A primer and typing probe combination for detecting human papillomavirus and its application

Abstract

The present invention provides a primer and typing probe combination for detecting human papillomavirus and its application. The primer and typing probe combination for detecting human papillomavirus comprises a universal primer pair and a typing probe for amplifying the late region L1 region of the human papillomavirus genome; the universal primer pair comprises an upstream primer group and a downstream primer group; the upstream primer group comprises an upstream primer 1, an upstream primer 2 and an upstream primer 3; the downstream primer group comprises a downstream primer 1, a downstream primer 2 and a downstream primer 3. The primer and typing probe combination for detecting human papillomavirus can detect and distinguish 28 HPV subtypes, which is superior to current domestic similar products, has a wider coverage and is more representative.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a primer and typing probe combination for detecting human papillomavirus and an application thereof. Background Art

[0002] Cervical cancer is the most common gynecological malignancy, and its incidence tends to be younger. Early screening, detection and treatment of cervical cancer are the key to effectively preventing and treating cervical cancer. Studies have shown that infection with human papillomavirus (HPV) is directly related to the occurrence of cervical cancer. HPV belongs to the papillomaviridae family and is a small molecule, non-enveloped circular double-stranded DNA virus that can cause proliferation of the squamous epithelium of human skin and mucous membranes. Currently, more than 190 HPV subtypes have been identified, and about 50 of them specifically infect the stratified squamous epithelium of the skin and mucous membranes of the human reproductive tract.

[0003] In clinical practice, HPV is divided into three categories: high-risk, medium-risk and low-risk according to the pathogenicity of different HPV subtypes. The National Medical Products Administration defines HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59 and HPV68 as high-risk types, and HPV26, HPV53, HPV66, HPV73 and HPV82 as medium-risk types. In addition, common low-risk HPV types include HPV6, HPV11, HPV40, HPV43, HPV54, HPV61, HPV81 and HPV83. In addition to causing genital warts, medium- and high-risk HPV can also cause genital cancer and cervical cancer. Medium- and high-risk HPV are the main pathogens that cause cervical cancer. About 99% of cervical cancers are caused by persistent or repeated infection with high-risk HPV. Low-risk HPV mainly causes benign lesions such as condyloma acuminatum of the male and female genitalia, but if not diagnosed and treated in time, it may also develop into cancer. In particular, HPV16 and HPV18 are closely related to cervical cancer. HPV16 mainly causes squamous cell carcinoma, and HPV18 is mainly related to adenocarcinoma. Therefore, accurate typing and detection of HPV subtypes are of great significance for the early diagnosis and treatment of cervical cancer and other wart-like lesions.

[0004] Since HPV cannot be cultured in vitro, it is not possible to use simple serum tests for HPV diagnosis and typing. Clinical methods for detecting HPV include cytology, immunohistochemistry, in situ hybridization, dot hybridization, nucleic acid blotting and PCR, among which PCR has the highest sensitivity and is simple, efficient and inexpensive, making it the most widely used method. Currently, the main methods for clinical HPV detection in China include real-time fluorescence PCR, gene chip and hybrid capture 2 (HC-2).

[0005] Real-time fluorescence PCR technology adds fluorescent labeled probes to conventional PCR. From PCR amplification to results, it is run in a completely closed system, without the need for PCR post-processing, thus avoiding the possibility of contamination and cross-contamination of amplified products. At the same time, hybridization with specific probes during amplification further improves the sensitivity and specificity of the experiment, and the amplification process can be monitored in real time.

[0006] The essence of HC-2 is gene hybridization signal amplification technology, which adopts the principle of molecular hybridization and chemiluminescence signal amplification. The signal amplification belongs to linear series amplification and does not require gene amplification. This technology uses an RNA probe with a full length of 8,000 bases to denature the target DNA into a single strand and then hybridize it with the RNA probe to form a DNA-RNA hybrid, which is then captured by a microplate coated with anti-DNA-RNA hybrid antibodies. The DNA-RNA hybrid is combined with a second antibody labeled with multiple alkaline phosphatases, and the signal intensity is measured by enzyme chemiluminescence. Compared with the standard, the concentration of the target nucleic acid in the sample is calculated by the software.

[0007] At present, the detection of HPV by gene chip method in China is all based on DNA chip technology that combines PCR amplification and DNA reverse dot hybridization (RDB). At present, the domestic HPV genotyping detection kits all use the genetic characteristics of HPV to design specific primers, which can simultaneously amplify target fragments of up to 28 HPV genotypes.

[0008] Real-time fluorescence PCR technology still has unavoidable defects, including: it can only detect whether the sample is infected with the corresponding HPV genotype, but does not have a specific typing function; the detection of a single subtype is time-consuming; when multiple subtypes are detected simultaneously, interference between primers will lead to reduced detection sensitivity; the early stages of real-time fluorescence PCR generally require a cumbersome nucleic acid extraction process; and a relatively expensive fluorescence quantitative PCR instrument is required.

[0009] HC-2 technology also has inherent defects, including: low detection specificity, about 85%, slightly lower than liquid-based cytology; HC-2 technology is a comprehensive application of nucleic acid hybridization, immune response and chemiluminescence technology, with high detection complexity and cost; it is unable to accurately perform HPV genotyping; RNA probes have poor stability and high requirements for experimental conditions and operating techniques; it is easy to cause cross-reactions and lead to false positive results, and there is a certain cross-reaction between high-risk and low-risk types.

[0010] Gene chip RDB technology also has its defects, including: the need to design multiple sets of primers for different HPV genotypes in the early stage, the PCR reaction system is relatively complex, and the interference between primers in the actual amplification leads to reduced detection sensitivity or even missed detection; because a large number of primers are used, the corresponding product production process is complicated, which greatly increases the cost.

[0011] Therefore, there is still a need to seek new universal primer pairs and develop more efficient HPV genotyping detection methods to more sensitively and specifically detect different subtypes of HPV, thereby playing a role in screening cervical cancer and early lesions in the early stages. Summary of the invention

[0012] In view of the shortcomings of the prior art, the object of the present invention is to provide a primer and typing probe combination for detecting human papillomavirus and its application. The primer and typing probe combination for detecting human papillomavirus can detect and distinguish 28 HPV subtypes, which is generally more than the current domestic similar products, with wider coverage and more representativeness. The typing probe has good specificity and can achieve accurate genotyping of 28 subtypes of HPV in the sample; the typing probe has high sensitivity; it can effectively detect HPV low copy number positive samples; the typing probe has high accuracy and can effectively detect HPV composite type positive samples, significantly reducing the amplification bias in the multiplex PCR detection system. The human papillomavirus typing detection kit provided by the present invention has high efficiency in detecting the amplification of target gene fragments, a simple system, and low detection cost.

[0013] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0014] In a first aspect, the present invention provides a primer and typing probe combination for detecting human papillomavirus, wherein the primer and typing probe combination for detecting human papillomavirus comprises a universal primer pair and a typing probe for amplifying the late region L1 region of the human papillomavirus genome;

[0015] The universal primer pair includes an upstream primer set and a downstream primer set;

[0016] The upstream primer set includes upstream primer 1, upstream primer 2 and upstream primer 3;

[0017] The upstream primer set includes the nucleotide sequences shown in SEQ ID No. 1 to 3;

[0018] The downstream primer set includes downstream primer 1, downstream primer 2 and downstream primer 3;

[0019] The downstream primer set includes the nucleotide sequences shown in SEQ ID No. 4-6.

[0020] In the present invention, the universal primer pair is a novel universal primer pair obtained by screening and developing by comparing the genomes of many subtypes of HPV and taking different sequence conserved regions. The upstream primer set and the downstream primer set of the universal primer pair have the following characteristics:

[0021] (1) High GC content (corresponding to a higher Tm value);

[0022] (2) The sequence is more conservative;

[0023] (3) Both the upstream and downstream primers were designed with multiple primers to avoid the use of degenerate bases and ensure that the 3′ end of the primer set could effectively match the HPV sequences of different subtypes;

[0024] (4) The sites with large base differences between the upstream primer and the downstream primer are replaced by the universal base 3-nitropyrrole, which can effectively reduce the instability of the primer-target sequence binding caused by base mismatch at this site and improve the amplification efficiency.

[0025] In the present invention, the number of primers in the universal primer pair is significantly reduced, the amplification efficiency of detecting the target gene fragment is significantly improved, the system is simple, and the detection cost is low.

[0026] Preferably, the universal primer pair contains a universal base, and the universal base includes any one of 3-nitropyrrole, 5-nitroindole, 3-formamido-5-nitroindole or 4-nitro-1-hydroimidazole, or a combination of at least two thereof.

[0027] Preferably, the universal base is 3-nitropyrrole.

[0028] In the present invention, when 3-nitropyrrole is added to the universal primer pair, the amplification effect is the best.

[0029] In the present invention, the nucleotide sequence of the upstream primer 1 includes SEQ ID NO.1, the nucleotide sequence of the upstream primer 2 includes SEQ ID NO.2, the nucleotide sequence of the upstream primer 3 includes SEQ ID NO.3, the nucleotide sequence of the downstream primer 1 includes SEQ ID NO.4, the nucleotide sequence of the downstream primer 2 includes SEQ ID NO.5, and the nucleotide sequence of the downstream primer 3 includes SEQ ID NO.6.

[0030] SEQ ID NO. 1: AATAGGGCPGGTGCTPTTGGTGA.

[0031] SEQ ID NO. 2: AATAGGGCPGGCACTPTGGGCGA.

[0032] SEQ ID NO. 3: AATAGGGCPGTGCTPTGGGGGA.

[0033] SEQ ID NO. 4: CCCTGPGCCCGTTGPAACCA.

[0034] SEQ ID NO. 5: CCCTGPGCCTTTTGPAGCCA.

[0035] SEQ ID NO. 6: CCCTGPGCCCGTTGPATCCA.

[0036] Preferably, the typing probes include probes 1-28.

[0037] Preferably, the typing probe comprises the nucleotide sequences shown in SEQ ID No. 7-34.

[0038] Preferably, the 5' ends of probes 1 to 28 in the typing probes are labeled with an NH2 group.

[0039] Preferably, the subtypes of human papillomavirus detected by probes 1 to 28 in the typing probes include: HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81 and HPV83.

[0040] In the present invention, 28 typing probes can realize accurate genotyping of 28 subtypes of HPV in samples with good specificity; can effectively detect HPV low copy number positive samples with high sensitivity; can effectively detect HPV composite type positive samples, significantly reduce the amplification bias in the multiplex PCR detection system, and improve the detection accuracy.

[0041] In a second aspect, the present invention provides a human papillomavirus typing hybridization membrane strip, the human papillomavirus typing hybridization membrane strip comprising a substrate and a probe fixed on the substrate, the probe comprising the typing probe described in the first aspect.

[0042] Preferably, the human papillomavirus typing hybridization membrane strip includes at least one HPV subtype detection point and a positive quality control point.

[0043] Preferably, the positive quality control points include color development control points and internal reference gene points.

[0044] Preferably, the probe of the color development control point includes the nucleotide sequence shown in SEQ ID No.103.

[0045] Preferably, the 3' end of the probe of the color development control point is labeled with a biotin group.

[0046] Preferably, the probe of the internal reference gene locus comprises the nucleotide sequence shown in SEQ ID No.104.

[0047] Preferably, the internal reference gene site detects the β-actin gene.

[0048] Preferably, the upstream primer for amplifying the β-actin gene includes the nucleotide sequence shown in SEQ ID No.105.

[0049] Preferably, the downstream primer for amplifying the β-actin gene includes the nucleotide sequence shown in SEQ ID No.106.

[0050] Preferably, the 5' ends of the probes of the internal reference gene spot and the color development control spot are labeled with an NH2 group.

[0051] SEQ ID No. 103: ATGCTGAGCTCACTGTCAGTCACAC.

[0052] SEQ ID No. 104: CGAGGAGCACCCCGTGCTGCT.

[0053] SEQ ID No. 105: GCACCACACCTTCTACAATG.

[0054] SEQ ID No. 106: ATCTGGGTCATCTTCTCGCG.

[0055] In the present invention, the color development of the internal reference gene point in the membrane strip indicates that the sampling, DNA extraction and PCR processes are normal, the color development of the color control point indicates that the hybridization process is normal, and the remaining points in the membrane strip represent 28 subtypes of HPV, and the color development of different points indicates the detection of the subtype of HPV corresponding to the point.

[0056] Preferably, the substrate of the human papillomavirus typing hybridization membrane strip comprises a nitrocellulose membrane and / or a nylon membrane.

[0057] In a third aspect, the present invention provides a human papillomavirus typing detection kit, which comprises the universal primer pair described in the first aspect and the human papillomavirus typing hybridization membrane strip described in the second aspect.

[0058] Preferably, the human papillomavirus typing detection kit further comprises a reverse dot hybridization reagent and a PCR amplification reagent.

[0059] Preferably, the PCR amplification reagents include Taq enzyme and PCR buffer.

[0060] In the present invention, the reverse dot hybridization reagent includes hybridization solution I concentrated solution, hybridization solution II concentrated solution, solution I concentrated solution, solution II concentrated solution, solution III concentrated solution and solution IV concentrated solution.

[0061] The hybridization solution I concentrate is a 10×SSC buffer solution containing 0.35wt% to 0.65wt% SDS. The concentration of SDS can be, for example, 0.35wt%, 0.45wt%, 0.55wt% or 0.65wt%.

[0062] The hybridization solution II concentrate is a 2.5×SSC buffer containing 0.25wt% to 0.45wt% SDS. The concentration of SDS can be, for example, 0.25wt%, 0.3wt%, 0.35wt%, 0.4wt% or 0.45wt%.

[0063] The solution I concentrate is an aqueous solution containing POD, and the concentration of POD in the solution I concentrate is 8 Vol% to 16 Vol%, for example, it can be 8 Vol%, 10 Vol%, 12 Vol%, 14 Vol% or 16 Vol%, etc.

[0064] The solution II concentrate includes a trisodium citrate solution, and the concentration of the trisodium citrate solution is 0.2-0.3M, for example, 0.2M, 0.22M, 0.24M, 0.26M, 0.28M or 0.3M.

[0065] The solution III concentrate includes TMB and DMSO. The concentration of TMB in the solution III concentrate is 4.5-5.5 mg / mL, for example, 4.5 mg / mL, 4.8 mg / mL, 5.0 mg / mL, 5.2 mg / mL or 5.5 mg / mL, and the concentration of DMSO is 4 Vol%-8 Vol%, for example, 4 Vol%, 5 Vol%, 6 Vol%, 7 Vol% or 8 Vol%, etc.

[0066] The solution IV concentrate includes H2O2 solution, and the concentration of the H2O2 solution is 10wt% to 30wt%, for example, it can be 10wt%, 15wt%, 20wt%, 25wt% or 30wt%.

[0067] In a fourth aspect, the present invention provides a method for using the human papillomavirus typing detection kit described in the third aspect for the purpose of non-disease diagnosis and / or treatment, the method comprising the following steps:

[0068] (1) collecting and processing a nucleic acid sample to be tested, adding the nucleic acid sample to be tested and the universal primer pair to a PCR amplification reagent, mixing, and obtaining a PCR system;

[0069] (2) amplifying the PCR system;

[0070] (3) denaturing the PCR product and performing reverse dot hybridization using the human papillomavirus typing hybridization membrane strip;

[0071] (4) Determine the subtype of the nucleic acid sample to be tested based on the position of the color developing point.

[0072] Preferably, the final concentrations of upstream primer 1, upstream primer 2, upstream primer 3, downstream primer 1, downstream primer 2 and downstream primer 3 in the PCR system are each independently 0.4 to 1 pmol / μL, for example, 0.4 pmol / μL, 0.5 pmol / μL, 0.6 pmol / μL, 0.7 pmol / μL, 0.8 pmol / μL, 0.9 pmol / μL or 1 pmol / μL, etc.

[0073] Preferably, the final concentration of Taq enzyme in the PCR system is 0.05-0.20 U / μL, for example, 0.05 U / μL, 0.08 U / μL, 0.10 U / μL, 0.15 U / μL or 0.20 U / μL.

[0074] Preferably, the denaturation temperature in step (3) is 95-100°C, for example, 95°C, 96°C, 97°C, 98°C, 99°C or 100°C.

[0075] Preferably, the method of use further comprises the steps of amplifying and detecting using primers for amplifying an internal reference gene.

[0076] In the present invention, the amplification PCR system includes Taq enzyme, UDG enzyme, upstream primer 1, upstream primer 2, upstream primer 3, downstream primer 1, downstream primer 2, downstream primer 3, dNTPs and PCR buffer.

[0077] The final concentration of the UDG enzyme is 0.02-0.1 U / μL, for example, 0.02 U / μL, 0.04 U / μL, 0.06 U / μL, 0.08 U / μL or 0.1 U / μL.

[0078] The final concentration of the dNTPs is 0.4-0.7 mM, for example, 0.4 mM, 0.45 mM, 0.5 mM, 0.55 mM, 0.6 mM, 0.65 mM or 0.7 mM.

[0079] The procedure of amplification described in the present invention is:

[0080] Incubate at 47-53° C. for 2-5 min. The temperature may be, for example, 47° C., 49° C., 50° C., 51° C. or 53° C., and the time may be, for example, 2 min., 3 min., 4 min. or 5 min.

[0081] Incubate at 93-97°C for 3-8 min. The temperature may be, for example, 93°C, 93.5°C, 94°C, 94.5°C, 95°C, 95.5°C, 96°C, 96.5°C or 97°C. The time may be, for example, 3 min, 5 min or 8 min.

[0082] Incubate at 92-96° C. for 1-2 seconds, where the temperature may be, for example, 92° C., 93° C., 94° C., 95° C., or 96° C., and the time may be, for example, 1 second or 2 seconds;

[0083] Incubate at 53-58° C. for 1-2 seconds, the temperature may be, for example, 53° C., 54° C., 55° C., 56° C., 57° C. or 58° C., and the time may be, for example, 1 second or 2 seconds;

[0084] Incubate at 70-74° C. for 35-45 seconds, where the temperature may be, for example, 70° C., 71° C., 72° C., 73° C., or 74° C., and the time may be, for example, 35 seconds, 38 seconds, 40 seconds, 42 seconds, or 45 seconds;

[0085] The number of cycles is 38 to 42, for example, 38, 39, 40, 41 or 42.

[0086] Incubate at 70-74°C for 3-8 min. The temperature may be, for example, 70°C, 71°C, 72°C, 73°C or 74°C, and the time may be, for example, 3 min, 5 min or 8 min.

[0087] As a preferred technical solution of the present invention, the method for using the human papillomavirus typing detection kit for the purpose of non-disease diagnosis and / or treatment comprises the following steps:

[0088] (1) collecting and processing a nucleic acid sample to be tested, adding the nucleic acid sample to be tested and a universal primer pair to an amplification reagent, mixing them, and obtaining a PCR system;

[0089] The amplification PCR system comprises Taq enzyme, UDG enzyme, upstream primer 1, upstream primer 2, upstream primer 3, downstream primer 1, downstream primer 2, downstream primer 3, dNTPs and PCR buffer.

[0090] In the amplified PCR system, the final concentrations of upstream primer 1, upstream primer 2, upstream primer 3, downstream primer 1, downstream primer 2 and downstream primer 3 are each independently 0.4-1 pmol / μL; the final concentration of the Taq enzyme is 0.05-0.20 U / μL; the final concentration of the UDG enzyme is 0.02-0.1 U / μL; and the final concentration of the dNTPs is 0.4-0.7 mM.

[0091] (2) Amplify the PCR system:

[0092] The amplification procedure is as follows:

[0093] Incubate at 47-53°C for 2-5 minutes.

[0094] Incubate at 93-97°C for 3-8 minutes;

[0095] Incubate at 92-96°C for 1-2 seconds, 53-58°C for 1-2 seconds, and 70-74°C for 35-45 seconds for 38-42 cycles;

[0096] Incubate at 70-74°C for 3-8 minutes.

[0097] (3) The PCR product was denatured at 95-100°C and reverse dot hybridization was performed using a human papillomavirus typing hybridization membrane strip and a reverse dot hybridization reagent.

[0098] (4) Determine the subtype of the nucleic acid sample to be tested based on the position of the color developing point:

[0099] The color development of the internal reference gene point in the membrane strip indicates that the sampling, DNA extraction and PCR processes are normal, the color development of the color control point indicates that the hybridization process is normal, and the remaining points in the membrane strip represent 28 subtypes of HPV, and the color development of different points indicates the detection of the subtype of HPV corresponding to the point.

[0100] In a fifth aspect, the present invention provides a human papillomavirus typing detection system, the human papillomavirus typing detection system comprising:

[0101] (1) Sample preparation module: collecting and processing the nucleic acid sample to be tested, adding the nucleic acid sample to be tested and the universal primer pair to the PCR amplification reagent, mixing, and preparing the PCR system;

[0102] (2) Amplification module: amplify the PCR system;

[0103] (3) Detection module: denaturing the PCR product and performing reverse dot hybridization using the human papillomavirus typing hybridization membrane strip;

[0104] (4) Analysis module: Determine the subtype of the nucleic acid sample to be tested based on the position of the color developing point.

[0105] In a sixth aspect, the present invention provides the use of any one or a combination of at least two of the primer and typing probe combination for detecting human papillomavirus described in the first aspect, the human papillomavirus typing hybridization membrane strip described in the second aspect, the human papillomavirus typing detection kit described in the third aspect, or the human papillomavirus typing detection system described in the fifth aspect in the preparation of a product for detecting human papillomavirus.

[0106] The numerical range described in the present invention not only includes the point values ​​listed above, but also includes any point values ​​between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific point values ​​included in the range.

[0107] Compared with the prior art, the present invention has the following beneficial effects:

[0108] (1) The number of universal primers for detecting human papillomavirus provided in the present invention is relatively small, the efficiency of target gene fragment amplification is significantly improved, the system is simple, and the detection cost is low.

[0109] (2) The typing probe for detecting human papillomavirus provided in the present invention corresponds to distinguishing 28 subtypes of HPV (HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81 and HPV83), and can achieve accurate genotyping of 28 subtypes of HPV in samples with good specificity; can effectively detect HPV low copy number positive samples with high sensitivity; can effectively detect HPV composite type positive samples, significantly reduce the amplification bias existing in the multiplex PCR detection system, and improve detection accuracy.

[0110] (3) The human papillomavirus typing detection kit described in the present invention generally detects more HPV subtypes than current domestic similar products, with a wider coverage and greater representativeness. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1Schematic diagram of different amplification conditions in Test Example 1 and Test Example 2, wherein - indicates no target amplification band, + indicates a weaker target amplification band, ++ indicates a brighter target amplification band, and M indicates a standard DNA molecular weight marker.

[0112] Figure 2 It is the electrophoresis diagram of the amplification products of the universal primer pair for amplifying human papillomavirus described in Example 1 in Test Example 3, which are the amplification products of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58 and HPV59, M-DL500 DNA Marker.

[0113] Figure 3 It is the electrophoresis diagram of the amplification products of the universal primer pair for amplifying human papillomavirus described in Example 1 in Test Example 3, which are the amplification products of HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81, HPV83 and HPV negative control, M-DL500 DNA Marker.

[0114] Figure 4 This is the electrophoresis diagram of the amplification products of the GP5+ / GP6+ primer set in Test Example 3, which are the amplification products of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58 and HPV59, M-DL500 DNA Marker.

[0115] Figure 5 It is the electrophoresis diagram of the amplification products of the GP5+ / GP6+ primer set in Test Example 3, which are the amplification products of HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81, HPV83 and HPV negative control, M-DL500 DNA Marker.

[0116] Figure 6 This is the electrophoresis diagram of the amplification products of the MY11 / MY09 primer set in Test Example 3, which are the amplification products of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58 and HPV59, M-DL500 DNA Marker.

[0117] Figure 7 It is the electrophoresis diagram of the amplification products of the MY11 / MY09 primer set in Test Example 3, which are the amplification products of HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81, HPV83 and HPV negative control, M-DL500 DNA Marker.

[0118] Figure 8 This is a graph showing the test results of the human papillomavirus typing test kit in Test Example 4. DETAILED DESCRIPTION

[0119] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0120] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0121] The sources of materials in the following specific embodiments are as follows:

[0122] POD: CAS No. 9003-99-0, Product No. P8021, Brand: Solarbio.

[0123] Trisodium citrate: CAS No. 6132-04-3, GR grade, Shanghai test.

[0124] TMB: CAS No. 54827-17-7, biochemical reagent grade, Wokai.

[0125] DMSO: CAS No. 67-68-5, Voke.

[0126] Taq enzyme: Product No. TAQ-I033, Beijing Boerma Biotechnology Co., Ltd.

[0127] Example 1

[0128] The present embodiment provides a universal primer pair for amplifying human papillomavirus, wherein the universal primer pair amplifies genes in the late region L1 region of the human papillomavirus genome, and the universal primer pair for amplifying human papillomavirus comprises an upstream primer group and a downstream primer group; the upstream primer group comprises upstream primer 1, upstream primer 2 and upstream primer 3; the downstream primer group comprises downstream primer 1, downstream primer 2 and downstream primer 3.

[0129] The nucleotide sequence of upstream primer 1 is shown as SEQ ID NO.1, the nucleotide sequence of upstream primer 2 is shown as SEQ ID NO.2, the nucleotide sequence of upstream primer 3 is shown as SEQ ID NO.3, the nucleotide sequence of downstream primer 1 is shown as SEQ ID NO.4, the nucleotide sequence of downstream primer 2 is shown as SEQ ID NO.5, the nucleotide sequence of downstream primer 3 is shown as SEQ ID NO.6, and the sequence of the universal primer pair is shown in Table 1.

[0130] Table 1

[0131] Primer type Serial number sequence Upstream Primer 1 SEQ ID NO.1 AATAGGGCPGGTGCTPTTGGTGA Upstream primer 2 SEQ ID NO.2 AATAGGGCPGGCACTPTGGGCGA Upstream primer 3 SEQ ID NO.3 AATAGGGCPGGTGCTPTGGGGGA Downstream Primer 1 SEQ ID NO.4 CCCTGPGCCCGTTGPAACCA Downstream primer 2 SEQ ID NO.5 CCCTGPGCCTTTTGPAGCCA Downstream primer 3 SEQ ID NO.6 CCCTGPGCCCGTTGPATCCA

[0132] Here, P represents the base 3-nitropyrrole.

[0133] Comparative Example 1

[0134] This comparative example provides a universal primer pair for detecting human papillomavirus, wherein the universal primer pair amplifies genes in the late region L1 region of the human papillomavirus genome.

[0135] The universal primer pair includes an upstream primer set and a downstream primer set, wherein the upstream primer set includes upstream primer 4, upstream primer 5 and upstream primer 6, and the downstream primer set includes downstream primer 4, downstream primer 5 and downstream primer 6. The sequence of the universal primer pair is shown in Table 2.

[0136] Table 2

[0137] Primer type Serial number sequence Upstream primer 4 SEQ ID No.7 AATAGGGCPGGCGCTPTGGGTGA Upstream primer 5 SEQ ID No.8 AATAGGGCPGGCACTPTGGGCGA Upstream primer 6 SEQ ID No.9 AATAGGGCPGGTGCTPTTGGGGA Downstream primer 4 SEQ ID No.10 CCCTGPGCACGTTGPAACCA Downstream primer 5 SEQ ID No.11 CCCTGPGCCCGTTGPAGCCA Downstream primer 6 SEQ ID No.12 CCCTGPGCCTTTTGPATCCA

[0138] Comparative Example 2

[0139] This comparative example provides a universal primer pair for detecting human papillomavirus, wherein the universal primer pair amplifies genes in the late region L1 region of the human papillomavirus genome.

[0140] The universal primer pair includes an upstream primer set and a downstream primer set, wherein the upstream primer set includes upstream primer 7, upstream primer 8 and upstream primer 9, and the downstream primer set includes downstream primer 7, downstream primer 8 and downstream primer 9. The sequence of the universal primer pair is shown in Table 3.

[0141] Table 3

[0142] Primer type Serial number sequence Upstream primer 7 SEQ ID No.13 AATAGGGCPGGCACTPTGGGTGA Upstream primer 8 SEQ ID No.14 AATAGGGCPGGTGCTPTTGGCGA Upstream primer 9 SEQ ID No.15 AATAGGGCPGGCACTPTGGGGGA Downstream primer 7 SEQ ID No.16 CCCTGPGCCCGTTGPAACCA Downstream primer 8 SEQ ID No.17 CCCTGPGCCTTTTGPAGCCA Downstream primer 9 SEQ ID No.18 CCCTGPGCACGTTGPATCCA

[0143] Comparative Example 3

[0144] This comparative example provides a universal primer pair for detecting human papillomavirus, the universal primer pair includes a degenerate base universal primer pair, a B universal primer pair, an F universal primer pair and an H universal primer pair, and the sequence of the universal primer pair is shown in Table 4.

[0145] Table 4

[0146]

[0147]

[0148] Note: P, B, F, H represent 3-nitropyrrole, 5-nitroindole, 3-formamido-5-nitroindole and 4-nitro-1-hydroimidazole, respectively; degenerate bases are marked as, D represents G or A or T, R represents A or G, N represents A or T or G or C, and Y represents C or T.

[0149] Comparative Example 4

[0150] This comparative example provides a universal primer pair for detecting human papillomavirus, wherein the universal primer pair is a GP5+ / GP6+ primer set, and the sequence of the GP5+ / GP6+ primer set is shown in Table 5.

[0151] Table 5

[0152]

[0153] Comparative Example 5

[0154] This comparative example provides a universal primer pair for detecting human papillomavirus, wherein the universal primer pair is a MY11 / MY09 primer set, and the sequence of the MY11 / MY09 primer set is shown in Table 6.

[0155] Table 6

[0156]

[0157] Note: Degenerate bases are marked as M for A or C, W for A or T, Y for C or T, and R for A or G.

[0158] Test Example 1

[0159] Using the universal primer pair for amplifying human papillomavirus described in Example 1 and the universal primer pairs for amplifying human papillomavirus described in Comparative Examples 1 and 2, human papillomavirus samples were amplified, and the samples included 28 HPV subtypes positive clinical samples.

[0160] The PCR system of the amplification is as follows:

[0161]

[0162]

[0163] The amplification procedure is as follows:

[0164] Incubate at 50°C for 3 min.

[0165] Incubate at 95°C for 5 min.

[0166] Incubate at 94°C for 1 s, 55°C for 1 s, and 72°C for 40 s for 40 cycles;

[0167] Incubate at 72°C for 5 min.

[0168] After the amplification, the amplified product was subjected to agarose gel electrophoresis. The results showed that the universal primer pair for amplifying human papillomavirus described in Example 1 was able to amplify brighter target bands (target amplified band size was 170 bp) for 28 subtypes of HPV clinical samples, while the universal primer pairs for amplifying human papillomavirus described in Comparative Examples 1 and 2 were unable to amplify target bands of some subtypes of HPV clinical samples or could only amplify weaker target bands. The results of agarose gel electrophoresis were statistically analyzed, and the specific statistical results are shown in Table 7. The results showed that the universal primer pair for amplifying human papillomavirus described in Example 1 had a higher amplification efficiency.

[0169] Table 7

[0170]

[0171] Note: - indicates no target amplification band; + indicates a weaker target amplification band; ++ indicates a brighter target amplification band; Schematic diagram of different amplification conditions is as follows Figure 1 shown.

[0172] Test Example 2

[0173] The universal primer pair for amplifying human papillomavirus in Example 1 and the universal primer pair for amplifying human papillomavirus in Comparative Example 3 were used to amplify human papillomavirus samples, respectively, and the samples included 28 HPV subtypes positive clinical samples.

[0174] The universal primer pairs for detecting human papillomavirus in Comparative Example 3 include a degenerate base universal primer pair (abbreviated as degenerate base), a B universal primer pair (abbreviated as B), an F universal primer pair (abbreviated as F) and an H universal primer pair (abbreviated as H).

[0175] The PCR system for the amplification is consistent with that in Test Example 1; the procedure for the amplification is consistent with that in Test Example 1.

[0176] After the amplification, the amplified product was subjected to agarose gel electrophoresis. The electrophoresis results showed that the primers for human papillomavirus described in Example 1 were able to amplify brighter target bands for 28 subtypes of HPV clinical samples, while other universal primer pairs corresponding systems could not amplify target bands for some subtypes of HPV clinical samples or could only amplify weaker target bands. The results of agarose gel electrophoresis were statistically analyzed, and the specific statistical results are shown in Table 8. The universal primer pair for amplifying human papillomavirus described in Example 1 has a higher amplification efficiency, indicating that the universal base 3-nitropyrrole has the best effect.

[0177] Table 8

[0178]

[0179] Note: - indicates no target amplification band; + indicates a weaker target amplification band; ++ indicates a brighter target amplification band; Schematic diagram of different amplification conditions is as follows Figure 1 shown.

[0180] Test Example 3

[0181] The universal primer pairs for amplifying human papillomavirus described in Example 1 and the universal primer pairs for amplifying human papillomavirus in Comparative Examples 4 and 5 were sequenced and analyzed, and the universal primer pairs in Example 1, Comparative Example 4 and Comparative Example 5 were used to amplify human papillomavirus samples, respectively, including 28 HPV subtypes positive clinical samples and 1 HPV negative clinical sample.

[0182] (1) Sequence analysis

[0183] The primers in Example 1, Comparative Example 4 and Comparative Example 5 were sequenced using BioEdit 5.0.6 (analysis software). The results of sequence analysis showed that the GP5+ / GP6+ primer set and the MY11 / MY09 primer set had obvious deficiencies:

[0184] The GC content in the sequences of the GP5+ / GP6+ and MY11 / MY09 primer sets is low, and the corresponding Tm values ​​are low (around 50°C), especially the GP5+ / GP6+ primer set, whose Tm value is 46°C. Therefore, in the actual amplification procedure, the annealing temperature will be low (the annealing temperature corresponding to the GP5+ / GP6+ primer set reported in the literature is 40°C, while the annealing temperature range for general PCR amplification is 53-60°C), resulting in excessive nonspecific amplification and affecting the amplification efficiency of the target product;

[0185] There are base mismatches between the primer set sequences and the HPV sequences of specific subtypes, especially the 3' end of the GP5+ / GP6+ primer set has obvious mismatches;

[0186] There are multiple degenerate bases in the MY11 / MY09 primer set, resulting in the primers having multiple base types at the degenerate base sites, thus further increasing the probability of base mismatch between the primer set sequence and the HPV sequence of a specific subtype;

[0187] During primer synthesis, degenerate bases are randomly added. There are multiple degenerate bases in the MY11 / MY09 primer set. The specific sequence of the degenerate bases is random. Therefore, there are large differences in the MY11 / MY09 primer sets synthesized in different batches, which is uncertain and greatly reduces the detection stability.

[0188] The size of the target amplification product (amplicon) in the amplification system corresponding to the MY11 / MY09 primer set is 450 bp, which is significantly larger than the 100-200 bp amplicon in the general PCR detection method, and will also reduce the actual amplification efficiency;

[0189] In general, the amplification efficiency of the target gene fragments of 28 HPV subtypes was greatly reduced when the GP5+ / GP6+ primer set and the MY11 / MY09 primer set were used to amplify the target gene fragments of 28 HPV subtypes.

[0190] The upstream primer set and the downstream primer set in Example 1 have the following characteristics:

[0191] The GC content is higher (corresponding to a higher Tm value); the sequence is more conservative; both the upstream primer set and the downstream primer set adopt a multiple-strip design to avoid the use of degenerate bases and ensure that the 3' end of the primer set can effectively match the HPV sequences of different subtypes; the sites with large base differences in the upstream primer set and the downstream primer are replaced by the universal base 3-nitropyrrole, which can effectively reduce the instability of the primer-target sequence binding caused by the base mismatch at the site and improve the efficiency of amplification.

[0192] (2) Sample amplification

[0193] In Comparative Example 4, the universal primer pair for amplifying human papillomavirus is the GP5+ / GP6+ primer set; and in Comparative Example 5, the universal primer pair for amplifying human papillomavirus is the MY11 / MY09 primer set.

[0194] The PCR system for amplification of three different universal primer pairs is consistent with that in Test Example 1.

[0195] When the universal primer pair for amplifying human papillomavirus described in Example 1 is used to amplify the sample, the PCR procedure is the same as that in Test Example 1.

[0196] When amplifying samples using the GP5+ / GP6+ primer set, the PCR procedure is as follows:

[0197] Incubate at 50°C for 3 min.

[0198] Incubate at 95°C for 4 min.

[0199] Incubate at 94°C for 1 min, 40°C for 2 min, and 72°C for 1.5 min for 40 cycles;

[0200] Incubate at 72°C for 4 min.

[0201] When amplifying samples using the MY11 / MY09 primer set, the PCR procedure is as follows:

[0202] Incubate at 50°C for 3 min.

[0203] Incubate at 95°C for 9 min.

[0204] Incubate at 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min for 40 cycles;

[0205] Incubate at 72°C for 5 min.

[0206] The three PCR amplification products were subjected to agarose gel electrophoresis. The electrophoresis diagram of the amplification products of the universal primer pair for amplifying human papillomavirus described in Example 1 is as follows: Figure 2 and Figure 3 As shown, Figure 2 It is an electrophoretic diagram of the amplified products of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58 and HPV59; wherein Figure 3 The electrophoretic diagrams of the amplified products of HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81, HPV83 and HPV negative control; Figure 2 and Figure 3 The middle M lane is DL500 DNA Marker.

[0207] The electrophoresis of the amplified product of the GP5+ / GP6+ primer set is shown in Figure 4 and Figure 5 As shown, Figure 4 It is an electrophoretic diagram of the amplified products of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58 and HPV59; wherein Figure 5The electrophoretic diagrams of the amplified products of HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81, HPV83 and HPV negative control; Figure 4 and Figure 5 The middle M lane is the DL500 DNA Marker.

[0208] The electrophoresis of the amplification product of the MY11 / MY09 primer set is shown in Figure 6 and Figure 7 As shown, Figure 6 It is an electrophoretic diagram of the amplified products of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58 and HPV59; wherein Figure 7 The electrophoretic diagrams of the amplified products of HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81, HPV83 and HPV negative control; Figure 6 and Figure 7 The middle M lane is the DL500 DNA Marker.

[0209] After amplification by the GP5+ / GP6+ primer set, the MY11 / MY09 primer set, and the universal primer pair for amplifying human papillomavirus described in Example 1, the amplified products of 28 subtypes of HPV-positive clinical samples and 1 HPV-negative clinical sample were subjected to electrophoresis, and the electrophoresis results were compared and observed. It can be seen that the target amplified product band size corresponding to the GP5+ / GP6+ primer set is 140bp; the target amplified product band size corresponding to the MY11 / MY09 primer set is 450bp; the target amplified product band size corresponding to the primers in Example 1 is 170bp. The results show that the amplified bands of the GP5+ / GP6+ primer set and the MY11 / MY09 primer set for some subtype samples are weak, and the amplified products of some samples also have more non-specific bands. The target amplified product band of the universal primer pair in Example 1 is significantly brighter, and no obvious non-specific bands are observed, indicating that the universal primer pair in Example 1 has a higher amplification efficiency.

[0210] Example 2

[0211] This embodiment provides a typing probe for detecting human papillomavirus, the typing probe includes probes 1 to 28, and the 5' ends of the probes 1 to 28 are labeled with NH2 groups. The nucleotide sequences of the typing probes are shown in SEQ ID No. 47 to 74, and the sequences of the typing probes are shown in Table 9.

[0212] Table 9

[0213] Probe HPV subtypes Serial number <![CDATA[Sequence (NH2-5’→3’)]]> 1 HPV6 SEQ ID No.47 TGTGCCTGATACTCTTATAATTAAGGGTAGTGG 2 HPV11 SEQ ID No.48 GGGTAATAACAGATCATCTGTAGCTAGTAGT 3 HPV40 SEQ ID No.49 CAGGTACATCTGGTCGGACTCCTATTGCAG 4 HPV42 SEQ ID No.50 TGCATCTGGCAGACATAATTTAGGTAGTAGTA 5 HPV43 SEQ ID No.51 GCTGGCTCTAATACCAGGTCCAAATTGCAG 6 HPV44 SEQ ID No.52 GTGCTAGTAAAATACTGTTCCTAATGCTATAT 7 HPV54 SEQ ID No.53 CATTAAGAAATCCTCAGGTAACCTTGACAGTTCT 8 HPV61 SEQ ID No.54 AGGGTGCGAATGACAAGGCGGCCCCTGGTAGT 9 HPV81 SEQ ID No.55 GAAGGGTGCTGCAGGCAGTGACAGATAAC 10 HPV83 SEQ ID No.56 CTAATATAGGAACACTCTTACCAGCTACATC 11 HPV16 SEQ ID No.57 CTCTGGGTCTACTGCAAATTTAGCCAGTTCAAAT 12 HPV18 SEQ ID No.58 CACAGGTATGCGTGCTTCACCTGGCAGCT 13 HPV26 SEQ ID No.59 TGAATCAGGCAGGGAGCCCCCTACATCTTCT 14 HPV31 SEQ ID No.60 CTCCGGTTCAACAGCTACTTTAGCTAAACAG 15 HPV33 SEQ ID No.61 AGGAACTACTGCCTCTATTCAAAGCAGTG 16 HPV35 SEQ ID No.62 TACCACTGGCACATTGCCTAGTACTAGTTAT 17 HPV39 SEQ ID No.63 CACAGATATACGTGCAACCCCGGTAGTTCT 18 HPV45 SEQ ID No.64 CACTAGCGCTAATATGCGTGAAACCCCTG 19 HPV51 SEQ ID No.65 TAGTGGTAATGGCCGTGACCCTATAGAAAGT 20 HPV52 SEQ ID No.66 AGGGTCTAACTCTGGCAATACTGCCACTG 21 HPV53 SEQ ID No.67 TAGTAATGGCAGGGACCCGCCCCCCTAGCT 22 HPV56 SEQ ID No.68 TAGCAAATGGTAGGAAACCCCCTCCTAGTTCT 23 HPV58 SEQ ID No.69 GTCCGGTAATACTGCAGTTATCCAAAGTAGTG 24 HPV59 SEQ ID No.70 TACTGACATACGTGCCAACCCAGGCAGTTATT 25 HPV66 SEQ ID No.71 GTGGCAATGGCAGGGACCCTCCTCCCAGTT 26 HPV68 SEQ ID No.72 CACTGACATACGTGACAGTCCTAGTAGTTATG 27 HPV73 SEQ ID No.73 CACAGGCAATACTGCAACACCATCCAGTTGT 28 HPV82 SEQ ID No.74 TGGTGCTGGCCGCGACCCTATTAGTAGTTAT

[0214] Comparative Example 6

[0215] This comparative example provides a typing probe for detecting human papillomavirus, the typing probe includes probes 29 to 56, and the 5' end of the probes 29 to 56 is labeled with an NH2 group. The nucleotide sequence of the typing probe is shown in SEQ ID No. 75 to 102, and the sequence of the typing probe is shown in Table 10.

[0216] Table 10

[0217]

[0218]

[0219] Example 3

[0220] This embodiment provides a human papillomavirus typing hybridization membrane strip, which includes a substrate and a probe fixed on the substrate. The probe is the typing probe for detecting human papillomavirus described in Example 2.

[0221] The human papillomavirus typing hybridization membrane strip includes 28 HPV subtype detection points and two positive quality control points; the positive quality control points include color control points and internal reference gene points, and the substrate of the human papillomavirus typing hybridization membrane strip is a nitrocellulose membrane. The nucleotide sequence of the probe of the color control point is shown in SEQ ID No.103, and the 3' end of the probe of the color control point is labeled with a biotin group. The nucleotide sequence of the probe of the internal reference gene point is shown in SEQ ID No.104.

[0222] SEQ ID No. 103: ATGCTGAGCTCACTGTCAGTCACAC.

[0223] SEQ ID No. 104: CGAGGAGCACCCCGTGCTGCT.

[0224] Comparative Example 7

[0225] This comparative example provides a human papillomavirus typing hybridization membrane strip, which comprises a substrate and a probe fixed on the substrate, and the probe is the typing probe for detecting human papillomavirus described in Comparative Example 6.

[0226] The human papillomavirus typing hybridization membrane strip includes 28 HPV subtype detection points and two positive quality control points; the positive quality control points include color control points and internal reference gene points, and the substrate of the human papillomavirus typing hybridization membrane strip is a nitrocellulose membrane. The nucleotide sequence of the probe of the color control point is shown in SEQ ID No.103, and the 3' end of the probe of the color control point is labeled with a biotin group. The nucleotide sequence of the probe of the internal reference gene point is shown in SEQ ID No.104.

[0227] Example 4

[0228] This embodiment provides a human papillomavirus typing detection kit, which includes the universal primer pair described in Example 1 and the human papillomavirus typing hybridization membrane strip described in Example 3, and the kit also includes a reverse dot hybridization reagent and a PCR amplification reagent.

[0229] The reverse dot hybridization reagent includes hybridization solution I concentrated solution, hybridization solution II concentrated solution, solution I concentrated solution, solution II concentrated solution, solution III concentrated solution and solution IV concentrated solution.

[0230] The hybridization solution I concentrate (1000 mL) comprises the following components:

[0231]

[0232] The hybridization solution II concentrate (1000 mL) includes the following components:

[0233]

[0234] The solution I concentrate (20 mL) includes the following components:

[0235] Component volume (mL)

[0236] POD solution 3.2 mL

[0237] Sterile purified water 16.8mL

[0238] The solution II concentrate (1000 mL) comprises the following components:

[0239] Component volume (mL)

[0240] Trisodium citrate 65g

[0241] Sterile purified water 1000mL

[0242] The solution III concentrate (1000 mL) comprises the following components:

[0243]

[0244] The solution IV concentrate is a 20 wt% H2O2 solution.

[0245] The PCR amplification reagent includes Taq enzyme and PCR buffer.

[0246] The 20×SSC buffer contains 3M sodium chloride and 0.3M sodium citrate.

[0247] Comparative Example 8

[0248] This comparative example provides a human papillomavirus typing detection kit, which includes the universal primer pair described in Example 1 and the human papillomavirus typing hybridization membrane strip described in Comparative Example 7, and the kit also includes a reverse dot hybridization reagent and a PCR amplification reagent.

[0249] The reverse dot hybridization reagent and PCR amplification reagent are the same as those in Example 4.

[0250] Test Example 4

[0251] The human papillomavirus typing detection kit provided in Example 4 and the human papillomavirus typing detection kit provided in Comparative Example 8 were used to detect 28 subtypes of HPV clinical samples.

[0252] (1) Collecting and processing the nucleic acid sample to be tested, adding the nucleic acid sample to be tested and the universal primer pair to a PCR amplification reagent, mixing, and obtaining a PCR system; the PCR system is consistent with that in Test Example 1.

[0253] A PCR system for detecting an internal reference gene was prepared, and the nucleotide sequence of the upstream primer for amplifying the internal reference gene β-actin was shown in SEQ ID No. 105; the nucleotide sequence of the downstream primer for amplifying the internal reference gene β-actin was shown in SEQ ID No. 106; the PCR system referred to the PCR system in Test Example 1.

[0254] SEQ ID No. 105: GCACCACACCTTCTACAATG.

[0255] SEQ ID No. 106: ATCTGGGTCATCTTCTCGCG.

[0256] (2) Amplify the PCR system.

[0257] The amplification procedure is consistent with that in Test Example 1.

[0258] (3) The PCR product was denatured and reverse dot hybridization was performed using a human papillomavirus typing hybridization membrane strip.

[0259] The PCR product in step (2) was incubated at 98°C for 8 minutes to denature the PCR product, and then immediately placed in an ice-water mixture for more than 2 minutes.

[0260] Prepare the reagents for reverse dot blot:

[0261] Hybridization solution I: 100 mL of hybridization solution I concentrate + 300 mL of sterile purified water;

[0262] Hybridization solution II: 100 mL of hybridization solution II concentrate + 300 mL of sterile purified water;

[0263] Solution II: 100 mL of Solution II concentrate + 300 mL of sterile purified water;

[0264] Solution IV: 200 μL Solution IV concentrate + 1800 μL sterile purified water;

[0265] Binding solution: 60 mL hybridization solution II + 60 μL solution I;

[0266] Color development solution: 40 mL solution II + 4 mL solution III + 20 μL solution IV;

[0267] Perform reverse dot hybridization on the denatured PCR product and the human papillomavirus typing hybridization membrane strip:

[0268] Take 28 15mL clean plastic tubes and place them in a centrifuge tube rack; use tweezers to pick up the human papillomavirus typing hybridization membrane strips and mark the sample number to be tested on the edge of the membrane strips; put each membrane strip into a 15mL plastic tube, add 8mL of hybridization solution I to each plastic tube, and set aside.

[0269] Hybridization: Add the denatured PCR product to a 15 mL plastic tube of the corresponding sample number and cover the tube tightly; place the centrifuge tube flat in a 42°C water bath shaker and hybridize at low speed (100 rpm) for 1 hour; place hybridization solution II in a water bath shaker and preheat to 42°C for use.

[0270] Binding: Discard hybridization solution I and transfer the membrane strip into a 50 mL centrifuge tube. Add the freshly prepared binding solution and place in a 42°C water bath shaker, and rotate at low speed (120 rpm) for 10 minutes.

[0271] Wash the membrane: discard the binding solution, take out the membrane strip, transfer it to a 50mL centrifuge tube, add hybridization solution II preheated to 42℃, place it in a 42℃ water bath shaker, and wash the membrane at low speed (120rpm) for 10 minutes.

[0272] Color development: discard hybridization solution II, take out the membrane strip, transfer it to a 50mL centrifuge tube, add the freshly prepared color development solution, shake gently at 20℃ and develop color for 10 minutes in the dark.

[0273] Termination: Take out the membrane strip and place it in 20mL of solution II to stop color development for 2 minutes.

[0274] (4) Determine the subtype of the nucleic acid sample to be tested based on the position of the color developing point.

[0275] The CC point in the membrane strip is the color control point, and the color development indicates that the hybridization process is normal; the PC point is the internal reference gene point, and the color development indicates that the sampling, DNA extraction and PCR amplification processes are normal; the remaining points represent 28 subtypes of HPV, and the color development of different points indicates the detection of the corresponding subtype of HPV at that point.

[0276] After amplification, hybridization and color development, the results showed that the corresponding subtype color points on the human papillomavirus typing hybridization membrane strip in the human papillomavirus typing detection kit provided in Example 4 were obvious, and no other points were colored. The detection results of the human papillomavirus typing hybridization membrane strip are shown in the figure below: Figure 8 As shown, it is shown that the human papillomavirus typing detection kit provided in Example 4 can effectively detect 28 subtypes of HPV present in clinical samples, and the detection specificity is good.

[0277] Compared with Example 4, the corresponding color points of each subtype on the human papillomavirus typing hybridization membrane strip in the human papillomavirus typing detection kit provided in Comparative Example 8 are not obvious, and no color points are observed in the samples of HPV26, HPV33, HPV52, HPV73, HPV42, HPV54 and HPV81. The results show that the human papillomavirus typing detection kit provided in Comparative Example 8 cannot detect all 28 subtypes of HPV.

[0278] Test Example 5

[0279] The human papillomavirus typing detection kit provided in Example 4 and similar domestic products were used to detect 28 subtypes of HPV clinical samples.

[0280] (1) Comparison of clinical sample testing at different dilution multiples

[0281] Take 28 HPV subtypes of clinical samples, dilute them 10 times with sample diluent 1 , 10 2 , 10 3 , 10 4 and 10 5times, using the human papillomavirus typing detection kit provided in Example 4 and a domestic similar product, the domestic similar product is product A, the name of product A is human papillomavirus genotyping (type 23) detection kit (PCR-reverse dot hybridization method), National Food and Drug Administration Machinery (Approved) No. 2012 3400059, to detect the above diluted samples.

[0282] The detection steps of the human papillomavirus typing detection kit provided in Example 4 refer to Test Example 4, and the detection steps of the product A refer to the instructions of product A.

[0283] The test results showed that the kit of Example 4 could detect the dilution of 10 3 ~10 5 HPV clinical samples of different subtypes were detected by product A, while product A could only detect 10 dilution 2 ~10 4 The test results are shown in Table 11. It can be seen from Table 11 that the human papillomavirus typing detection kit provided in Example 4 has higher sensitivity.

[0284] Table 11

[0285]

[0286]

[0287] Note: - indicates no color spot; + indicates a color spot; * indicates that product A does not have the function of detecting this subtype of HPV.

[0288] (2) Comparison of HPV-negative and HPV-positive clinical samples

[0289] 300 clinical samples of female cervical exfoliated cells were used, and corresponding nucleic acid samples were obtained by nucleic acid extraction. The samples were tested by the human papillomavirus typing detection kit provided in Example 4 and product A, respectively. The statistical data of the test results are shown in Table 12. The test results show that the proportion of medium- and high-risk HPV positives detected by the human papillomavirus typing detection kit provided in Example 4 was 52.0%, which was significantly higher than the test result of product A; the proportion of HPV negatives detected by the human papillomavirus typing detection kit provided in Example 4 was 26.3%, which was significantly lower than the test result of product A; the human papillomavirus typing detection kit provided in Example 4 detected 32 medium- and high-risk HPV composite-type positive samples, accounting for 10.7%, which was significantly higher than the test result of product A, and detected 14 medium- and high-risk HPV composite-type positive samples, accounting for 4.7%.

[0290] Table 12

[0291]

[0292] Note: Single-type positivity indicates that the test sample is infected with a single subtype of HPV; compound-type positivity indicates that the test sample is infected with 2 or more subtypes of HPV.

[0293] In addition, 156 clinical samples whose test results of the human papillomavirus typing detection kit provided in Example 4 were positive for medium- and high-risk HPV were verified by gene sequence sequencing, and the sequencing results were completely consistent with the test results of the human papillomavirus typing detection kit provided in Example 4, indicating that the human papillomavirus typing detection kit provided in Example 4 is more sensitive and has higher accuracy.

[0294] In summary, the primer and typing probe combination for detecting human papillomavirus provided by the present invention can detect and distinguish 28 subtypes of HPV, which is generally more than the current domestic similar products, with wider coverage and more representativeness. The typing probe corresponds to distinguishing 28 HPV subtypes, and the typing probe has good specificity, which can achieve accurate genotyping of 28 subtypes of HPV in the sample; the typing probe has high sensitivity; it can effectively detect HPV low copy number positive samples; the typing probe has high accuracy, which can effectively detect HPV composite type positive samples, and significantly reduce the amplification bias existing in the multiplex PCR detection system.

[0295] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention. Sequence Listing <110> Guangzhou Anping Pharmaceutical Technology Co., Ltd. <120> A primer and typing probe combination for detecting human papillomavirus and its application <130> 2021 <160> 106 <170> PatentIn version 3.3 <210> 1 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 1 aatagggcgg tgctttggtg a 21 <210> 2 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 2 aatagggcgg cacttgggcg a 21 <210> 3 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 3 aatagggcgg tgcttggggg a 21 <210> 4 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 4 ccctggcccg ttgaacca 18 <210> 5 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 5 ccctggcctt ttgagcca 18 <210> 6 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 6 ccctggcccg ttgatcca 18 <210> 7 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 7 aatagggcgg cgcttgggtg a 21 <210> 8 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 8 aatagggcgg cacttgggcg a 21 <210> 9 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 9 aatagggcgg tgctttgggg a 21 <210> 10 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 10 ccctggcacg ttgaacca 18 <210> 11 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 11 ccctggcccg ttgagcca 18 <210> 12 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 12 ccctggcctt ttgatcca 18 <210> 13 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 13 aatagggcgg cacttgggtg a 21 <210> 14 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 14 aatagggcgg tgctttggcg a 21 <210> 15 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 15 aatagggcgg cacttggggg a 21 <210> 16 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 16 ccctggcccg ttgaacca 18 <210> 17 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 17 ccctggcctt ttgagcca 18 <210> 18 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 18 ccctggcacg ttgatcca 18 <210> 19 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 19 aatagggcdg gtgctrttgg tga 23 <210> 20 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 20 aatagggcdg gcactrtggg cga 23 <210> twenty one <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> twenty one aatagggcdg gtgctrtggg gga 23 <210> twenty two <211> 20 <212> DNA <213> Artificially synthesized sequences <220> <221> misc_feature <222> (6) <223> n is a, c, g, or t <400> twenty two ccctgngccc gttgyaacca 20 <210> twenty three <211> 20 <212> DNA <213> Artificially synthesized sequences <220> <221> misc_feature <222> (6) <223> n is a, c, g, or t <400> twenty three ccctgngcct tttgyagcca 20 <210> twenty four <211> 20 <212> DNA <213> Artificially synthesized sequences <220> <221> misc_feature <222> (6) <223> n is a, c, g, or t <400> twenty four ccctgngccc gttgyatcca 20 <210> 25 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 25 aatagggcbg gtgctbttgg tga 23 <210> 26 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 26 aatagggcbg gcactbtggg cga 23 <210> 27 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 27 aatagggcbg gtgctbtggg gga 23 <210> 28 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 28 ccctgbgccc gttgbaacca 20 <210> 29 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 29 ccctgbgcct tttgbagcca 20 <210> 30 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 30 ccctgbgccc gttgbatcca 20 <210> 31 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 31 aatagggcgg tgctttggtg a 21 <210> 32 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 32 aatagggcgg cacttgggcg a 21 <210> 33 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 33 aatagggcgg tgcttggggg a 21 <210> 34 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 34 ccctggcccg ttgaacca 18 <210> 35 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 35 ccctggcctt ttgagcca 18 <210> 36 <211> 18 <212> DNA <213> Artificially synthesized sequences <400> 36 ccctggcccg ttgatcca 18 <210> 37 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 37 aatagggchg gtgcthttgg tga 23 <210> 38 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 38 aatagggchg gcacthtggg cga 23 <210> 39 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 39 aatagggchg gtgcthtggg gga 23 <210> 40 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 40 ccctghgccc gttghaacca 20 <210> 41 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 41 ccctghgcct tttghagcca 20 <210> 42 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 42 ccctghgccc gttghatcca 20 <210> 43 <211> twenty three <212> DNA <213> Artificially synthesized sequences <400> 43 tttgttactg tggtagatac tac 23 <210> 44 <211> 25 <212> DNA <213> Artificially synthesized sequences <400> 44 gaaaaataaa ctgtaaatca tattc 25 <210> 45 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 45 gcmcagggwc ataayaatgg 20 <210> 46 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 46 cgtccmarrg gawactgatc 20 <210> 47 <211> 33 <212> DNA <213> Artificially synthesized sequences <400> 47 tgtgcctgat actcttataa ttaagggtag tgg 33 <210> 48 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 48 gggtaataac agatcatctg tagctagtag t 31 <210> 49 <211> 30 <212> DNA <213> Artificially synthesized sequences <400> 49 caggtacatc tggtcggact cctattgcag 30 <210> 50 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 50 tgcatctggc agacataatt taggtagtag ta 32 <210> 51 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 51 gctggctcta ataccaggtc caaaattgca g 31 <210> 52 <211> 33 <212> DNA <213> Artificially synthesized sequences <400> 52 gtgctagtaa aaatactgtt cctaatgcta tat 33 <210> 53 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 53 cattaagaaa tcctcaggta accttgacag ttct 34 <210> 54 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 54 agggtgcgaa tgacaaggcg gcccctggta gt 32 <210> 55 <211> 30 <212> DNA <213> Artificially synthesized sequences <400> 55 gaagggtgct gcaggcagtg acagaataac 30 <210> 56 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 56 ctaatagtag gaacactctt accagctaca tc 32 <210> 57 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 57 ctctgggtct actgcaaatt tagccagttc aaat 34 <210> 58 <211> 29 <212> DNA <213> Artificially synthesized sequences <400> 58 cacaggtatg cgtgcttcac ctggcagct 29 <210> 59 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 59 tgaatcaggc agggagcccc ctacatcttc t 31 <210> 60 <211> 30 <212> DNA <213> Artificially synthesized sequences <400> 60 ctccggttca acagctactt tagctaacag 30 <210> 61 <211> 29 <212> DNA <213> Artificially synthesized sequences <400> 61 aggaactact gcctctattc aaagcagtg 29 <210> 62 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 62 taccactggc acattgccta gtactagtta t 31 <210> 63 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 63 cacagatata cgtgcaaccc ccggtagttc t 31 <210> 64 <211> 29 <212> DNA <213> Artificially synthesized sequences <400> 64 cactagcgct aatatgcgtg aaacccctg 29 <210> 65 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 65 tagtggtaat ggccgtgacc ctatagaaag t 31 <210> 66 <211> 29 <212> DNA <213> Artificially synthesized sequences <400> 66 agggtctaac tctggcaata ctgccactg 29 <210> 67 <211> 29 <212> DNA <213> Artificially synthesized sequences <400> 67 tagtaatggc agggacccgc cccctagct 29 <210> 68 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 68 tagcaatggt agagaacccc ctcctagttc t 31 <210> 69 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 69 gtccggtaat actgcagtta tccaaagtag tg 32 <210> 70 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 70 tactgacata cgtgccaacc caggcagtta tt 32 <210> 71 <211> 30 <212> DNA <213> Artificially synthesized sequences <400> 71 gtggcaatgg cagggaccct cctcccagtt 30 <210> 72 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 72 cactgacata cgtgacagtc ctagtagtta tg 32 <210> 73 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 73 cacaggcaat actgcaacac catccagttg t 31 <210> 74 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 74 tggtgctggc cgcgacccta ttagtagtta t 31 <210> 75 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 75 aagggtagtg gaaatcgaac gtctgtaggg a 31 <210> 76 <211> 27 <212> DNA <213> Artificially synthesized sequences <400> 76 tgtgcctgatgacctgttgg taaaagg 27 <210> 77 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 77 gtgtcccaac tgacttatat ataacaggta catc 34 <210> 78 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 78 tgatgaactg tataccaagg ctgctaataa tgca 34 <210> 79 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 79 tgtgccttcc gatatgtata ttgctggctc t 31 <210> 80 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 80 ccaggatctg gttattaaaa gtgctagtaa a 31 <210> 81 <211> 36 <212> DNA <213> Artificially synthesized sequences <400> 81 ctgtacctaa tgacttatac attaagaaat cctcag 36 <210> 82 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 82 ctgcctgact ctttattatct taagggtgcg aatg 34 <210> 83 <211> 33 <212> DNA <213> Artificially synthesized sequences <400> 83 ccttacctgc agacttatat atgaagggtg ctg 33 <210> 84 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 84 tacctcttat tatattccag gcacatctgc t 31 <210> 85 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 85 gtaccagacg atttatacat taaaggctct gggt 34 <210> 86 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 86 gcctcaatcc ttatatatta aaggcacagg tatg 34 <210> 87 <211> 33 <212> DNA <213> Artificially synthesized sequences <400> 87 caccactttg tatattaaag gtgctgaatc agg 33 <210> 88 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 88 gtccctactg acttatatat taaaggctcc g 31 <210> 89 <211> 30 <212> DNA <213> Artificially synthesized sequences <400> 89 tgttcccgat gacctgtaca ttaaaggttc 30 <210> 90 <211> 33 <212> DNA <213> Artificially synthesized sequences <400> 90 cagtacctgc agacctatat attaagggta cca 33 <210> 91 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 91 ctgcccaatt gtatattaag ggcacagata tacg 34 <210> 92 <211> 36 <212> DNA <213> Artificially synthesized sequences <400> 92 cagtacctac agacctatat attaaaggca ctagcg 36 <210> 93 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 93 cattcctaac gattattata ttaagggtag tg 32 <210> 94 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 94 tgtgccaagt gatttatata tacaagggtc t 31 <210> 95 <211> 36 <212> DNA <213> Artificially synthesized sequences <400> 95 atacctaatg acttatatat taagggtagt aatggc 36 <210> 96 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 96 caatacctgc agagttatat ttaaagggta gc 32 <210> 97 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 97 tgtcccggat gacctttata ttaaagggtc cg 32 <210> 98 <211> 33 <212> DNA <213> Artificially synthesized sequences <400> 98 acttcctgaa tcactatata ttaaaggtac tga 33 <210> 99 <211> 31 <212> DNA <213> Artificially synthesized sequences <400> 99 ccattcctac agatttgtat tggaagggtg g 31 <210> 100 <211> 34 <212> DNA <213> Artificially synthesized sequences <400> 100 ctattcctac tgaattgtat attaagggca ctga 34 <210> 101 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 101 atcccagatg aactaatgat taaaggcaca gg 32 <210> 102 <211> 32 <212> DNA <213> Artificially synthesized sequences <400> 102 cattccagac aaggcttata ttaagggtac tg 32 <210> 103 <211> 25 <212> DNA <213> Artificially synthesized sequences <400> 103 atgctgagct cactgtcagt cacac 25 <210> 104 <211> twenty one <212> DNA <213> Artificially synthesized sequences <400> 104 cgaggagcac cccgtgctgc t 21 <210> 105 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 105 gcaccacacc ttctacaatg 20 <210> 106 <211> 20 <212> DNA <213> Artificially synthesized sequences <400> 106 atctgggtca tcttctcgcg 20

Claims

1. A primer and typing probe combination for detecting human papillomavirus, characterized in that: The primer and typing probe combination for detecting human papillomavirus comprises a universal primer pair and a typing probe for amplifying the late region L1 region of the human papillomavirus genome; The universal primer pair includes an upstream primer set and a downstream primer set; The upstream primer set includes upstream primer 1, upstream primer 2 and upstream primer 3; The nucleotide sequences of the upstream primer set are shown as AATAGGGCPGGTGCTPTTGGTGA, AATAGGGCPGGCACTPTGGGCGA and AATAGGGCPGGTGCTPTGGGGGA; The downstream primer set includes downstream primer 1, downstream primer 2 and downstream primer 3; The nucleotide sequences of the downstream primer set are shown as CCCTGPGCCCGTTGPAACCA, CCCTGPGCCTTTTGPAGCCA and CCCTGPGCCCGTTGPATCCA; The universal primer pair contains a universal base P, and the universal base P is 3-nitropyrrole; The typing probes include probes 1 to 28; The nucleotide sequences of the typing probes are shown in SEQ ID No. 47-74.

2. The combination of primers and typing probes for detecting human papillomavirus according to claim 1, characterized in that: The 5' ends of probes 1 to 28 in the typing probes are labeled with NH2 groups.

3. The combination of primers and typing probes for detecting human papillomavirus according to claim 2, characterized in that: The subtypes of human papillomavirus detected by probes 1 to 28 in the typing probes are: HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, HPV82, HPV6, HPV11, HPV40, HPV42, HPV43, HPV44, HPV54, HPV61, HPV81 and HPV83.

4. A human papillomavirus typing detection kit, characterized in that: The human papillomavirus typing detection kit comprises the universal primer pair described in any one of claims 1 to 3; The human papillomavirus typing detection kit also includes a human papillomavirus typing hybridization membrane strip, The human papillomavirus typing hybridization membrane strip comprises a substrate and a probe fixed on the substrate, and the probe comprises the typing probe according to any one of claims 1 to 3.

5. The human papillomavirus typing detection kit according to claim 4, characterized in that: The human papillomavirus typing hybridization membrane strip includes at least one HPV subtype detection point and a positive quality control point; The positive quality control points include color development control points and internal reference gene points; The nucleotide sequence of the probe of the color development control point is shown in SEQ ID No.103; The 3' end of the probe of the color development control point is labeled with a biotin group; The nucleotide sequence of the probe of the internal reference gene locus is shown in SEQ ID No.104; The internal reference gene point detection β -actin gene; Amplify the β The nucleotide sequence of the upstream primer of the -actin gene is shown in SEQ ID No.105; Amplify the β The nucleotide sequence of the downstream primer of the -actin gene is shown in SEQ ID No.106; The 5' ends of the probes for the internal reference gene site and the color development control site are labeled with an NH2 group; The substrate of the human papillomavirus typing hybridization membrane strip comprises a nitrocellulose membrane and / or a nylon membrane.

6. The human papillomavirus typing detection kit according to claim 4 or 5, characterized in that: The human papillomavirus typing detection kit also includes a reverse dot hybridization reagent and a PCR amplification reagent; The PCR amplification reagent includes Taq enzyme and PCR buffer.

7. A method for using the human papillomavirus typing detection kit according to any one of claims 4 to 6 for purposes other than disease diagnosis and / or treatment, characterized in that: The method of use comprises the following steps: (1) collecting and processing a nucleic acid sample to be tested, adding the nucleic acid sample to be tested and the universal primer pair to a PCR amplification reagent, mixing them, and obtaining a PCR system; (2) Amplifying the PCR system; (3) denaturing the PCR product and performing reverse dot hybridization using the human papillomavirus typing hybridization membrane strip; (4) Determine the subtype of the nucleic acid sample to be tested based on the location of the color spot.

8. The method for using the human papillomavirus typing detection kit according to claim 7 for purposes other than disease diagnosis and / or treatment, characterized in that: The final concentrations of upstream primer 1, upstream primer 2, upstream primer 3, downstream primer 1, downstream primer 2 and downstream primer 3 in the PCR system are independently 0.4-1 pmol / μL; The final concentration of Taq enzyme in the PCR system is 0.05-0.20 U / μL; The denaturation temperature in step (3) is 95-100°C; The method of use also includes the steps of amplifying and detecting using primers for amplifying the internal reference gene.

9. A human papillomavirus typing detection system, characterized in that: The human papillomavirus typing detection system comprises: (1) Sample preparation module: collecting and processing the nucleic acid sample to be tested, adding the nucleic acid sample to be tested and the universal primer pair described in any one of claims 1 to 3 to a PCR amplification reagent to prepare a PCR system; (2) Amplification module: amplify the PCR system; (3) Detection module: denaturing the PCR product and performing reverse dot hybridization using the human papillomavirus typing hybridization membrane strip described in claim 4 or 5; (4) Analysis module: Determine the subtype of the nucleic acid sample to be tested based on the position of the color developing point.

10. Use of any one of the primer and typing probe combination for detecting human papillomavirus according to any one of claims 1 to 3, the human papillomavirus typing detection kit according to any one of claims 4 to 6, or the human papillomavirus typing detection system according to claim 9 in the preparation of a product for detecting human papillomavirus.

Images