a) antibody was injected at a flow rate of 30 μl / min for 7 minutes to allow binding to FVIIa, followed by a 9-minute buffer injection to allow dissociation from FVIIa. Two running buffers were prepared. Buffer 1 was prepared by diluting 10x HBS-P+ (provided by GE Healthcare) 10 times and supplementing 1mg / ml BSA and 5mM CaCl2 to obtain 10mM HEPES, 150mM NaCl, 0.05% v / v polysorbate 20, pH 7.4, 5mM CaCl2, 1mg / ml bovine serum albumin (BSA). Buffer 2 was prepared by diluting 10x HBS-P+ (provided by GE Healthcare) 10 times and supplementing 1mg / ml BSA, 5μM CaCl2 and adjusting the pH to 6.0 (using 4M HCl to adjust) to obtain 10mM HEPES, 150mM NaCl, 0.05% v / v polysorbate 20, pH 6.0, 5μM CaCl2, 1mg / ml bovine serum albumin (BSA). FVIIa, anti-FVII antibody 4F9 and anti-FVII (a) antibody were diluted in these two running buffers respectively. The regeneration buffer composed of 10mM Gly-HCl pH 1.7 (provided by GE Healthcare) was used to achieve the regeneration of the chip. The BiaEvaluation 4.1 provided by the manufacturer (Biacore AB, Uppsala, Sweden) was used to analyze the binding data according to the 1:1 model. The analysis resulted in the binding constants reported in Table 7b, demonstrating the high affinity binding retained between FVIIa and anti-FVII (a) antibody.

[0370] Table 7bEstimated binding constants and fold differences for the interaction of FVIIa and anti-FVII(a) antibodies in two different buffers, as determined by surface plasmon resonance (SPR) analysis according to Example 6.

[0371]

[0372] Example 7: Identification of antibodies that compete with mAb0005 (11F2) for binding to FVII(a) in a competitive ELISA

[0373] To determine whether the anti-FVII(a) antibodies with the desired in vitro properties from Example 5 compete with mAb0005 (11F2) and its derivative antibodies for binding to FVIIa(a), competition studies were performed using the corresponding Fab fragment Fab0076. FVIIa, HD-Phe-Phe-Arg chloromethyl ketone (FFR-cmk; Bachem, Switzerland) active site inhibited FVIIa (FVIIai; see Example 9) was immobilized overnight at 4°C on NUNC maxisorp plates at a concentration of 125 ng / ml in dilution buffer (20 mM HEPES, 5 mM CaCl2, 150 mM NaCl, pH 7.2). The plates were washed and blocked for 15 minutes in wash buffer (20 mM HEPES, 5 mM CaCl2, 150 mM NaCl, 0.5 mL / L Tween 20, pH 7.2). Using standard biotinylation kit (EZ-Link, Thermo), 11F2-Fab0076 is biotinylated according to the manufacturer's instructions. For competition studies, the final fixed concentration is 10ng / ml of biotinylated Fab0076 combined with a series of diluted anti-FVIIa (a) antibodies to obtain a final concentration in the range of 100mg / ml to 9.5ng / ml in dilution buffer. The mixture is added to the wells of the plate and incubated for 1 hour. The plate is then washed and HRP-labeled streptavidin-HRPO (1: 2000 in dilution buffer; Kirkegaard & PerryLabs) is added and incubated for 1 hour. Finally, the plate is washed and developed with TMB ONE (KEMENTEC) for 10 minutes. The reaction is terminated by adding H3PO4 (4M), and the plate is read at 450nm in a FLUOStar Optima microplate reader, minus the background signal measured at 620nm. Unless otherwise stated, all incubations were performed at room temperature and plates were washed 5 times with wash buffer.

[0374] Based on the measured signal (OD units), competition at any given antibody concentration was calculated as

[0375] % inhibition = (1-(OD units-100% inhibition) / (0% inhibition-100% inhibition))*100 where 0% inhibition is determined by the signal in the wells without any competing anti-FVII(a) antibody, and 100% inhibition is determined as the signal from the wells without biotinylated Fab0076 (i.e. corresponding to the assay background). If at least 50% inhibition (% inhibition) is observed when testing antibody concentrations at up to 10,000-fold excess of biotinylated Fab0076, the antibody is considered to compete with 11F2 (mAb0005) for binding to FVII(a). The results are summarized in Table 8.

[0376] Table 8 Competition with 11F2-Fab0076 (mAb0005) for binding to FVII(a). Antibodies were classified as competitors or non-competitors using a cutoff of 50% as described in Example 7.

[0377]

[0378]

[0379] Example 8: FVIIa activity assay

[0380] Essentially as described by Morissey JH et al., Blood, 1993; 81: 734-44, using The reagent of VIIa-rTF kit (Diagnostica Stago) measures FVIIa activity. The assay is performed on the ACLTOP500 automated coagulation instrument from Instrumentation Laboratory. In the assay, 40 μl diluted animal plasma samples, calibrators (recombinant FVIIa (rFVIIa) reference materials calibrated for international WHO references) or quality control (QC) samples are mixed with 40 μl plasma lacking FVII and 40 μl soluble tissue factor (sTF) and phospholipids. A volume of 40 μl of 25 mM CaCl2 is added to start the reaction, and the clotting time is measured by the instrument. The sample and QC clotting time are compared with the rFVIIa calibration curve, and the plasma concentration is the same as the diluted sample to alleviate the interference of plasma. The calibration curve range is 5-1000 mIU / mL, and a cubic polynomial equation is used for fitting. QC and sample results are calculated by the software on the ACLTOP500 instrument. Results in IU / mL were converted to nM using the specific activity of the administered compound (IU / pmol).

[0381] Example 9: Pharmacokinetics of recombinant FVIIa co-formulated with anti-FVII(a) antibody in rats

[0382] The monoclonal anti-FVII(a) antibody with the desired in vitro properties from Example 5 was intravenously administered to male Sprague Dawley rats in a co-formulation with 20 nmol / kg human FVIIa. The molar ratio of FVIIa to antibody was 1:1 or 1:5, as shown in Table 9. During the experiment, animals were allowed to eat and drink freely. FVIIa plasma activity was measured using the FVIIa activity assay as described in Example 8.

[0383] Pharmacokinetic analysis was performed using WinNonlin by non-compartmental methods. Mean residence time (MRT) was calculated from the data. The results are given in Table 9.

[0384] Of the antibodies from Example 5 with the desired properties, mAb0005 (11F2) and mAb0001 (11F26) conferred the longest mean residence times for human FVIIa, 7.9 and 7.5 hours, respectively, compared to a free mean residence time of 1.1 hours for free human FVIIa (see Table 9). mAb0005 and mAb0001 (mAb0759) are high affinity antibodies (Example 6) that exhibit competitive binding to FVIIa (Example 7).

[0385] Table 9 Mean residence time (MRT) of FVIIa plasma activity in sprague dawley rats following intravenous administration of 20 nmol / kg FVIIa at a molar ratio of 1:1 or 1:5 to the indicated antibodies. Vehicle indicates administration of FVIIa in combination with buffer instead of antibody.

[0386] Anti-FVII(a) Antibodies Molar ratio of FVIIa:antibody MRT(h) vehicle na 1.1 mAb0005 1:5 7.9 mAb0007 1:1 3.9 mAb0018 1:5 1.1 mAb0004 1:5 3.6 mAb0001 1:1 7.5 mAb0587 1:1 4.0 mAb0578 1:1 4.2

[0387] Example 10: Effect of 11F2 anti-FVII(a) antibody on FX activation by free or TF-complexed FVIIa

[0388] Preferably, the anti-FVII (a) antibody of the present invention should not interfere with the pharmacological action of FVIIa on the membrane surface or the initiation of coagulation, i.e., the activation of FX by the FVIIa-TF complex. In order to explore these aspects, the effects of 11F2 on the TF-independent and TF-dependent proteolytic activity of FVIIa were determined in the absence or presence of lipidated TF, respectively. A one-armed monovalent antibody format was used to avoid the avidity effect caused by the simultaneous binding of two FVIIa molecules to a normal bivalent antibody.

[0389] Effect of 11F2 antibody on FX activation by FVIIa in the presence of phospholipid membrane

[0390] Activity assay was performed in an assay buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, pH 7.3, 0.1% PEG8000, and 1 mg / ml BSA) containing 10 nM FVIIa, 0 or 200 nM antibody (see Table 10) and 25 μM 25:75 phosphatidylserine: phosphatidylcholine vesicles (Haematologic Technologies Inc.). The reaction was initiated by adding 0-300 nM human plasma derived factor X (FX) and incubated at room temperature for 20 minutes (n=2) in a total reaction volume of 100 μl in a 96-well plate. After incubation, the reaction was quenched by adding 50 μl quenching buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, 80 mM EDTA, pH 7.3), followed by the addition of 50 μl 1 mM S-2765 chromogenic substrate (Chromogenix) aqueous solution. The conversion of the generated FXa to the chromogenic substrate was measured using a Spectramax microplate spectrophotometer as the slope of the linear absorbance increase at 405 nm over 10 minutes. The initial rate of FXa generation on a molar basis can be estimated by correlating the measured slope with the slope generated under similar conditions using known amounts of plasma-derived human FXa. Enzyme kinetic parameters were estimated using GraphPad Prism by nonlinear curve fitting of the data to the Michaelis-Menten equation (v = kcat*[FX]*[FVIIa-TF] / (Km+[FX])).

[0391] As shown in Table 10, monovalent 11F2 did not affect the rate of FX activation by free FVIIa in the presence of phospholipid vesicles.

[0392] Effect of 11F2 antibody on FX activation by FVIIa in the presence of TF

[0393] Activity assays were performed as described by Smith and Morrissey (2005) J. Thromb. Haemost., 2: 1155-1162 in assay buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, pH 7.3, 0.1% PEG8000, and 1 mg / ml BSA) containing 100 pM FVIIa, 0 or 200 nM antibody (see Table 10), and 2 pM E. coli derived TF fragment 1-244 incorporated into 25:75 phosphatidylserine:phosphatidylcholine (PS:PC) vesicles. Reactions were initiated by the addition of 0-30 nM human plasma derived factor X (FX) and incubated in a 96-well plate in a total reaction volume of 100 μl for 20 minutes at room temperature (n=2). After incubation, the reaction was quenched and FXa was quantified as described above.

[0394] As shown in Table 10, monovalent 11F2 (mAb0077(OA)) did not affect the rate of FX activation by the FVIIa / TF complex.

[0395] Table 10 Effect of 200 nM monovalent form of 11F2 on the kinetic parameters of FX activation by FVIIa-TF complex according to embodiment 10. Parameters shown as mean ± SD (n = 3) were estimated by fitting the Michaelis-Menten equation. cat / K M Shown are relative to values ​​determined in the absence of antibody.

[0396]

[0397] Example 11: Effect of 11F2 antibody on the inhibition of FVIIa by plasma inhibitors

[0398] FVIIa exhibits a relatively short half-life in the circulation, in part because it is inactivated by the abundant plasma inhibitor antithrombin (AT). Similarly, animal studies have shown that another plasma inhibitor, alpha-2-macroglobulin, is involved in the inactivation of FVIIa. Using purified plasma-derived inhibitors, the effects of the monovalent 11F2 antibody on the inactivation of FVIIa by these inhibitors were investigated.

[0399] Effect of 11F2 antibody on the inhibition of FVIIa by antithrombin

[0400] In the presence of monovalent 11F2 antibodies (mAb0048, mAb0077 (OA)), inhibition of FVIIa with human plasma derived AT was performed under pseudo first order conditions. The assay was performed at room temperature in an assay buffer (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, 0.1% PEG8000, 1 mg / ml BSA, pH 7.3) containing 200 nM FVIIa, 12 μM low molecular weight heparin (enoxaparin, European Pharmacopoeia Reference, Code E0180000, Batch 5.0, Id 00CK18) and 0 or 1000 nM antibody in a volume of 200 μl. After a pre-incubation of 10 minutes, the reaction was initiated by adding 5 μM AT (antithrombin III, Baxter, Lot VNB1M007; repurified on a heparin-Sepharose column to remove serum albumin from the formulation). At selected time points, 10 μl aliquots were transferred to a total volume of 200 μl containing 0.5 mg / ml polybrene (hexadimethoxine bromide, Sigma, catalog number H9268, batch SLBC8683V), 200 nM sTF and 1 mM S-2288 (Chromogenix) to quench the reaction and saturate FVIIa with sTF, which allows measurement of residual FVIIa activity from chromogenic substrate hydrolysis monitored for 5 minutes at 405 nm. Residual amidolytic activity was determined as the slope of the linear progression curve after blank subtraction, and these curves were subsequently fitted to a first-order exponential decay function using GraphPad Prism software to obtain the pseudo-first-order rate constant (kapp) of the reaction. The apparent second-order rate constant (kinh) was estimated by dividing kapp by the AT concentration.

[0401] From this analysis, the inhibition rate of FVIIa in the presence of monovalent 11F2 (mAb0077(OA)) was found to be 133±10 M -1 s -1 In contrast, the inhibition of free FVIIa was 124 ± 7 M -1 s -1 .

[0402] Effect of 11F2 antibody on the inhibition of FVIIa by α-2-macroglobulin

[0403] Under pseudo first order conditions, α-2-macroglobulin derived from human plasma was used to inhibit FVIIa in the presence of 0 or 1000 nM monovalent 11F2 antibody (mAb0077 (OA)). The assay was performed at room temperature in an assay buffer (50 mM HEPES, 100 mM NaCl, 5 mM CaCl2, 0.1% PEG8000, 0.01% Tween 80, pH 7.3) containing 200 nM FVIIa and 0 or 1000 nM antibody. The reaction was initiated by adding 0 or 1000 nM α-2-macroglobulin purified from human plasma as described by Banbula et al. (2005) J. Biochem., 138: 527-537. At selected time points, 10 μl aliquots were transferred to 190 μl buffer (50 mM HEPES, 100 mM NaCl, 5 mM CaCl2, 0.1% PEG8000, 1 mg / ml BSA, pH 7.3) containing 200 nM sTF and 1 mM S-2288 (Chromogenix), which allowed the measurement of residual FVIIa activity from the hydrolysis of the chromogenic substrate monitored for 5 minutes at 405 nM. The residual amidolytic activity was determined as the slope of the linear progression curve after blank subtraction, and these curves were subsequently fitted to a first-order exponential decay function using GraphPad Prism software to obtain the pseudo first-order rate constant (kapp) of the reaction. The apparent second-order rate constant (kinh) was estimated by dividing kapp by the α-2-macroglobulin concentration.

[0404] In the absence of antibody, the apparent second-order rate constant for the inhibition of FVIIa by α-2-macroglobulin was found to be 475 ± 21 M -1 s -1 However, in the presence of the monovalent 11F2 antibody (mAb0077(OA)), no significant inhibition of FVIIa was observed before the last time point of 125 minutes. From these studies it can be concluded that 11F2 does not affect the inhibition of FVIIa by antithrombin, but rather protects FVIIa from inhibition by α-2-macroglobulin.

[0405] Example 12: Effect of 11F2 Antibody on FVII Autoactivation

[0406] After vascular injury, endogenous FVII binds with high affinity to its cofactor tissue factor (TF), which is exposed on cells surrounding the vascular endothelium. During this process, FVII is converted to FVIIa by limited proteolysis. Activation is believed to occur as a result of TF-mediated FVIIa-FVII transactivation (also known as autoactivation). In order to determine the effect of 11F2 antibody on FVII autoactivation, FVII activation was measured in the presence of lipidated TF, FVII, limiting concentrations of FVIIa, and monovalent 11F2 antibody.

[0407] Activity measurements were performed in assay buffer (50 mM HEPES, 100 mM NaCl, 5 mM CaCl2, pH 7.3, containing 0.1% PEG8000 and 1 mg / ml BSA) containing 2 nM FVIIa, 145 nM FVII, 0 or 200 nM monovalent 11F2 antibody (mAb0077 (OA)). The reaction was initiated by adding 2 nM lipidated E. coli derived TF fragment 1-244 incorporated into 25:75 PS: PC vesicles as described by Smith and Morrissey (2005) J. Thromb. Haemost., 2: 1155-1162. The total reaction volume was 100 μl. At selected time points (usually 5, 10, 15, 20, 30, 40, 50 and 60 minutes), the generated FVIIa was quantified according to the subsampling procedure described below.

[0408] Quantification of FVIIa by subsampling - At selected time points, 10 μl samples were transferred to 140 μl 50 mM HEPES, 100 mM NaCl, 5 mM EDTA containing 0.1% PEG8000, 1 mg / ml BSA and 215 nM soluble tissue factor (sTF) to quench it. After all samples were collected, the FVIIa chromogenic activity was measured by adding 50 μl S-2288 (4 mM) in 60 mM CaCl2. The conversion of the generated FVIIa to the chromogenic substrate was measured using a Spectramax microplate reader with the slope of the linear absorbance increase at 405 nM in 10 minutes. The molar concentration of FVIIa can be estimated by correlating the measured slope with the slope generated under similar conditions using a known amount of FVIIa.

[0409] FVIIa autoactivation was found to be TF-dependent, and the FVIIa activity measured in Table 11 indicated that it was not impaired by the presence of the monovalent 11F2 antibody.

[0410] Table 11: TF-mediated FVIIa autoactivation according to embodiment 12 in the absence or presence of 200 nM monovalent 11F2 antibody mAb0077 (OA)

[0411]

[0412] Example 13: Crystal structure of 11F2-Fab0076 in complex with active site inhibited FVIIa and soluble tissue factor

[0413] To determine the epitope on FVII(a) recognized by the murine antibody 11F2, the corresponding Fab fragment (Fab0076) was crystallized in complex with FVIIa (FVIIai) with active site inhibition by HD-Phe-Phe-Arg chloromethyl ketone (FFR-cmk; Bachem, Switzerland) and soluble tissue factor fragment 1-219 (sTF) using the hanging drop method described by Kirchhofer.D. et al., Proteins Structure Function and Genetics. (1995), 22, 419-425.

[0414] crystallization

[0415] Crystals of Fab0076 mixed with FVIIai / sTF complex at a 1:1 molar ratio were grown using the hanging drop vapor diffusion technique at 18° C. 1 μl of a 4.6 mg / ml protein solution of the protein complex in 10 mM HEPES, 50 mM NaCl, 5 mM CaCl2 (pH 7.0) was mixed with 0.5 μl of 100 mM sodium citrate (pH 6.2) and 20% PEG6000 as a precipitant and incubated on 1 ml of the precipitant solution at a temperature of 18° C. to obtain crystals of the complex.

[0416] Diffraction data collection

[0417] Before rapid cooling in liquid nitrogen, the crystals were cryoprotected in a solution consisting of 75 mM sodium citrate (pH 6.2), 15% PEG 6000, 4% glycerol, 4% ethylene glycol, 4.5% sucrose and 1% glucose. Diffraction data were collected at 100 K at beamline I911-3 at MAX-lab (Lund, Sweden) using a marCCD225 detector from MAR Research. Automatic indexing, integration and scaling of data were performed using a program from the XDS package (diffraction data statistics are summarized in Table 12).

[0418] Structure determination and refinement

[0419] The structure was determined by molecular replacement using Phaser as implemented in the program suite Phenix with the A and B chains of Protein Data Bank entry 1YY8 and Protein Data Bank entry 3ELA. The asymmetric unit contains two Fab: FVIIai / sTF complexes. The model was refined using Phenix refinement and a manual rebuild step in COOT. Refinement statistics are shown in Table 12.

[0420] Table 12 : Data collection and refinement statistics from the X-ray crystallographic structure determination of the complex between active site inhibited FVIIa, soluble tissue factor (sTF) and Fab0076. Statistics for the highest resolution shell are shown in parentheses.

[0421]

[0422]

[0423] Epitopes were found (defined as those in FVIIai with a distance less than or equal to that of a non-hydrogen atom in Fab0076 The residues containing non-hydrogen atoms within a distance of 100 Å) include the following residues according to SEQ ID NO: 1:

[0424] R113

[0425] C114

[0426] H115

[0427] E116

[0428] G117

[0429] Y118

[0430] S119

[0431] L120

[0432] T130

[0433] V131

[0434] N184

[0435] T185

[0436] I186

[0437] P251

[0438] V252

[0439] E265

[0440] M391

[0441] R392

[0442] E394

[0443] The paratope (defined as the region in Fab0076 with a distance less than or equal to that of a non-hydrogen atom in FVIIai) was found. The residues of non-hydrogen atoms within a distance of ) include the following light chain residues according to SEQ ID NO: 64:

[0444] Q27

[0445] G28

[0446] S30

[0447] D31

[0448] Y32

[0449] K49

[0450] Y50

[0451] Q53

[0452] H92

[0453] S93

[0454] F94

[0455] and the heavy chain residues according to SEQ ID NO:63:

[0456] D32

[0457] Y54

[0458] N59

[0459] N101

[0460] Y102

[0461] Y103

[0462] G104

[0463] N105.

[0464] Example 14: Humanized mouse 11F2

[0465] In order to humanize the mouse antibody 11F2 (mAb0005) with VH and VL domain sequences corresponding to SEQ ID NO.754 and SEQ ID NO.750, respectively, while retaining its high binding affinity to FVII (a), we combined information from sequence identity relative to human germline, crystal structure of the complex between Fab0076 (Example 12) and active site inhibited FVIIa (Example 9), and in vitro binding data. At the beginning, we used the blast algorithm to search for human VH, VL and VJ sequences (for both heavy chain (HC) and light chain (LC)) with high sequence identity to the mouse variable domain sequence of 11F2 in the human germline database. For the VH of HC, the sequences with the highest sequence identity were: IGHV4-30-4*01, IGHV4-28*01, IGHV4-28*06, and IGHV459*01, while for the VJ segment of HC, the top germline sequences were: IGHJ5*01, IGHJ4*01. For LC, the top sequences for VL were: IGKV6D-41*01 and IGKV3-11*01, and for the VJ segment: IGKJ2*01 and IGKJ2*02 (Table 12). Next, the differences between the human germline and murine VH and VL sequences were mapped onto the crystal structure of the Fab0076 / FVIIa complex. Residues greater than or equal to 100% of the expected distance from the epitope were The residues in the mouse variable domain at a distance of 1000 to 1000 had no or little effect on binding affinity and were exchanged for the corresponding human germline amino acid entities. In addition, the residues that constitute the paratope were considered to be more problematic to replace without affecting affinity, so the mouse amino acid entities were retained. A subset of residues near the binding interface that may affect binding affinity was identified. Humanized variants were generated by mutating residues at the distal end of the epitope to human amino acid entities from germline alignments. In addition, residues close to the paratope were mutated to human entities in a subset to make the variants as close to the human germline as possible. This group includes variants in which mouse CDRs are transplanted to the complete human germline of HC and LC. According to Table 13, 12 LCs and 13 HCs were generated from the initial analysis and paired into 23 variants.

[0466] The binding affinity of humanized antibodies to FVIIa (listed in Table 13) was measured using Bio-Layer interferometry (Fortebio). All steps were carried out at 30 ° C in running buffer (20mM HEPES buffer (pH 7.4), 150mM NaCl, 5mM CaCl2, 0.03% Tween 20, 1mg / ml BSA without IgG). Antibodies were captured at a concentration of 10ug / ml for 3 minutes on anti-human tips (AHC, Fortebio). Then a 3-minute incubation was performed to establish a baseline. After this, association was monitored for 3 minutes using four different concentrations of FVIIa (25nM, 50nM, 100nM and 200nM), followed by 3 minutes of dissociation. Sensorgrams were analyzed using Fortebio data analysis software. Fortebio data are used for ranking, and absolute affinity values ​​may deviate from the values ​​determined by SPR (Example 6, Table 7).

[0467] Table 12 : Human germline sequence used for humanization of murine 11F2. The numbers in brackets reflect the identity between the murine variable domain of Fab0076 and the specified human germline sequence ((n / m) indicates n identical positions out of a total of m positions)

[0468]

[0469]

[0470] Table 13 : Pairing of VH and VL in the first round of humanization of murine 11F2-mAb0048, and measured affinity of the corresponding antibodies for FVIIa (determined as described herein). For some variants, no binding was measured (nb).

[0471]

[0472]

[0473] Variants with equal or higher affinity than the parental murine antibody from the first round of humanization were identified, and those mutations found to retain or improve binding affinity were used to design the second round of variants. From this set of mutations, the second round of variants was generated by inserting as many of these mutations as possible on top of the humanized HC and LC that already had the desired affinity. From this analysis, 19 VH sequences (corresponding to SEQ ID NOs: 314, 514, 522, 530, 538, 546, 554, 562, 570, 578, 586, 594, 602, 610, 618, 626, 634, 642, and 650) and 25 VL sequences (corresponding to SEQ ID NOs: 310, 318, 326, 334, 342, 350, 358, 366, 374, 382, ​​390, 398, 406, 414, 422, 430, 438, 446, 454, 462, 470, 478, 486, 494, and 502) were designed and experimentally tested by combining all VLs with VLs, resulting in a total of 475 combinations. As described above, the dissociation constant (KD) values ​​of the resulting 475 humanized antibodies binding to FVIIa were measured using Bio-Layer interferometry (Fortebio). The measured KD values ​​are listed in Table 14.

[0474] Table 14 . Dissociation constant values ​​(M, nb indicates no binding) for humanized variants of the murine 11F2 anti-FVII(a) antibody. The antibodies are defined by their respective VH and VL SEQ ID NOs.

[0475]

[0476]

[0477] Table 14 (Continued)

[0478]

[0479]

[0480] Table 14 (Continued)

[0481]

[0482] SPR analysis of humanized 11F2 variants

[0483] The affinity of selected humanized 11F2 variants was determined by SPR analysis as detailed in Example 6. The measured dissociation constants are listed in Table 15 and show retained high affinity binding of the variants to human FVIIa.

[0484] Table 15 Estimated binding constants (K) for the interaction of humanized 11F2 antibody and biAb with FVIIa in monovalent form D ), as determined by surface plasmon resonance (SPR) analysis according to Example 6.

[0485] Anti-FVII(a) Antibodies <![CDATA[K D (M)]]> mAb0077(OA) 4.1E-11 mAb0099(OA) 1.2E-10 mAb0138(OA) 1.3E-10 mAb0140(OA) 8.3E-11 mAb0141(OA) 7.8E-11 mAb0142(OA) 1.0E-09 mAb0143(OA) 7.9E-11 mAb0705(OA) 5.05E-11 mAb0706(OA) 5.42E-11 mAb0707(OA) 1.06E-10 mAb0709(OA) 1.04E-10 mAb0710(OA) 1.28E-10 biAb0001 0.06E-09 biAb0245 600E-09

[0486] Functional characterization of humanized 11F2 variants

[0487] The effects of selected humanized 11F2 variants on FVIIa activity and sensitivity to antithrombin inhibition were determined as detailed in Example 5. The results are listed in Table 16 and show that the humanized variants retained the desired properties with respect to these parameters.

[0488] Table 16 . Functional characterization of anti-FVII(a) antibodies in thrombin generation (TGT) and antithrombin (AT)-inhibition assays as described in Example 5.

[0489]

[0490] Pharmacokinetics of FVIIa co-formulated with humanized 11F2 variant in rats

[0491] As detailed in Example 9, the family of humanized 11F2 variants were administered intravenously to male Sprague Dawley rats in a co-formulation with 20 nmol / kg FVIIa.

[0492] The results are given in Table 17 and show that several humanized 11F2 variants conferred FVIIa with the same long half-life as the parent antibody.

[0493] Table 17 : Mean residence time (MRT) of FVIIa plasma activity in Sprague Dawley rats after intravenous administration of 20 nmol / kg FVIIa at different molar ratios to antibodies. Values ​​are mean ± SD, n = 3. na: not applicable

[0494] Anti-FVII(a) Antibodies Molar ratio of FVIIa:antibody MRT(h) vehicle na 1.1 mAb0005 1:5 7.9 mAb0077(OA) 1:1 11±0.2 mAb0099(OA) 1:1 7.7±0.4 mAb0137(OA) 1:1 7.0 mAb0139(OA) 1:1 2.7 mAb0140(OA) 1:1 7.7 mAb0141(OA) 1:1 7.7 mAb0705(OA) 1:1 7.7±0.4 mAb0706(OA) 1:1 7.3±0.3 mAb0707(OA) 1:1 6.4±1.0 mAb0709(OA) 1:1 5.9±0.4 mAb0710(OA) 1:1 5.7±0.3

[0495] Example 15: Crystallization and epitope mapping of 11F2Fab0883 in complex with active site inhibited FVIIa and soluble tissue factor

[0496] In order to determine the epitope on FVII(a) recognized by humanized 11F2, i.e., mAb0705(OA) and mAb0842(OA), the corresponding Fab fragment Fab0883 was crystallized in complex with FVIIa (FVIIai) with active site inhibited by HD-Phe-Phe-Arg chloromethyl ketone (FFR-cmk; Bachem, Switzerland) and soluble tissue factor fragment 1-219 (sTF) using the hanging drop method as described by Kirchhofer.D. et al., Proteins Structure Function and Genetics. (1995), 22, 419-425.

[0497] crystallization

[0498] Crystals of SEC purified complex of Fab and FVIIai / sTF were grown using sitting drop vapor diffusion technique at 18°C. 360 nl of protein complex (4.5 mg / ml) in 20 mM HEPES, 150 mM NaCl, 0.1 mM CaCl2 (pH 7.4) were mixed with 360 nl of precipitant solution containing 0.15 M CsCl and 15% (w / v) polyethylene glycol 3350 and 360 nl of water and equilibrated with 80 μl of precipitant solution. Crystals grew within 6 weeks.

[0499] Diffraction data collection

[0500] Crystals were cryoprotected in a solution consisting of 0.15 M CsCl, 15% (w / v) ethylene glycol 3350 and 20% (v / v) glycerol before rapid cooling in liquid nitrogen. Diffraction data were collected at 100 K on a Rigaku FRX rotating anode generator equipped with a Dectris Pilatus 1M detector. Data reduction was performed using a program from the XDS package (diffraction data statistics are summarized in Table 18).

[0501] Structure determination and refinement

[0502] All crystallographic calculations were performed using the Phenix crystallographic program suite. The Phaser program was used to determine the structure by molecular replacement using the coordinates of the complex structure obtained as described in Example 13 as a search model. The asymmetric unit contains four Fab: FVIIai / sTF complexes. Iterative cycles of manual reconstruction using COOT and Phenix refinement produced the final model (Table 18).

[0503] Table 18:Data collection and refinement statistics from the X-ray structure determination of the complex between active site inhibited FVIIa, soluble tissue factor (sTF) and Fab0883. Statistics for the highest resolution shell are shown in parentheses.

[0504]

[0505]

[0506] Epitope mapping

[0507] If all four independently identified FVIIa molecules in the crystal have a non-hydrogen atom located less than or equal to the distance between the non-hydrogen atom in Fab If there is no non-hydrogen atom of the residue within a distance of , the residue is considered to be part of the epitope. Thus, the epitope was found to comprise the following residues according to SEQ ID NO: 1:

[0508] R113

[0509] C114

[0510] H115

[0511] E116

[0512] G117

[0513] Y118

[0514] S119

[0515] L120

[0516] T130

[0517] V131

[0518] N184

[0519] T185

[0520] P251

[0521] V252

[0522] V253

[0523] Q388

[0524] M391

[0525] R392

[0526] Complementary position determination

[0527] If all four independently identified Fab molecules in the crystal have a Fab located at a distance less than or equal to The non-hydrogen atoms of the residue within a distance of , then the residue is considered to be part of the paratope. The paratope was found to contain the following light chain residues (according to SEQ ID NO: 814):

[0528] Q27

[0529] G28

[0530] Y32

[0531] Y50

[0532] H92

[0533] S93

[0534] F94

[0535] and heavy chain residues (according to SEQ ID NO:818):

[0536] D32

[0537] Y54

[0538] Y103

[0539] N105

[0540] Example 16: Hot spot analysis of 11F2 mAb0842(OA) using SPR Expression of alanine variants of FVIIa

[0541] hFVII alanine variants were generated using QMCF technology, which is a stable episomal expression system (Icosagen). CHOEBNALT85 cells were cultured in Qmix1 medium (1L=1:1CD-CHO and SFM II (NVO11514701) + 10ml Pen / Strep (Gibco, 15140-122) + 2ml puromycin (Gibco, A11138-03)) in an E125 flask in a CO2 shaking incubator. On the day of transfection, 1×10e7 CHOEBNALT85 cells were transfected with 2μg hFVII variant encoding plasmids and 50μg salmon sperm DNA using electroporation (Bio-Rad Gene Pulser Xcell electroporation system, 300V, 900μF, 4mm cuvette). One day after transfection, G418 selection was started by transferring the cells to Qmix2 medium (1L=1:1CD-CHO and SFM II (NVO11514701) + 10ml Pen / Strep (Gibco, 15140-122) + 1ml K-vitamin (K.vit 13A 01311) + 14ml G418 (Gibco, 10131-027)). After 10-14 days of G418 selection, the cells reached> 95% viability (Vi-Cell XR cell counter). The cells were divided into 0.4×10e6 cells / ml to 2×250mlQmix2 in a 2×E1000 flask. After 3-4 days, the cells reached a density of about 4-5×10e6 cells / ml. Expression was initiated by adding 20% ​​CHO CD Efficient Feed B (Gibco A10240) + 6mM GlutaMax (Gibco, 35050). After 4 days of initiation, 10% CHO CD Efficient Feed B + 6mM GlutaMAX was added. On the 6th day after initiation, the culture was harvested and centrifuged (200g, 5 minutes). The supernatant was collected and 15mM HEPES (Gibco, 15630) and 5mM CaCl2 (Sigma, 21115) were added. The supernatant was sterilized by filtration using a 0.22 μm bottle top filter (Corning, CLS430049).

[0542] Expression and purification of cFVIIa-chimera (22017-051)

[0543] cFVIIa-chimera is generated using a similar expression system as outlined above. As described in Example 26, the zymogen cFVII-chimera is purified from the culture medium using an affinity column prepared by coupling an internal anti-FVII (a) antibody (F1A2) to agarose beads. Anti-FVII (a) antibody F1A2 binds to the Gla domain of FVII (a) in a Ca++ dependent manner. Human FIXa is used to activate the zymogen cFVII-chimera, and F1A2 affinity purification is used to repurify to obtain the final cFVI chimera.

[0544] Hot spot analysis

[0545] Hot spot analysis using monovalent humanized antibody mAb0842 (OA) was performed by using surface plasmon resonance (Biacore T200) at 25 ° C with a group of 19 FVII (a) variants for binding research. Anti-FVII (a) antibodies (NN internal Ab 4F6 (Nielsen AL et al., PNAS 114 (47) 12454-12459, 2017)) targeting FVII (a) gla domains of 25 μg / ml were fixed on a sensor chip (all provided by GE Healthcare) on CM4 using a standard amine coupling chemistry kit. FVII (a) variants according to Table 19 in cell culture supernatant (as described above) were diluted in running buffer and injected at a flow rate of 10 μl / min for 1 minute to reach a capture level of 5-55RU. Each FVII (a) variant was captured by immobilized anti-FVII (a) gla Ab. Subsequently, 540nM (3 times dilution) mAb0842 (OA) was injected at a flow rate of 30 μl / min for 7 min to allow binding to the captured FVII (a) variant, followed by a 9 min buffer injection, so that the one-arm anti-FVII (a) antibody was dissociated. By diluting 10 times with 10xHBS-P buffer (provided by GE Healthcare) and supplementing 1mg / ml BSA and 5mM CaCl2 to obtain 10mM HEPES, 150mM NaCl, 0.05% v / v polysorbate 20 (pH 7.4), 5mM CaCl2, 1mg / ml bovine serum albumin (BSA) to prepare running buffer. This running buffer is also used to dilute anti-FVII (a) antibodies and FVII (a) samples. The regeneration of the chip is achieved using 10mM HEPES, 150mM NaCl, 20mM EDTA, 0.05v / v polysorbate 20 (pH 7.4). Use the BiaEvaluation 4.1 provided by manufacturer (Biacore AB, Uppsala, Sweden), analyze binding data according to 1: 1 kinetic model and steady-state analysis. Whenever possible, report ka, kd and KD values ​​from 1: 1 kinetic fitting model. For 4 FVII (a) variants, report the KD value using the steady-state fitting model. In addition, report the capture signal of all FVII (a) variants. If the amino acid residue is replaced by alanine and causes affinity to reduce ten (10) times or more relative to wild-type, then the amino acid residue is considered to be a hotspot residue. Based on the data provided in Table 19, draw the following conclusion: amino acid residues H115, T130, V131 and R392 are hotspots.

[0546] Table 19.Binding interactions of FVII(a) variants with the monovalent humanized antibody mAb0842(OA) as determined by surface plasmon resonance (SPR) analysis according to embodiment 16.

[0547]

[0548]

[0549] Example 18: Pharmacokinetics of recombinant FVIIa co-formulated with humanized 11F2 antibody in cynomolgus monkeys

[0550] In a cynomolgus monkey study, FVIIa plasma activity-time profiles were estimated following intravenous or subcutaneous administration of recombinant FVIIa (rFVIIa) alone or in a 1:3 molar ratio co-formulation with monovalent single-arm 11F2 mAb0705 (OA). The formulations were administered as a single dose of 5.4 nmol / kg FVIIa (including 16.2 nmol / kg mAb0705 (OA) for co-formulation), and blood samples were drawn over a three-week period.

[0551] During the experiment, animals were housed and handled according to standard procedures of the local health authorities and were allowed free access to feed and water. FVIIa plasma activity was measured using the FVIIa activity assay as described in Example 8. Endogenous cynomolgus FVIIa was below the LLOQ (0.1 nM) before dosing and could therefore be ignored.

[0552] The pharmacokinetic analysis of FVIIa plasma activity-time curve was performed using Phoenix WinNonlin 6.4 by non-compartmental methods. The following parameters were estimated from the data: clearance (CL), mean residence time (MRT) and SC bioavailability (F). The parameters are listed in Table 20, and compared with FVIIa in the absence of antibody, by co-preparing with mAb0705 (OA), after intravenous and subcutaneous administration, FVIIa activity was significantly extended.

[0553] Table 20 : Clearance (CL), mean residence time (MRT) and SC bioavailability (F) of FVIIa plasma activity following intravenous or subcutaneous administration of 5.4 nmol / kg FVIIa alone or co-formulated with mAb0705(OA) at a 1:3 molar ratio in a cynomolgus monkey study. Values ​​are mean (SD), n=3.

[0554]

[0555] Example 19: Humanization and Optimization of Murine Anti-TLT-1 Antibody mAb0012

[0556] Humanization

[0557] The mouse anti-human TLT-1 antibody mAb0082 disclosed in WO2012 / 117091 was used as the starting point of the humanization process. mAb0082 was derived from mAb0012 in the following manner: two point mutations, C41A in VL and T61A in VH, were incorporated to remove the unpaired cysteine ​​in FR1 of VL and the N-glycosylation site in CDR2 of VH, respectively. The humanization process was based on standard molecular biology methods known to those skilled in the art.

[0558] In brief, based on the VH3_74 / JH1 sequence defined in the IMGT database, mAb0082 CDRH1, CDRH2 and CDRH3 sequences are transplanted onto human germline sequences. In addition, three VH3_74 / JH1 human amino acid substitutions are introduced into the CDRH2 sequence of the transplant to further humanize this CDR sequence: P62D, L64V and D66G. In order to obtain the binding affinity suitable with mAb0082, three back mutations are introduced to the position S49G, D62P and R98S of the VL sequence. About the humanization of VL, mAb0082 CDRL1, CDRL2 and CDRL3 sequences are transplanted onto the human germline sequences based on the VKII_A23 / JK2 sequence defined in the IMGT database. The VL sequence comprises potential deamidation hotspots (NG motifs) in CDR1. Saturation mutagenesis is used at this position, and it is found that the NG motif can be eliminated by N33Q displacement, without compromising the affinity to TLT-1.

[0559] The final humanized and optimized variant of mAb0082 was designated mAbl076, corresponding to SEQ ID NOs:934 (VL) and 938 (VH).

[0560] SPR analysis of humanized TLT1 variants

[0561] sTLT1 (corresponding to SEQ ID NO:3, six histidine residues were added at the C-terminus) was detected by surface plasmon resonance (BiacoreT200) at 25°C for the combination with the biAb from (Example 4). Anti-human IgG was fixed on a CM5 sensor chip (all provided by GE Healthcare) using standard amine coupling chemistry. Purified biAb (1nM) according to Table 21 was injected at a flow rate of 10 μl / min for 1 minute. Subsequently, 0 to 60 μM sTLT1 was injected at a flow rate of 30 μl / min for 3 minutes to allow for the combination with biAb, followed by 3 minutes of buffer injection to allow for dissociation from biAb. By 10xHBS-P buffer (provided by GE Healthcare) dilute 10 times and supplement 1mg / ml BSA and 5mM CaCl2 to obtain 10mM HEPES, 150mM NaCl, 0.05% v / v polysorbate 20 (pH7.4), 5mM CaCl2, 1mg / ml bovine serum albumin (BSA) prepare running buffer.This running buffer is also used to dilute biAb and sTLT1 samples.Use by 3M MgCl2The recommended regeneration buffer (provided by GE Healthcare) of composition realizes the regeneration of chip.Use the BiaEvaluation 4.1 provided by manufacturer (Biacore AB, Uppsala, Sweden), according to 1:1 model analysis binding data.Analysis results in the binding constant reported in Table 21, proves that the affinity range of biAb to sTLT1 binding is from 2.9nM to 320nM.

[0562] Table 21 .Estimated binding constant for the interaction of sTLT1 with biAb, as determined by surface plasmon resonance (SPR) analysis according to embodiment X.

[0563]

[0564] Example 20: Crystal structure of Hz-TLT1 and TLT-1 peptide complex preparation

[0565] The Fab fragment for complex crystallization with the stem peptide of TLT-1 comprises the VL and VH domain sequences corresponding to mAb1076 (SEQ ID NO:854 and 858, respectively), human IgG4 CH1 domain and human κCL with single point mutation (G157C). The displacement of G to C is in the constant domain of the Fab fragment, i.e. away from the antigen binding site, and has no effect on the combination with TLT-1. The 37-mer stem peptide EEEEETHKIGSLAENAFSDPAGSANPLEPSQDEKSIP (SEQ ID NO:13) corresponding to the residue 111-147 of SEQ ID NO:2 is prepared by standard peptide synthesis methods known to those skilled in the art. Fab and stem peptide are mixed in a 1:2 molar ratio in hepes buffer (20mM HEPES (pH 7.3), 150mM NaCl). 1:1 Fab: peptide complex is separated using gel filtration on a superdex 200 column eluted with hepes buffer, then concentrated to about 11mg / ml and used for crystallization.

[0566] crystallization

[0567] Crystals of gel filtered 1:1 molar Fab / peptide complexes were grown using the sitting drop vapor diffusion technique at 18° C. 150 nl of a 10.8 mg / ml protein solution of Fab:peptide complex in 20 mM HEPES (pH 7.3) and 150 mM NaCl were mixed with 50 nl of 1 M LiCl, 0.1 M sodium citrate-citric acid (pH 4) and 20% (w / v) PEG 6000 as precipitant and incubated on 60 μl of precipitant.

[0568] Diffraction data collection

[0569] Crystals were cryoprotected by adding 1 μl of precipitant with 20% ethylene glycol to the crystallization drop before rapid cooling in liquid nitrogen. Diffraction data were collected at 100 K at the BioMAX beamline of the MAX IV synchrotron (Lund, Sweden) using an Eiger 16M hybrid pixel detector from Dectris. Automatic indexing, integration and scaling of the data were performed using programs from the XDS package (diffraction data statistics are summarized in Table 22).

[0570] Structure determination and refinement

[0571] According to Matthews coefficient analysis, the asymmetric unit contains two Fab: peptide complexes. Structure is determined by molecular replacement. Use Phaser implemented in program suite Phenix, with H and L chains of protein database entry 5KMV as search models for positioning two Fab. These are models that COOT is used to build with correct amino acid sequence, and then refined using Phenix. Clearly see amino acid 7 to 21 from peptide in difference electron density map, and COOT can be used to manually build model. This model is further refined using the step of manual reconstruction in Phenix refinement and COOT. Refinement statistics are shown in Table 22.

[0572] Table 22 .Data collection and refinement statistics

[0573]

[0574]

[0575] Statistics for the highest resolution shell are shown in parentheses.

[0576] Epitope and paratope of Fab / peptide complexes

[0577] The epitope was defined as a residue in the TLT-1 stem-peptide with the following characteristics: in both complexes in the asymmetric unit, a distance of 1 0.1 Å from a heavy atom in the Fab. Similarly, the paratope is defined as a residue in the Fab fragment that has a heavy atom (i.e., non-hydrogen atom) within a distance of 1000 Å from a heavy atom in the TLT-1 stem-peptide in both complexes in the asymmetric unit. The epitope was found to contain the following residues from the 37aa TLT-1 peptide according to SEQ ID NO: 13:

[0578] K8

[0579] I9

[0580] G10

[0581] S11

[0582] L12

[0583] A13

[0584] N15

[0585] A16

[0586] F17

[0587] S18

[0588] D19

[0589] P20

[0590] A21

[0591] Corresponding to K118, I119, G120, S121, L122, A123, N125, A126, F127, S128, D129, P130 and A131 of SEQ ID No: 2 and 3).

[0592] The paratope comprises the following residues from the heavy chain variable domain (SEQ ID NO:938):

[0593] V2

[0594] F27

[0595] R31

[0596] Y32

[0597] W33

[0598] E50

[0599] T57

[0600] N59

[0601] S98

[0602] G99

[0603] V100

[0604] T102

[0605] S103

[0606] and the following residues from the light chain variable domain (SEQ ID NO:934):

[0607] H31

[0608] Y37

[0609] H39

[0610] Y54

[0611] F60

[0612] S61

[0613] S96

[0614] T97

[0615] V99

[0616] Y101

[0617] Example 21: Effect of affinity on the stimulatory activity of anti-FVII(a) / anti-TLT-1 bispecific antibodies

[0618] To determine the effect of affinity on the activity of bispecific antibodies, a number of anti-FVII(a) and anti-TLT-1 mAbs humanized from 11F2 mAb0005 (see Example 14) and mAb0012 (see Example 19) with different affinities for FVIIa and TLT-1, respectively, were tested in a bispecific format in a FXa generation assay using lipidated TLT-1 as described in WO2011 / 023785.

[0619] The first step is to measure FX activation in the presence of 4nM recombinant TLT-1 (WO2011023785) incorporated into 10:90 phosphatidylserine:phosphatidylcholine vesicles, 2.5nM FVIIa and 0 to 300nM concentration series of bispecific antibodies (biAb). At room temperature in assay buffer (50mM HEPES, 100mM NaCl, 10mM CaCl2, pH 7.3+1mg / mlBSA and 0.1%PEG8000) after pre-incubation for 10 minutes, add 150nM plasma derived FX (Haematologic Technologies) to obtain a total volume of 50 μl, and allow to activate for 20 minutes. Activation was then terminated by adding 25 μl of quenching buffer (50 mM HEPES, 100 mM NaCl, 80 mM EDTA, pH 7.3) and the generated FXa (added as a 2 mM stock in a 25 μl volume) was quantified based on its ability to hydrolyze 0.5 mM S-2765 (Chromogenix) chromogenic substrate and tracked for 5 minutes at 405 nM in a SPECTRAmax Plus 384 microplate reader. The normalized activity (A) of each biAb at a concentration of 100 nM was calculated based on the slope of the linear absorbance increase by subtracting the background activity in the absence of the biAb and dividing by the FVIIa concentration in the assay. biAb ).

[0620] In the second step, the same assay was performed using assay buffer and a range of FVIIa concentrations from 0 to 80 nM instead of the biAb. The slope of the linear relationship between background-subtracted FXa generation and FVIIa concentration in this assay provides a measure of the specific activity of free FVIIa under the assay conditions used (A FVIIa ).

[0621] Based on the measured activities, the stimulatory activity of each biAb at 100 nM was calculated as A biAb / A FVIIaThe stimulatory activity provides a measure of the fold increase in FXa production caused by FVIIa after the addition of 100 nM biAb.

[0622] The stimulatory activity is provided in Table 23 and shows the dependence of the biAb stimulation on the strength of binding to FVIIa and TLT-1, respectively, expressed as dissociation constant (KD) values. Among the biAbs tested, biAb0001 exhibited the highest stimulatory activity.

[0623] Table 23 : Stimulating activity of bispecific antibodies in the presence of FX, FVIIa and lipidated TLT-1 as described in Example 21. For each bispecific antibody, the measured stimulating activity (mean ± SD, n = 2) and the dissociation constants for interaction with FVIIa and TLT-1, respectively, are listed.

[0624]

[0625]

[0626] Example 22: Effect of epitope mapping on the stimulatory activity of anti-FVII(a) / anti-TLT-1 bispecific antibodies

[0627] To determine the effect of epitope mapping on the activity of bispecific antibodies, a number of anti-TLT-1 and anti-FVIIa mAbs that bind to different epitopes on TLT-1 and FVIIa, respectively, were tested in a bispecific format in a FXa production assay as performed in Example 21.

[0628] The results are provided in Table 24 and show the dependence of biAb stimulatory activity on epitope localization. Specifically, anti-TLT-1 mAbs mAb1076, mAb0023, mAb0051 and mAb0062 in combination with anti-FVIIa mAb mAb0865 exhibited comparable stimulatory activity.

[0629] Table 24 Stimulatory activity of bispecific antibodies in the presence of FX, FVIIa and lipidated TLT-1 as described in Example 22. For each bispecific antibody, the measured stimulatory activity (mean ± SD, n = 2) and the dissociation constants for interaction with FVIIa and TLT-1, respectively, are listed.

[0630]

[0631] Example 23: Antigen Assay for Human IgG (LOCI)

[0632] The presence of human IgG (hIgG) in cynomolgus monkey plasma was measured by luminescent oxygen channel immunoassay (LOCI). In short, the LOCI reagent includes two latex bead reagents (donor and acceptor beads) and a biotinylated monoclonal antibody against hIgG (Biosite, catalog number AFC4249). The donor bead reagent containing a photosensitive dye is coated with streptavidin. The second bead reagent, the acceptor bead, is conjugated with an internal monoclonal antibody against hIgG (0421), which constitutes a sandwich structure. During the assay, the three reactants combine with the hIgG in the plasma to form a bead-aggregate immune complex. The excitation of the complex releases singlet oxygen molecules from the donor beads, which are guided into the acceptor beads and trigger a chemiluminescent reaction. It is then measured in an Envision microplate reader. The amount of light generated (reported in counts per second (cps)) is proportional to the concentration of hIgG. The sample is diluted at least 100 times in the assay buffer, and a calibration curve is prepared based on hIgG added to 1% cynomolgus monkey plasma.

[0633] Example 24: Antigenic determination of FVII(a) (LOCI)

[0634] FVII(a) antigen, including FVII zymogen, FVIIa, and FVIIa: antithrombin (FVIIa:AT) complex, was measured by the LOCI assay as described in Example 23, except that the FVII(a) assay consisted of acceptor beads coated with an in-house anti-FVII(a) antibody (4F9) and an in-house biotinylated anti-FVII(a) monoclonal antibody (4F7). Samples were diluted at least 100-fold in assay buffer, and a calibration curve was prepared by adding known amounts of human rFVIIa to the assay buffer.

[0635] Example 25: Antigen Assay (EIA) of FVIIa:AT (Antithrombin)

[0636] The FVIIa:AT (antithrombin) complex is synthesized by using H et al., J Thromb Haemost 2011; 9: 333–8. The monoclonal anti-FVIIa antibody (Dako Denmark A / S, Glostrup, Denmark, product code O9572) that binds to the N-terminal EGF domain and does not block antithrombin binding is used to capture the FVIIa:AT complex. The preformed complex of human FVIIa and cynomolgus monkey antithrombin (FVIIa:AT) is prepared by incubating FVIIa with a 2-fold molar excess of antithrombin in the presence of 10 μM low molecular weight heparin (enoxaparin). The residual amidolytic activity of FVIIa after overnight incubation at room temperature (see Example 11) was confirmed to be less than 10% of the initial FVIIa activity. The complex is used to construct an EIA calibration curve. A polyclonal anti-human antithrombin antibody peroxidase conjugate is used for detection (Siemens Healthcare Diagnostics ApS, Ballerup, Denmark, product code OWMG15). TMB was added and color development was performed until sufficient color was developed, which was terminated by adding H2SO4 and the absorbance at 450 nM was measured on an absorbance microplate reader (BioTek), with 650 nM as reference. The color intensity is proportional to the concentration of FVIIa:AT.

[0637] Example 26: Preparation of human FVIIa, FVII (zymogen) and FVIIa:AT (antithrombin) complex

[0638] Preparation of human FVIIa (activated FVII)

[0639] Unless otherwise indicated, recombinant human activated FVII (FVIIa) was prepared as described by Thim et al. (1988) Biochemistry 27:7785-7793 and Persson et al. (1996) FEBS Lett 385:241-243.

[0640] Preparation of human FVII (zymogen FVII)

[0641] The recombinant human FVII produced in CHO cells was purified by single-step calcium-dependent affinity chromatography as described in Thim et al. (1988) Biochemistry 27:7785-7793. After purification, the zymogen FVII was dialyzed into 10mM MES, 100mM NaCl, 10mM CaCl2 (pH 6.0) buffer. The level of activated FVII (FVIIa) in the product was determined by measuring the amidolytic activity in the presence of 1mM chromogenic substrate S-2288 and 200nM sTF (see Example 11). By associating it with a standard curve prepared with a known concentration of FVIIa, the measured activity can be converted into the molar concentration of FVIIa in the zymogen FVII product.

[0642] Preparation of human FVIIa:AT (antithrombin) complex

[0643] FVIIa: AT (antithrombin) complex is prepared by incubating equimolar concentrations of human recombinant FVIIa, human plasma-derived AT (Baxter) and low molecular weight heparin (enoxaparin sodium) at 4°C for 16 hours. In order to remove contaminated excipients, AT is re-purified on a heparin sepharose 6fast flow (GE Healthcare) column by applying a sodium chloride gradient before use. The eluted AT is concentrated upward by ultrafiltration to obtain the final product in 10mM HEPES, 25mM NaCl (pH7.3) containing 50% glycerol. FVIIa: AT complex is purified by SEC chromatography at 4°C in 20mM MES, 100mM NaCl, 1mM EDTA (pH5.5) to maximize the stability of the complex. The residual level of FVIIa in the product is determined as described above. In order to minimize the decomposition of the complex, the product is stored in aliquots at -80°C and thawed immediately before use and stored on ice.

[0644] Embodiment 27: single dose pharmacokinetics of anti-FVII (a) / anti-TLT-1 biAb in cynomolgus monkeys biAb0001 and corresponding YTE variant biAb0352 (wherein three additional half-life extension substitutions (M252Y, S254T and T256E) are introduced into the heavy chain constant domain) are administered intravenously at 3.0, 9.49 or 30nmol / kg or subcutaneously (sc) at 9.49nmol / kg in cynomolgus monkeys. Each group consists of two monkeys (one male and one female). Before administration and for the iv group, 1mL sodium citrate-stabilized blood samples are taken at 0.5h, 2.5h, 6h, 12h, 24h, 48h, 72h and the 8th, 10th and 15th days after administration. For the sc group, blood samples were collected before and after administration at 0.5h, 3h, 6h, 12h, 16h, 24h, 30h, 38h, 48h, 54h, 72h, 78h, 96h, 120h and on the 8th, 10th and 15th days. The blood samples were centrifuged at 2000g for 10 minutes, and plasma was taken out, divided into equal parts and stored at -80°C until analysis of hIgG (see Example 23), total FVII (a) antigen (see Example 24), FVIIa activity (see Example 8) and FVIIa: AT complex (Example 25). Phoenix WinNonlin 6.4 was used to perform pharmacokinetic (PK) analysis of the concentration and time curve of hIgG by non-compartmental methods. The following PK parameters are shown in Table 24: half-life (t1 / 2), clearance (Cl), distribution volume (Vz), mean residence time (MRT) and SC bioavailability (F).

[0645] Table 24 PK parameters of biAbs with and without YTE mutation based on analysis of plasma samples from cynomolgus monkeys.*

[0646]

[0647]

[0648] *) Each line represents data from one cynomolgus monkey, **) Cl is for the iv administration group, Cl / F is for the sc group. F corresponds to sc bioavailability.

[0649] Endogenous FVII (a) accumulation was observed in monkeys administered with BiAb0001 or corresponding YTE-variant biAb0352. Table 25 shows the pre-administration levels of FVII (a) antigen, FVIIa activity and FVII: AT and the average cumulative levels measured between 72 to 240 hours after administration. FVII (a) antigen, FVIIa activity and FVIIa: AT antibody dose-dependent accumulation was observed. FVII (a) antigen increased up to 3 times relative to pre-administration levels, while FVIIa and FVIIa: AT increased up to 5 times. The data show that intravenous or subcutaneous administration of a single dose of biAb0001 or biAb0352 with a YTE mutation causes endogenous FVII (a) antigen, FVIIa activity and FVIIa: AT complexes to accumulate in vivo.

[0650] Table 25 : Accumulation of FVII(a) antigen, FVIIa and FVIIa:AT after a single intravenous or subcutaneous administration of biAbs with or without the YTE mutation to cynomolgus monkeys.

[0651]

[0652]

[0653] *) Data are mean and SD of measurements from n=2 animals per group and 3 time points from the iv group and 6 time points from the sc group. For all 16 animals, pre-dose values ​​are based on one time point (pre-dose).

[0654] Example 28: Single-dose and multiple-dose pharmacokinetics of the monovalent 11F2 anti-FVII(a) antibody mAb0705(OA) in cynomolgus monkeys

[0655] The in vivo accumulation of FVII, FVIIa and FVIIa:AT was analyzed by administering the monovalent 11F2 anti-FVII(a) antibody mAb0705(OA) to cynomolgus monkeys and then measuring FVII antigen, FVIIa activity and FVIIa:AT in plasma samples. Two male cynomolgus monkeys weighing approximately 2.5 kg were intravenously administered 40 nmol / kg mAb0705(OA) in the saphenous vein, cephalic vein or lateral caudal vein of the tail, while three male cynomolgus monkeys were administered 20 nmol / kg of the single-arm anti-FVIIa antibody subcutaneously (sc) in the thigh (left and right thighs alternately) every other day (i.e., the antibody was administered on days 1, 3, 5, 7, 9, 11, 13 and 15). At time points up to 21 days after administration, blood was collected from the cephalic vein or femoral vein and added to 3.8% trisodium citrate.

[0656] Blood was centrifuged at 2300 g for 10 minutes, and plasma was aliquoted and stored at -80 ° C until analysis of hIgG (see Example 23), total FVII (a) antigen (see Example 24), FVIIa activity (see Example 8) and FVIIa: AT complex (see Example 25). Phoenix WinNonlin 6.4 was used to perform PK analysis of concentration versus time curves by non-compartmental methods. The PK parameters for intravenous administration are shown in Table 26. After a single intravenous administration, the half-life (t1 / 2) of the one-armed antibody averaged 116 hours (4.8 days). The estimated half-life of the subcutaneously administered antibody was 181 ± 20 hours (mean and SD of n = 3). The antibody accumulated during the two-week dosing period, resulting in a maximum level of 1179 ± 140 nM at a time point between 336 and 366 hours after the initial administration (mean and SD of data from n = 3 animals and 3 time points).

[0657] Table 26 PK parameters of mAb0705(OA) administered intravenously at 40 nmol / kg in cynomolgus monkeys.

[0658]

[0659] The single intravenous or repeated subcutaneous administration of mAb0705 (OA) leads to the accumulation of endogenous FVII (a).Total FVII (a) antigen, FVIIa: AT and FVIIa after the single intravenous dose of 40nmol / kg are shown in Table 27.At the 7th-14th day, total FVII antigen increased to 35.0 ± 4.7nM from 7.0nM before administration.Similarly, FVIIa increased to 2.3 ± 0.7nM from being lower than the detection limit (0.009nM), and FVIIa: AT increased to 6.3 ± 0.8nM from 1.0 at the 7th-14th day.As calculated by deducting FVIIa and FVIIa: AT from total FVII (a) antigen, the zymogen FVII level after using 40nmol / kh single-arm antibody is 26.4nM.

[0660] Table 27 FVII(a) levels after a single intravenous dose of 40 nmol / kg mAb0705(OA) measured on days 7-14 post-dose.

[0661] FVII(a) Pre-dose level (nM) Steady state concentration (nM) Total FVII(a) antigen 7.0 35.0±4.7 FVIIa:AT 1.0 6.3±0.8 FVIIa <0.009 2.3±0.7

[0662] The steady-state levels of total FVII (a), FVIIa and FVIIa: AT after multiple subcutaneous administration are shown in Table 28. At 12-21 days, total FVII (a) antigen increased from 6.5 ± 1.5 nM before administration to 36.9 ± 9.8 nM. Similarly, FVIIa increased to 3.9 ± 1.6 nM from below the detection limit (0.009 nM) at 12-21 days, while FVIIa: AT increased to 9.1 ± 0.6 nM from 1.0 ± 0.3 at 12-21 days. The steady-state zymogen FVII level calculated by subtracting FVIIa and FVIIa: AT from total FVII (a) antigen was 24 nM.

[0663] The data show that administration of the single-arm anti-FVII(a) antibody mAb0705(OA) results in the accumulation of endogenous FVII(a), FVIIa, and FVIIa:AT in vivo. The clearance of the single-arm anti-FVII(a) antibody (0.42-0.49 mL / kg×kg, Table 26) is comparable to the clearance of biAb0001 after intravenous administration (0.33–0.64 mL / kg×kg, Example 27, Table 24). Therefore, it is expected that the steady-state levels of FVII(a) antigen, FVIIa, and FVIIa:AT measured after repeated administration of the single-arm anti-FVII(a) antibody represent the levels that will be achieved at steady state after repeated administration of a biAb with the same FVII(a) binding arm.

[0664] Table 28 Steady-state levels of FVII(a) following repeated subcutaneous administration of 20 nmol / kg mAb0705(OA) measured on days 12-21 after the initial dose.

[0665] FVII(a) Pre-dose level (nM) Steady state concentration (nM) Total FVII(a) antigen 6.5±1.5 36.9±9.8 FVIIa:AT 1.0±0.3 9.1±0.6 FVIIa <0.009 3.9±1.6

[0666] Example 29: Thromboelastography under hemophilia A-like conditions in human whole blood supplemented with anti-FVII(a) / anti-TLT-1 biAb0001 and steady-state levels of zymogens FVII, FVIIa and FVIIa:AT

[0667] The effect of the bispecific anti-FVII(a) / anti-TLT-1 antibody biAb0001 (wherein the parent anti-FVII(a) is mAb0865 and the parent anti-TLT-1 antibody is mAb1076) and the cumulative levels of proenzymes FVII, FVIIa and FVIIa:AT from Example 28 were evaluated by thromboelastography in human whole blood under hemophilia A-like conditions and compared with the effect of rFVIIa added to the blood. In principle, as described by Viuff D et al., Thromb Res 2010; 126: 144–9, the Thromboelastography analysis was performed with a thrombelastograph instrument (Thrombelastograph coagulation analyzer, Haemoscope Corp.). Citrate-stabilized whole blood from healthy donors was incubated with 0.1 mg / ml neutralizing anti-FVIII sheep polyclonal antibody (Haematological Technologies Inc, catalog number PAHFVIII-SC) and 5 μg / mL neutralizing anti-TF mouse monoclonal antibody (1F44, prepared in-house) for 30 minutes. biAb0001 at a final plasma concentration of 100 nM in HBS / BSA buffer (20 mM HEPES, 140 mM NaCl, pH 7.4, 2% BSA) was mixed with rFVIIa (Novo Novo Nordisk, final plasma concentration of 3.9 nM), zymogen FVII (prepared as in Example 26, final plasma concentration of 24 nM) and FVIIa:AT complex (prepared as in Example 26, final plasma concentration of 9 nM) were mixed and added to the blood sample. A pre-dilution of FVIIa:AT was prepared in cold 20 mM MES, 100 mM NaCl, 1 mM EDTA (pH 5.5) + 2% BSA and added to the remaining protein immediately before starting the assay. The zymogen FVII and FVIIa:AT preparations contained trace amounts of FVIIa, so a correspondingly lower amount of FVIIa was added to compensate for this and the expected plasma concentration of FVIIa in donor blood (0.1 nM, Morissey JH et al. Blood, 1993; 81: 734-44). Likewise, the amount of zymogen FVII added compensated for the expected plasma concentration of 10 nM zymogen FVIIa in donor blood. A single sample contained 25 nM rFVIIa, corresponding to administration of 90 μg / kg rFVIIa to a human subject with hemophilia A. The theoretical maximum plasma concentration after (Lindley CM et al. Clin Pharmacol Ther 1994; 55: 638-48). Controls included biAb alone and FVII / FVIIa / FVIIa:AT mixtures without biAb. Platelets were activated to the maximum extent by adding the PAR1 agonist peptide SFLLRN (Tocris Biosciences catalog number 3497) to a final concentration of 30 μM and the GPVI agonist convulxin (5-Diagnostics, catalog number 5D-1192-50UG) to a final concentration of 10 ng / mL. A 20 μL volume of 0.2M CaCl2 in 20mM Hepes (pH 7.4) was added to the TEG cup, followed by a 340 μL blood sample, and analysis was started immediately. The software ( Analytical software, version 4.1.73) calculates the clotting time (R-time) defined as the time reaching TEG trace 2mm amplitude.Data from 4 donors are shown in Table 29.After inducing hemophilia A sample condition by neutralization FVIII, clotting time is delayed to 3506 ± 1561s from 290 ± 12s in normal blood.Adding 25nM rFVIIa causes the clotting time of simulated hemophilia A blood to be shortened to 694 ± 158s.Adding 100nM biAb to blood causes clotting time to be appropriately shortened to 2198 ± 712s, which is most likely due to the effect enhancement of endogenous FVIIa in blood.Adding FVII / FVIIa / FVIIa:AT of steady-state level shortens clotting time to 1440 ± 275s. Combining 100 nM biAb and steady-state levels of FVII / FVIIa / FVIIa:AT shortened the clotting time to 495 ± 39 s, which is comparable to or slightly lower than the clotting time after adding 25 nM FVIIa. The data show that biAb enhances the effect of cumulative levels of FVII / FVIIa / FVIIa:AT, resulting in a shortening of the clotting time similar to or slightly better than that achieved using therapeutically effective concentrations of rFVIIa.

[0668] Table 29 . Thromboelastography analysis of the effect of biAb0001 (100 nM) in human whole blood with or without steady-state levels of FVII / FVIIa / FVIIa:AT.

[0669]

[0670] Example 30: Thromboelastography under hemophilia A-like conditions in human whole blood supplemented with bispecific anti-FVII(a) / anti-TLT-1 antibodies with different TLT-1 affinities and steady-state levels of zymogens FVII, FVIIa and FVIIa:AT

[0671] In this example, the following bispecific anti-FVII(a) / anti-TLT-1 antibodies with different affinities for TLT-1 were tested:

[0672]

[0673]

[0674] As described in Example 29, the bispecific antibody of 100nM concentration was evaluated by thromboelastography. Coagulation time (R-time) is listed in Table 30. After induction of hemophilia A (HA) by adding anti-FVIII antibody, coagulation time was delayed from 340 seconds to 5433 seconds. The presence of the biAb (biAb0001) with the highest affinity for TLT-1 shortened the coagulation time to 2465 seconds, i.e., shortened the coagulation time observed by the other three independent biAbs: biAb0015 shortened the coagulation time to 3645 seconds; -biAb0090 shortened to 4335 seconds, and biAb0095 shortened to 4110 seconds. Similarly, the combination of biAb with steady-state levels of FVII, FVIIa, and FVII:AT resulted in a more significant shortening of clotting time for biAb0001 (shortened to 540 seconds) than the other three biAbs; i.e., shortened to 1100 seconds for biAb0015, 1040 seconds for biAb0090, and 815 seconds for biAb0095. The data show that biAb0001, which has the highest affinity (i.e., lowest KD) for TLT-1, is the most effective in shortening clotting time.

[0675] Table 30 : Thromboelastography analysis of the effect of biAb0001, biAb0015 or biAb0090 (100 nM each) in human whole blood with or without steady-state levels of FVII / FVIIa / FVIIa:AT.

[0676]

[0677]

[0678] Example 31: In vivo efficacy of the anti-FVII(a) / anti-TLT-1 bispecific antibody biAb001 in the tail vein transection model of transgenic human TLT-1 mice lacking FVIII

[0679] Using transgenic FVIII knockout (i.e. hemophilia A), mouse TLT-1 knockout, human knock-in tail vein transection (TVT) model in mice, determine the in vivo efficacy of anti-FVII (a) / anti-TLT-1 bispecific antibody biAb0001. Because anti-FVII (a) does not recognize mouse FVII (a), biAb is co-administered with human FVIIa, FVII, FVII: AT, to provide the target plasma levels of these components in mice (respectively 3.8, 26.2 and 9.0nM), so as to simulate their expected clinical steady-state plasma levels according to Example 28. The concentration of biAb is 40 or 100nM. In short, mice are anesthetized with isoflurane and placed on a heating pad, which is set to maintain the body temperature of the animal at 37 ° C, and its tail is immersed in saline (37 ° C). Administration is carried out in the right tail lateral vein 5 minutes before injury. In the TVT model (Johansen et al., Haemophilia, 2016, 625-31), the lateral vein is transected. If the bleeding stops at 10, 20 or 30 minutes, the tail is removed from the saline and the wound is gently wiped with a saline-moistened gauze swab. After 40 minutes, the total blood loss is determined by quantifying the amount of hemoglobin in the saline. After 40 minutes of application, a blood sample is collected from the orbital plexus and added to 3.8% trisodium citrate. The blood is centrifuged at 4000 g for 5 minutes, the plasma is aliquoted, and stored at -80 ° C until analysis of hIgG (see Example 23), total FVII (a) antigen (see Example 24) and FVIIa activity (see Example 8).

[0680] As shown in Table 31, all combinations of FVIIa and biAb resulted in a significant reduction in blood loss compared to biAb alone or FVII(a) administered without biAb. For all combinations, platelet counts measured 45 minutes after treatment were comparable to those observed in the vehicle group.

[0681] Taken together, these data demonstrate a significant in vivo hemostatic effect of biAb0001 in the presence of expected steady-state levels of FVIIa, FVII, and FVII:AT.

[0682] Table 31. In the FVIII knockout / mouse TLT-1 knockout / people TLT-1 knock-in mice of the combination of biAb0001, FVIIa, FVII and FVIIa:AT shown in the application, the blood loss after tail vein transection (TVT). The dosage applied, the expected and measured plasma concentration and the determined blood loss are shown with mean ± SEM (n=10). Using one-way ANOVA, Dunnett's multiple comparison test was used subsequently, and it was found that the blood loss of the 3rd-5th group was significantly different from the 1st group and the 2nd group. The total FVII (a) antigen concentration (measured according to embodiment 23) is listed in the row marked as "FVII", and the numerical value is marked with an asterisk.

[0683]

[0684] Although certain features of the present invention have been illustrated and described herein, many modifications, substitutions, changes and equivalents will now occur to those skilled in the art. Therefore, it should be understood that the appended claims are intended to cover all such modifications and changes that fall within the true scope of the invention.

[0685] Example 32: Identification of Antibodies that Compete with Anti-TLT-1 mAb 1076 for Binding to TLT-1 in Competitive ELISA

[0686] The Fab fragment (anti-TLT-1Fab) for competition experiments comprises the VH and VL domain sequences (SEQ ID NO:938 and 934, respectively) corresponding to mAb1076, human IgG4 CH1 domain and people κ CL with single point mutation (G157C). The displacement of G to C is in the constant domain of the Fab fragment, i.e. away from the antigen binding site, and has no effect on the combination with TLT-1 (see embodiment 20). As described in WO2011 / 023785, recombinant is produced as TLT-1. Anti-TLT-1Fab is biotinylated using standard methods, including using a biotinylation kit (EZ-link, Thermo) according to the instructions of the manufacturer.

[0687] In order to determine whether anti-TLT-1 antibodies compete with anti-TLT-1 Fab and its derivative antibodies for binding to TLT-1, competition studies were performed. Recombinant TLT-1 was fixed overnight at 4 ° C in a NUN Cmaxisorp plate in a dilution buffer (20mM HEPES, 5mM CaCl2, 150mM NaCl, pH7.2). The plate was washed and blocked in a wash buffer (20mM HEPES, 5mM CaCl2, 150mM NaCl, 0.5ml / L Tween 20, pH7.2) for 15 minutes. For competition studies, the final fixed concentration of biotinylated anti-TLT-1 Fab was combined with a series of diluted anti-TLT-1 antibodies to obtain a final concentration in the range of 0 to a maximum of 100mg / ml in the dilution buffer. The mixture was added to the wells of the plate and incubated for 1 hour. The plate was then washed and HRP-labeled streptavidin-HRPO (1:2000 in dilution buffer; Kirkegaard & Perry Labs) was added and incubated for 1 hour. Finally, the plate was washed and developed with TMB ONE (KEMENTEC) for 10 minutes. The reaction was terminated by adding H3PO4 (4M) and the plate was read at 450nm in FLUOStar Optima, subtracting the background signal measured at 620nm. Unless otherwise stated, all incubations were carried out at room temperature and the plate was washed 5 times with washing buffer.

[0688] The concentration of the recombinant TLT-1 to be fixed on the NUNC maxisorp plate and the fixed concentration of the biotinylated anti-TLT-1 Fab mixed with the competitive antibody for competition research are determined by the separate titration of two components, and the purpose is to provide enough signals to allow the competition (i.e. signal reduction) of the detection competitive antibody. The concentration of the TLT-1 to be fixed is usually in the range of 0-1mg / ml, such as 125ng / ml. The concentration of the biotinylated anti-TLT-1 Fab is usually in the range of 0-1mg / ml, such as 10ng / ml.

[0689] Based on the measured signal (OD units), competition at any given antibody concentration was calculated as

[0690] % inhibition = (1-(OD units-100% inhibition) / (0% inhibition-100% inhibition))*100 wherein 0% inhibition is determined by the signal in the wells without any competing anti-TLT-1 antibody, and 100% inhibition is determined as the signal from the wells without biotinylated anti-TLT-1 Fab (i.e. corresponding to the assay background). If at least 50% inhibition (% inhibition) is observed when testing antibody concentrations at up to 10,000-fold excess of biotinylated anti-TLT-1 Fab, the antibody is considered to compete with the anti-TLT-1 Fab for binding to TLT-1.

Claims

1. A bispecific antibody comprising (i) is capable of binding to the first antigen binding site of factor VII(a) (FVII(a)), and (ii) a second antigen binding site capable of binding to TREM-like transcript 1 (TLT-1); Wherein the first antigen binding site comprises: CDRL1 represented by SEQ ID NO: 847, CDRL2 represented by SEQ ID NO: 848, CDRL3 represented by SEQ ID NO: 849, CDRH1 represented by SEQ ID NO:851, CDRH2 represented by SEQ ID NO: 852, and CDRH3 represented by SEQ ID NO:853; and Wherein the second antigen binding site comprises: CDRL1 represented by SEQ ID NO: 855, CDRL2 represented by SEQ ID NO: 856, CDRL3 represented by SEQ ID NO: 857, CDRH1 represented by SEQ ID NO: 859, CDRH2 represented by SEQ ID NO: 860, and CDRH3 represented by SEQ ID NO:861; and (iii) Fc region.

2. The bispecific antibody of claim 1, wherein the first antigen binding site comprises a light chain variable domain represented by SEQ ID NO: 846 and a heavy chain variable domain represented by SEQ ID NO:

850.

3. The bispecific antibody according to claim 1 or 2, wherein the second antigen binding site comprises a light chain variable domain represented by SEQ ID NO: 854 and a heavy chain variable domain represented by SEQ ID NO:

858.

4. The bispecific antibody of claim 1, wherein the first antigen binding site comprises a light chain variable domain represented by SEQ ID NO: 846 and a heavy chain variable domain represented by SEQ ID NO: 850, and wherein the second antigen binding site comprises a light chain variable domain represented by SEQ ID NO: 854 and a heavy chain variable domain represented by SEQ ID NO:

858.

5. The bispecific antibody of claim 1, wherein the first antigen binding site comprises a first light chain variable domain represented by SEQ ID NO: 846 and a first heavy chain variable domain represented by SEQ ID NO: 850, wherein the second antigen binding site comprises a second light chain variable domain represented by SEQ ID NO: 854 and a second heavy chain variable domain represented by SEQ ID NO: 858, wherein the first and second heavy chain variable domains are connected to heavy chain constant domains represented by SEQ ID NOs: 943 and 942, respectively, and wherein the first and second light chain variable domains are connected to light chain constant domains both represented by SEQ ID NO:

12.

6. A pharmaceutical preparation comprising the bispecific antibody according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.

7. Use of the bispecific antibody according to any one of claims 1 to 5 or the pharmaceutical preparation according to claim 6 in the preparation of a medicament for treating a coagulopathy, wherein the coagulopathy is selected from hemophilia A with or without inhibitors; hemophilia B with or without inhibitors; FVII(a) deficiency; and Glanzmann thrombocytopenia.

Images