A sorghum disease resistance gene and its application

Abstract

The present invention relates to a sorghum disease resistance gene and its application. SbRLK1 , is from sorghum ( Sorghum bicolor The disease resistance gene cloned from (L) Moench SAP35) encodes a LRR-RLK receptor kinase protein. The disease resistance function of this gene in different crops and its possible mechanism of action were further studied, providing a theoretical basis for disease resistance breeding of sorghum and other crops.

Description

Technical Field

[0001] The invention relates to the technical field of plant disease-resistant gene identification and genetic engineering, and in particular to a sorghum disease-resistant gene and application thereof. Background Art

[0002] Plants rely on two types of immune capabilities to resist the invasion of pathogens, namely innate immunity and systemic immunity, which are the immune capabilities of the cells themselves and the systemic signals generated after infection. The innate immune response is divided into two levels: pattern-triggered immunity (PTI) and effector-triggered immunity (ETI), which prevent pathogens from invading plants by forming a barrier.

[0003] Some conserved molecular structures in microorganisms are called microorganism-associated molecular motifs or pathogen-associated molecular motifs (PAMPs). For the host, these are non-self components that need to be recognized and responded to. Receptor-like protein kinases (RLKs) are a subfamily of protein kinases and are the largest type of surface receptor proteins discovered so far. Most of them act as pattern recognition receptors PRRs to mediate the PTI immune response stimulated by pathogen-associated molecular patterns in plants. Most of these kinases are located on the plasma membrane, and some kinases in a very small number of cytoplasmic receptor kinase subfamilies are located in the cytoplasm. The extracellular domain of plant receptor protein kinases recognizes and receives signals, and the transmembrane domain localizes the protein on the plasma membrane and transmits the recognized signal to the intracellular kinase domain. The intracellular kinase domain receives the signal to activate phosphorylation, and transmits the signal to the next-level signal transmitter through phosphorylation and activates the expression of a series of disease-resistant related proteins in plant cells.

[0004] Leucine-rich repeats-receptor-like protein kinase (LRR-RLKs) is currently the largest family of plant RLKs. In Arabidopsis, this kinase accounts for almost half of all RLKs. Its typical feature is that it has LRR repeat units, which are composed of leucine-rich conservative sequences arranged in series, generally located at the N-terminus or C-terminus of the protein. Its tertiary structure forms a new α helix / β fold, in which the most conserved amino acids form β folds, located on the surface of the three-dimensional structure of the protein, which may be related to the formation of the receptor region structure. The number of LRR repeats involved in the interaction between proteins may determine the specificity of the interaction.

[0005] So far, many LRR-RLK genes have been cloned from a variety of higher plants such as Arabidopsis, rice, and wheat, as pattern recognition receptors PRRs mediating PTI immune responses. For example, in Arabidopsis, the pattern recognition receptor FLS2 that can recognize bacterial flagellin flagellin and the pattern recognition receptor EFR (EF-Tureceptor) that can recognize elongation factor EF-Tu, EFR and FLS2 have similar structures and both belong to the LRRVII subfamily. The PRR in rice is XA21, which belongs to the LRRVII subfamily together with FLS2 and EFR. Chitin (N-acetylcitin oligosaccharide) in the cell wall of most fungi can act as fungal PAMPs and induce resistance responses in many plants such as wheat and barley. The chitin recognition receptor CERK1 in Arabidopsis and the chitin binding protein CEBiP in rice are transmembrane proteins that contain two LysMs outside the cell. Similar to the structure of receptor-like proteins, they also have extracellular leucine repeat sequences and transmembrane domains, but lack a protein kinase domain in the cytoplasm.

[0006] Smut is a common disease on crops such as sorghum, corn, wheat, and sugarcane. Among them, head smut is an important sorghum disease that is distributed all over the world and is also one of the main diseases that affect the development of crop production. my country's sorghum variety approval adopts a one-vote veto system for the head smut resistance of varieties. Every year, the resistance of varieties participating in regional trials is identified through inoculation. However, the sorghum planting variety background in my country is relatively single, the variety diversity is poor, and the disease resistance is weak, which has led to the aggravation of head smut. Because the vast majority of Chinese sorghum varieties lack genes for resistance to smut, the resistance sources that have been identified so far are mostly foreign resources or have foreign relatives. And due to the variability of sorghum head smut fungi and the emergence of new races, it is difficult to solve the problem once and for all. my country's sorghum breeding and production practices have shown that the emergence of new physiological races will cause a number of resistance sources to lose resistance. Therefore, it has become an important research topic to breed new disease-resistant varieties of better quality, continuously explore new disease-resistant genes, and improve the broad-spectrum disease resistance of crops. Actively introducing foreign germplasm resources and exploring and utilizing resistance genes is an important approach. At present, there is no report on the cloning of sorghum disease resistance genes at home and abroad, and the disease resistance and immunity mechanism of sorghum is also unknown. The disease resistance genes mined and screened from sorghum immune varieties introduced from abroad in the present invention can provide experimental and theoretical basis for the analysis of the disease resistance mechanism of sorghum and C4 crops, and can also provide reference and new gene resources for the disease resistance molecular breeding of sorghum and other similar crops. Summary of the invention

[0007] The present invention adopts homologous cloning technology, designs primers with reference to similar nucleotide sequences, and isolates and clones the sorghum smut resistance gene through conventional PCR method. SbRK1Through genetic transformation, sorghum and rice were made resistant to head smut, rice blast, rice false smut and bacterial leaf blight, confirming the function of the gene.

[0008] A broad-spectrum disease resistance gene in sorghum SbRK1 , having the nucleotide sequence shown in SEQ ID NO.1, or a nucleotide sequence in which one or more nucleotides are replaced, deleted or added, and encodes the same amino acid sequence.

[0009] A protein encoding a broad-spectrum disease resistance gene in sorghum SbRK1 The encoded protein has the amino acid sequence shown in SEQ ID NO.2.

[0010] One of the SbRK1 pBWA(V)-Ubi-SbRLK1-GFP overexpression vector of the gene.

[0011] The pBWA(V)-Ubi-SbRLK1-GFP overexpression vector is a host.

[0012] The application of the gene or the encoded protein in sorghum and rice breeding.

[0013] The gene, the encoded protein or the overexpression vector is used in improving sorghum resistance to smut, and rice resistance to rice blast, rice false smut, sheath blight and bacterial blight.

[0014] A transgenic plant comprising a transgenic plant cell comprising a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide comprises a nucleic acid sequence encoding an amino acid sequence having at least 90% sequence identity when compared to any one of SEQ ID NO: 1.

[0015] The present invention SbRK1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, the gene is 2748 bp in length, encoding 916 amino acids, and the protein sequence is shown in SEQ ID NO. 2. The protein belongs to the LRR-RLK family, and the domain includes an extracellular leucine repeat sequence-transmembrane region-intracellular phosphokinase active region.

[0016] use SbRK1 Gene construct pBWA(V)-Ubi- SbRK1 The overexpression vector was transformed into sorghum and rice by gene bombardment and Agrobacterium-mediated methods, respectively. SbRK1Overexpressed sorghum and rice transgenic lines. The resistance of the transgenic lines to sorghum head smut, rice blast, bacterial leaf blight and rice false smut was identified in the field and indoors, confirming the disease resistance function of the gene.

[0017] Taking into account the degeneracy of codons, for example, in the coding region, without changing the amino acid sequence, or in the non-coding region without affecting protein expression, the sequence encoding the above gene is modified. Therefore, this patent also includes the sense sequence or antisense sequence of the gene, including a cloning vector or expression vector containing the nucleotide sequence or a fragment thereof, a host cell containing the vector, and a transformed plant cell and a transgenic plant containing the nucleotide sequence or a fragment thereof.

[0018] The following is cloned and verified SbRK1 Gene steps:

[0019] 1. After the immune sorghum SAP35 and the common susceptible sorghum BTx623 were inoculated with pathogens, the total RNA was extracted and transcriptome sequencing analysis and comparison were performed, and a receptor kinase protein gene sequence with a large up-regulated expression range was screened. SbRK1 The disease resistance gene was amplified from the immune sorghum variety SAP35 using the first strand of cDNA synthesized from total RNA of sorghum leaves as a template by homologous cloning technology. SbRK1 sequence.

[0020] 2. SbRK1 The complete open reading frame of the sequence was inserted downstream of the Ubi promoter and upstream of GFP to construct an overexpression vector pBWA(V)-Ubi-srlk1-gfp, which was then introduced into the immature embryos of common sorghum Tx430 by gene bombardment. It was also introduced into japonica rice Nipponbare and indica rice Honglianyou 6 by Agrobacterium-mediated immature embryo infection, and the pBWA(V)-Ubi-srlk1-gfp vector with good phenotype was obtained. SbRK1 Transgenic lines.

[0021] 3. After indoor and field resistance testing, SbRK1 The transgenic positive lines can improve the resistance of sorghum to head smut, rice to rice blast, rice false smut and bacterial blight to varying degrees. SbRK1 The strains with high gene expression also showed significantly enhanced disease resistance, indicating SbRK1 Genes play an important role in disease resistance in sorghum and rice.

[0022] Advantages and effects of the present invention:

[0023] 1. No disease resistance gene of sorghum has been cloned internationally, nor has the rice smut resistance gene been cloned. The molecular mechanism of sorghum resistance to smut and rice resistance to smut is still unclear. SbRK1The gene has obvious resistance to sorghum head smut, rice blast, rice false smut and bacterial leaf blight, which will greatly promote the research on the molecular mechanism of sorghum resistance to head smut and rice broad-spectrum disease resistance.

[0024] 2. SbRK1 Genes have greatly improved the resistance of sorghum and rice to smut, rice blast, rice false smut, and bacterial blight. SbRK1 When used in sorghum and rice breeding, it can improve the disease resistance of sorghum and rice varieties, thereby reducing diseases and achieving the goal of increasing and stabilizing yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Staining of sorghum growth cones indoors. Aniline blue staining was performed on the growth cones of sorghum seedlings to identify the infection of smut pathogens in the early germination period of sorghum. Figure 1 A. Figure 1 C is the aniline blue staining result of the growth cone of the non-transgenic wild-type WT sorghum (Tx430). There are blue pathogenic spots in the growth cone tissue, and the staining result is positive, indicating the presence of invading smut pathogens; Figure 1 B. Figure 1 D is the aniline blue staining result of the growth cone of the transgenic sorghum plant OST-71. There are almost no blue spots and the staining result is negative, indicating that there is no invasion of pathogens.

[0026] Figure 2 Statistics of sorghum growth cone staining rate indoors. The staining positive rate of transgenic lines was significantly lower than that of wild-type plants.

[0027] Figure 3 qPCR detection of growth cone staining in sorghum leaves SbRK1 Gene expression. The expression level of OST-71 in the leaves of the transgenic lines was significantly higher than that of the wild type WT. Different letters indicate significant differences in one-way ANOVA (P < 0.05), and the same letter indicates no significant difference.

[0028] Figure 4 In the field experiment, the leaves of wild-type sorghum WT and transgenic sorghum lines showed SbRK1 Gene expression detection, each transgenic line SbRK1 The gene expression levels were significantly higher than those of the wild type.

[0029] Figure 5 Identification of disease resistance in detached rice leaves. SbRK1 Genetically modified rice leaves were inoculated with the rice blast pathogen PMP131, and the disease condition of the leaves was observed 4 days later. Figure 5 a) is the wild-type WT rice Nipponbare, the lesions on the leaves are obviously larger and the disease susceptibility is higher; right ( Figure 5 b) is a transgenic strain with very small leaf spots and significantly enhanced resistance.

[0030] Figure 6 Field identification of rice resistance to rice blast. Figure 6 a is the wild type WT rice Nipponbare, which has severe disease and poor growth; Figure 6 Figure b shows the transgenic line A8-11, which has less disease and good growth. Figure 6 c, Phenotypic comparison between wild-type WT and transgenic rice A8-11 plants.

[0031] Figure 7 qPCR detection of rice leaves in the field SbRK1 There is almost no gene expression in wild-type rice WT SbRK1 Gene expression, A8-11 and other transgenic rice lines, SbRK1 Genes were improved to varying degrees.

[0032] Figure 8 Field identification of resistance of transgenic rice to bacterial blight. Figure 8 a: wild-type WT Nipponbare control, highly susceptible to bacterial blight; Figure 8 b: Transgenic rice line A8-11, moderately resistant to bacterial blight; Figure 8 c: The length of the leaf lesions of each strain.

[0033] Fig. 9 Field identification of transgenic rice resistance to false smut. Fig. 9 a is the incidence of rice false smut in each rice strain, Fig. 9 b is qPCR detection of rice leaves SbRK1 Gene expression level. Fig. 9 As can be seen in the figure, the control CK is the non-transgenic Honglianyou 6 rice, which is highly susceptible to rice false smut. SbRK1 Almost no expression; HLT0-1, HLT0-2, HLT0-3, HLT0-4, HLT0-6, HLT0-8, HLT0-9, HLT0-10, HLT0-11 are transgenic lines, among which the lines with stronger resistance have SbRK1 The expression level is also high. DETAILED DESCRIPTION

[0034] The following examples further illustrate the present invention, but are not to be construed as limitations of the present invention. Without departing from the spirit and substance of the invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0035] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0036] Example 1

[0037] The first strand of cDNA synthesized by reverse transcription of total RNA from leaves of sorghum immune variety SAP35 was used as template, and primers were designed based on similar sequences of the genome of common sorghum variety BTx623 using homologous cloning technology to amplify the obtained cDNA. SbRK1 The gene sequence has a complete open reading frame, the full length of the sequence is 2748 bp, and the sequence is as shown in SEQ ID NO.1. The encoded protein has 916 amino acids, and the sequence is as shown in SEQ ID NO.2.

[0038] Overexpression vector construction: Extract sorghum RNA and reverse transcribe cDNA; use cDNA as template and amplify using the following primers SbRK1 Gene, primer sequences are as follows:

[0039] Upstream primer: SbRK1 -F:GCGAATTCATGGCCGCGTCGGATCT;

[0040] Downstream primer: SbRK1 -R: CG CTCGAGTTAGTATTCCCACTTCTTGAGCT.

[0041] Will SbRK1 The amplified product was inserted into the downstream of the Ubi promoter and the upstream of GFP, and then inserted into the pBWA(V) expression vector that had been digested with the same double enzymes by DNA ligase to obtain the recombinant plasmid pBWA(V)HU-srlk1-gfp, which was then transferred into E. coli for competent amplification. The constructed overexpression vector was extracted from E. coli and introduced into the immature embryos of common sorghum by gene gun method; the overexpression vector was also transferred into Agrobacterium EHA105, and introduced into japonica rice Nipponbare and indica rice Honglianyou 6 by infection of immature embryos mediated by Agrobacterium EHA105, and the strains with good phenotypes were screened. SbRK1 Transgenic sorghum and rice lines.

[0042] Example 2

[0043] Identification of transgenic plants by staining growth cones of sorghum seedlings SbRK1Genetically modified sorghum plants are resistant to pathogen invasion at the seedling stage. To observe the resistance of transgenic sorghum to head smut during the early germination process, the transgenic sorghum T1 generation and the non-transgenic control wild-type WT sorghum (Tx430) were sown in plug trays, and the seeds were covered with at least 2 cm thick fungus soil. The fungus soil was mixed with nutrient soil at a 5% inoculum of head smut spore powder and fermented at 28°C for 3 days. The plug trays were placed at 26°C~28°C for about 40 days. The sorghum leaves were collected, quick-frozen in liquid nitrogen, and stored at -80°C for genomic DNA extraction and RNA extraction. The corresponding numbered sorghum growth cones were peeled out and added with aniline blue dye solution. They were stained in a boiling water bath for 15-20 minutes. After rinsing with running water, the staining of the growth cones was observed under a microscope, and the results were statistically analyzed. The results are shown in the figure. Figure 1 After aniline blue staining (to stain pathogens) was performed on the growth cones of sorghum seedlings 40 days after emergence, it was found that a certain number of blue spots could be observed in the growth cones of sorghum seedlings in the non-transgenic control group, indicating that pathogens had invaded. Figure 1 A. Figure 1 C: Growth cone of non-transgenic wild-type sorghum (Tx430) (aniline blue positive staining); Figure 1 B. Figure 1 D: Transgenic sorghum growth cone (aniline blue staining negative), with almost no blue lesions.

[0044] is the positive rate of aniline blue staining of growth cones of each strain ( Figure 2 ). Among the five transgenic lines investigated, the positive rates of aniline blue staining were all lower than those of the wild-type WT. Among them, the positive rate of transgenic ZOS-71 staining was only 11%, while the positive rate of wild-type WT staining was 86%, indicating that the susceptibility rate of transgenic lines was significantly lower than that of non-transgenic lines. Figure 2 Note: WT is the wild-type control; the rest are transgenic lines; different letters indicate that the lines have significant differences in one-way ANOVA (P < 0.05), and the same letter indicates no significant difference.

[0045] Example 3

[0046] In transgenic plants SbRK1 Gene expression detection. Sorghum and rice RNA were extracted using the Polysaccharide Polyphenol Plant RNA Extraction Kit (centrifugal column type) from Tiangen Biotechnology Company. The extraction steps were performed according to the instructions of the kit. cDNA synthesis was performed according to the instructions of the cDNA First Strand Synthesis Kit (TaKaRa). SbRK1Gene sequence and fluorescence real-time quantitative PCR primer design principles, Primer 6.0 software was used for primer design, and it was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The amplification reaction program adopted a three-step method: 95℃ for 5min, and PCR was performed for 45 cycles. Denaturation 95℃, annealing 58℃, extension 72℃. The instrument detects the PCR amplification product, and the temperature rises from 65℃ to 95℃ until all the PCR products are dissolved. The temperature rise amplitude is 0.5℃ / s. The instrument detects the fluorescence signal every 5s. Three replicates are set for each sample. After the PCR reaction, a melting curve analysis is performed. The real-time fluorescence quantitative PCR experimental reaction system is as follows: cDNA 1μL, 2×TSINGKE Master Mix 5μL, Primer F 1μL, Primer R 1μL, ddH2O2μL, total volume 10μL. Take the corresponding numbered and rice plant leaves and detect them by qPCR. SbRK1 The expression level of the gene.

[0047] Figure 3 The growth cones of the plants were stained with leaves and the qPCR was used to detect SbRK1 The expression level of the gene, the results showed that in the transgenic sorghum OST-71 (aniline blue staining negative), SbRK1 The expression level of the gene was significantly higher than that of the wild type WT (aniline blue staining positive), indicating that the low susceptibility rate of transgenic sorghum head smut was related to its SbRK1 This indicates that SbRK1 Overexpression of the gene can enhance the resistance of sorghum to the invasion of the original strain in the early stage. Note: Different letters indicate that there are significant differences among the strains in the one-way analysis of variance (P < 0.05), and the same letter indicates no significant difference. a and b represent significant differences between the two strains.

[0048] Example 4

[0049] In the field experiment, the leaves of different sorghum lines were analyzed at different time periods after emergence. SbRK1 Gene expression detection. T1 seeds of five transgenic positive sorghum lines OST-62, ZOS-1, OST-61, OST-71 and ZOS-2 and wild type WT (non-transgenic control) were selected for plug sowing. At the time of sowing, the plug was covered with at least 2 cm thick fungus soil (the fungus soil was mixed with nutrient soil according to the inoculation amount of 5% head smut spore powder and fermented at 28℃ for 3 days). The plug tray was placed at 26~28℃ for two weeks and transplanted to the field. 100 plants were planted for each line. Three rows were planted, with a row length of 4~5m and a row spacing of 0.7m. Sorghum leaves were collected at 20d, 30d, 40d, 50d, 60d, 70d, and 80d after sorghum sowing, wrapped with tin foil and marked, quickly frozen in liquid nitrogen, and stored at -80℃.

[0050] RNA was extracted from leaves collected at the above-mentioned times, and real-time quantitative PCR was performed after reverse transcription of cDNA to detect the different stages of growth and development of sorghum after inoculation with head smut pathogen. SbRK1 The expression level of the gene (see Example 3 for the detection method), the results are shown in Figure 4 .

[0051] Figure 4 In a field experiment, the leaves of different sorghum lines were tested at different time periods after emergence. SbRK1 Gene expression detection, WT is wild-type sorghum (Tx430), OST-61-61, ZOS-1-13, OST-62-19, OST-72-17, ZOS-2-35 are transgenic sorghum lines. The results showed that during the period of 20 to 40 days, the expression of SbRK1 The gene expression level increased significantly in a short period of time, reaching a peak at 40 days, and then gradually dropped to a lower level after 40 days. In the wild type WT, there was a small increase from 20 days to 40 days, but it was different from that in the transgenic line. SbRK1 The gene expression level is very low. This indicates that it is related to the infection activity of the head smut pathogen in sorghum, and SbRK1 The expression level of the gene may be induced by pathogens, and large-scale expression can enhance the plant's resistance to pathogens.

[0052] Example 5

[0053] Identification of transgenic rice detached leaves for resistance to rice blast. The transgenic rice seeds obtained were sown and cultivated in the laboratory until they had three leaves and one heart or four leaves and one heart. The leaves with wide and thick leaves were taken for rice detached leaf infection test. The rice leaves were washed with sterile water, cut into pieces of about 4 cm, placed in the culture medium, and the rice blast fungus blocks were covered on the pinholes of the leaves after acupuncture. About 4 to 5 leaves were placed in each culture medium. The culture medium was kept moist for 3-5 days at 28°C to observe the infection effect of rice blast. Evaluation methods and standards for the disease resistance level of each strain: the resistance type was determined according to the incidence rate of the leaves. Highly resistant (HR): morbidity rate 0.1%~15.0%; resistant (R): morbidity rate 15.1%~30.0%; moderately resistant (MR): morbidity rate 30.1%~45.0%; moderately susceptible (MS): morbidity rate 45.1%~60.0%; susceptible (S): morbidity rate 60.1%~75.0%; highly susceptible (HS): morbidity rate 75.1%~100.0%. Morbidity rate = (number of diseased leaves / total number of leaves surveyed) × 100%.

[0054] Figure 5The detached leaves of transgenic rice were infected with the rice blast pathogen PMP131. The disease condition of the leaves was observed after 4 days. The results showed that 100% of the detached leaves of wild-type WT Nipponbare rice were infected with rice blast, while only 20% to 40% of the detached leaves of the five transgenic rice lines were infected with the pathogen. The infection rate was significantly lower than that of the wild-type control group, indicating that the transformation SbRK1 The gene can significantly enhance the resistance of rice leaves to infection by rice blast fungus.

[0055] Example 6

[0056] change SbRK1 Field identification of genetic rice plants resistant to rice blast. Rice seeds were sown naturally in rice blast diseased beds and managed naturally. The rice seedling blast, leaf blast, and panicle blast were investigated and counted according to the national DB22-T 2389-2018 Technical Regulations for Identification and Evaluation of Rice Blast Resistance. The blast was registered and graded according to the group resistance grading standard for rice panicle blast incidence (Table 1). 100 plants were investigated for each line for statistics.

[0057] Table 2 Classification standard of rice panicle blast incidence and resistance

[0058]

[0059] The incidence of rice blast in the field was statistically analyzed according to DB42 / T 157-2003 Technical Specifications for Identification and Evaluation of Rice Blast Resistance. The results (Table 2) showed that the incidence of wild-type WT Nipponbare control and transgenic negative line A8-2 was 100%, and the incidence of transgenic positive lines A8-8, A8-9, A8-3, and A8-5 was 86.9%, 64.0%, 61.3%, and 66.4%, respectively, which were highly susceptible; A8-7 had an incidence of 48.5%, which was susceptible; A8-92 had an incidence of 28.4%, which was moderately susceptible; and A8-11 had an incidence of 9.1%, which was moderately resistant.

[0060] Table 2

[0061] Sample name WT A8-2 A8-91 A8-3 A8-5 A8-7 A8-8 A8-92 A8-11 Number of diseased ears 210 198 126 138 148 115 172 66 67 Total number of ears 210 198 197 225 223 233 198 232 737 Incidence 100% 100% 64.0% 61.3% 66.4% 48.5% 86.9% 28.4% 9.1%

[0062] Figure 6 In the field identification of rice blast resistance, the growth status of wild-type rice and transgenic rice line A8-11 (medium resistance) was significantly different ( Figure 6 a is the wild type, Figure 6 b is a transgenic rice line). The wild type plants are short, with sparse and incomplete branches and leaves, and almost no normal panicles; A8-11 has vigorous branches and leaves, and can develop and set panicles normally, with only a few panicles of a few plants showing symptoms of panicle neck blast. This shows that after the rice is transfected SbRK1The resistance to rice blast was improved to varying degrees after the gene was transferred, among which A8-11 was improved from highly susceptible to moderately resistant. SbRK1 The gene can significantly enhance rice's resistance to rice blast.

[0063] Figure 7 To further understand the relationship between transgenic rice resistance to rice blast and the SbRK1 The relationship between the gene expression and the disease severity of rice leaves was determined by real-time fluorescence quantitative PCR. Figure 7 In the study, WT is the wild type, and A8-2-2, A8-8-3, A8-9-1, and A8-11-12 are transgenic rice lines. The results showed that the panicle blast incidence of the wild type WT was 100%, and almost no SbRK1 Gene expression in transgenic rice strain A8-11-12 SbRK1 The relative expression of the gene was as high as 13,000, and the incidence rate was only 9.1% (moderate resistance). SbRK1 The relative expression levels of the genes were different. The strains with higher expression levels had lower incidence of ear blast, while the strains with lower expression levels had higher incidence of ear blast. SbRK1 related to gene expression.

[0064] Example 7

[0065] change SbRK1 Identification of resistance to bacterial blight in rice in the field. The PXO99A strain was inoculated on a potato composite medium slant and cultured at 28 °C for 48 h. The cells were collected with sterile water and prepared into 3×10 8 CFU / L bacterial suspension for subsequent test inoculation. In the peak period of rice tillering, the leaves were cut and inoculated at 4 pm. 10 stumps and 40 leaves were inoculated for each strain. The prepared bacterial suspension was completed within 2 hours. The lesion length and leaf length were investigated 21 days after inoculation. The length of 20 inoculated leaves and lesions were measured for each treatment. The ratio of the average lesion length to the average full leaf length was calculated, and the resistance was evaluated according to the resistance evaluation standard of rice bacterial leaf blight cut inoculation. The disease level division and recording standards were implemented according to the identification methods and standards of DB42 / T 157-2003 Rice Bacterial Leaf Blight and Rice Blast Resistance Identification Operation Procedure. Resistance index = lesion length / leaf length × 100. The comprehensive resistance evaluation grading standard is shown in Table 3.

[0066] Table 3 Comprehensive evaluation and grading standards for bacterial blight resistance

[0067]

[0068] Figure 8 For transfer SbRK1Field resistance identification of genetically modified rice bacterial leaf blight. According to DB42 / T 157-2003 rice bacterial leaf blight and blast resistance identification operation procedures, the incidence of rice bacterial leaf blight in the field was counted.

[0069] Results Figure 8 , Figure 8 a: wild type rice WT Nipponbare; Figure 8 b: Transgenic rice line A8-11; Figure 8 c: The length of the leaf lesions of each strain. In the field test, the susceptibility rate of the wild-type WT control was about 93%, which was highly susceptible; the susceptibility rate of the transgenic strain A8-11 was about 9.8%, which was moderately resistant to bacterial blight. SbRK1 Overexpression of the gene can enhance rice's resistance to bacterial leaf blight. The higher the relative expression level, the stronger the resistance to bacterial leaf blight.

[0070] Example 8

[0071] change SbRK1 Identification of resistance to rice false smut in the field. SbRK1 Twelve strains of genetically modified rice (indica rice Honglianyou 6 T0 generation) were planted in a rice false smut disease nursery (2021). After the disease naturally occurred during continuous rainy days during the heading period, the number of rice false smut fungi in each strain was investigated. The results are shown in ( Fig. 9 , Table 4).

[0072] from Fig. 9 a It can be seen that among the 12 transgenic positive lines, HLT0-2 did not develop the disease, HLT0-1 and HLT0-3 developed mild disease, with many ears and full fruits; HLT0-4, HLT0-5 and HLT0-6 developed severe disease, with many ears and fewer fruits; HLT0-7, HLT0-8 and HLT0-9 developed severe disease, with many ears but few fruits; HLT0-10, HLT0-11 and HLT0-12 had short growth, few ears, and almost no fruits ( Fig. 9 -a), the non-transgenic control CK plants were severely diseased.

[0073] Leaves from each plant line were taken for qPCR detection (results see Fig. 9 b) Plants with low disease severity HLT0-1, 2, and 3 SbRK1 The expression level of the gene was high, and the plants with high disease severity, HLT0-4, 6, HLT0-8, and 9, SbRK1 The expression of genes was low or even absent. The expression of HLT0-10 and 11 was high, and the plants did not grow rice balls, but the rice grew short, the panicles were shriveled and could not bear fruit, and the control plants had no expression of disease-prone genes. The above results preliminarily indicate that SbRK1 The expression of the gene may improve rice resistance to rice false smut.

[0074] Table 4 Red Lotus 6th Turn SbRK1 Statistics on rice smut disease of each genetic rice line

[0075] SEQUENCE LISTING <110> China Three Gorges University <120> A Sorghum Disease-Resistant Gene and Its Application <130> 202203 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 2748 <212> DNA <213> Sorghum bicolor <400> 1 atgctcatgc cttgggccac aataatgttg ctactttcct gtggagctgg gaccatcaac 60 tgcatgaccc tcaacgggaa tgacacagat ttcatctccc tccttgactt caagcacgca 120 atcatgaatg acccaaaagg agcgttgagc tcatggaaca ccaccatcca cttctgcagc 180 tgggagggag tggtgtgtag ccagacacgt ccagagcgcg tactgatcct gaacctgtcc 240 aggcaggctt tggatggtca catttctcct tccctaggga acatctcaca tctcatttct 300 cttgacctct ccatgaacat gttctctggc cacatacctc ctcgtcttgg ctatctgcac 360 aagctcaagt ttcttgacct gagtaacaac tcgttacagg gaaatattcc agatgcactc 420 gcaaattgtt ccagcttgct ggggttattc cttcagcgaa acttgctggt tggagagatt 480 cccaagaaac tagccctcct gtccaaccta ttatatttgt ggcttaactc taacaacttt 540 tcaggggcca ttccacctga cctaggtaac atcacaacct tacagcatgt cattcttttt 600 tctaaccagc tccatggaag cattcccaag gagcttggca agttatccta tatgacagat 660 ttgttgcttg gtagcaatcg tctgtcaggt agaatcccag aagcactcct caatctctct 720 tcactaaac agttggccat gccagtgaat atgctacatg gtccattgcc atataaaatc 780 gggaagtttc tccctaacct ccgaatcctt tacttgggtg acaacatgtt gggaggtcac 840 atcccggatt ccctaggcaa cgcatcagag cttcagttaa tagatttggg atttaacaat 900 ggctttacag gaaaaatccc tccttccctt ggtaaacttt ggaagcttag aaagctaagt 960 ctccatgata acaatcttaa agcaaatgat agccaaagct gggaatttct cgatgcattg 1020 accaactgca ctcttctaga gcggctttta ctcactggaa atcagctaca gggagtactg 1080 ccaaattcag ttggtaacct ttcctctaat cttaacgacc tcacgctttc aatcaatatg 1140 ctatatggat tagtcccgac aagcatagga aaccttcata aactaactac gttaaaacta 1200 tcgctcaaca gttttacagg tccgattaat ggatggattg gaaatttggt caatttacaa 1260 gctttatacc ttcaccataa caacttcagt ggtcatattc ccgattccat tggtaatgtt 1320 tcaaagttgt tagatctgac tctagaagct aacaatttcc atggtcccat accatcaagt 1380 ttagggaaac ttcaactact ctcaatttta gacctcagtt ataacaatct cgaaggaaat 1440 ataccaaaag atctcattgc aatctctgtt gttcaatgta cattatccca caacaatctt 1500 gaaggccgaa taccttatgt tggtaaccat ctacagctca gctatctgga tctttcatcc 1560 aacaagctta caggggaaat tccacctact ctgggcactt gccagcaatt acaaactgtc 1620 atattggact caaactttct ctccggaagt atccccgcat tgttcggcca acttggcagt 1680 ttgactgtgc tcaacctttc tcgcaacaat ttctcaggct ctatcccaat ttctctaagc 1740 aagctgcagc ttcttacaca attagatctg tcacacaatc accttgacgg tgaagtgcca 1800 acagaagggg tattcacaaa cacaacagcc atttcacttg atgacaattg gcagctttgt 1860 ggaggtgtac tagaactgca tatgcctcca tgccctaacc ctatgcagaa aagaattgta 1920 tggcgacact atttgtaat atagcgatc cccgtaatag gcattgtgtc ccttacattg 1980 gtgatatatt ttcatctc aagaaggaag gtgccaagaa cacggttgtc gctgtctttt 2040 tctggtgagc aatttcctaa agttcctac aaggatcttg ctcaagccac ggataacttc 2100 acagaatcta gcttggttgg gagaggaagc catggctcag tgtacaaagg gaggctaata 2160 actccggaac ccatggttgt ggctgtgaag gttttcgacc ttgccatgga agggacaaat 2220 gggagtttca tatcagaatg ccaagctctg agaaatatcc ggcaccgcaa ccttgttcca 2280 attctaactg catgctcaac gattgataac atgggaaatg atttcaaagc tctagtctac 2340 aggtttatgc ccaatggaag cttggatact tggttgcact cacctggcta tggcaacctg 2400 gatctgtcac aaagattgaa aataattgtt gatatagctg atgcactgcg gtatatacat 2460 catgattgtg agactcccat tattcactgc gacttgaagc ccagcaatat tcttcttgac 2520 gacaatatgg gtgctcattt ggcagacttc ggcatcgcaa ggttctacct cgaaaccata 2580 tcacagacag ttggagattc cagatcaact ggcacgataa atctgaaggg aacaattggg 2640 tacatttctc cagaatatgc tggaggcagt ttcctgtcga cttgtggaga tgtgtacagc 2700 ttcggtgtag tcctgatgga gatgttgacg gggaaaaggc caactgat 2748 <210> 2 <211> 916 <212> PRT <213> Sorghum bicolor <400> 2 Met Leu Met Pro Trp Ala Thr Ile Met Leu Leu Leu Ser Cys Gly Ala 1 5 10 15 Gly Thr Ile Asn Cys Met Thr Leu Asn Gly Asn Asp Thr Asp Phe Ile 20 25 30 Ser Leu Leu Asp Phe Lys His Ala Ile Met Asn Asp Pro Lys Gly Ala 35 40 45 Leu Ser Ser Trp Asn Thr Thr Ile His Phe Cys Ser Trp Glu Gly Val 50 55 60 Val Cys Ser Gln Thr Arg Pro Glu Arg Val Leu Ile Leu Asn Leu Ser 65 70 75 80 Arg Gln Ala Leu Asp Gly His Ile Ser Pro Ser Leu Gly Asn Ile Ser 85 90 95 His Leu Ile Ser Leu Asp Leu Ser Met Asn Met Phe Ser Gly His Ile 100 105 110 Pro Pro Arg Leu Gly Tyr Leu His Lys Leu Lys Phe Leu Asp Leu Ser 115 120 125 Asn Asn Ser Leu Gln Gly Asn Ile Pro Asp Ala Leu Ala Asn Cys Ser 130 135 140 Ser Leu Leu Gly Leu Phe Leu Gln Arg Asn Leu Leu Val Gly Glu Ile 145 150 155 160 Pro Lys Lys Leu Ala Leu Leu Ser Asn Leu Leu Tyr Leu Trp Leu Asn 165 170 175 Ser Asn Asn Phe Ser Gly Ala Ile Pro Pro Asp Leu Gly Asn Ile Thr 180 185 190 Thr Leu Gln His Val Ile Leu Phe Ser Asn Gln Leu His Gly Ser Ile 195 200 205 Pro Lys Glu Leu Gly Lys Leu Ser Tyr Met Thr Asp Leu Leu Leu Gly 210 215 220 Ser Asn Arg Leu Ser Gly Arg Ile Pro Glu Ala Leu Leu Asn Leu Ser 225 230 235 240 Ser Leu Lys Gln Leu Ala Met Pro Val Asn Met Leu His Gly Pro Leu 245 250 255 Pro Tyr Lys Ile Gly Lys Phe Leu Pro Asn Leu Arg Ile Leu Tyr Leu 260 265 270 Gly Asp Asn Met Leu Gly Gly His Ile Pro Asp Ser Leu Gly Asn Ala 275 280 285 Ser Glu Leu Gln Leu Ile Asp Leu Gly Phe Asn Asn Gly Phe Thr Gly 290 295 300 Lys Ile Pro Pro Ser Leu Gly Lys Leu Trp Lys Leu Arg Lys Leu Ser 305 310 315 320 Leu His Asp Asn Asn Leu Lys Ala Asn Asp Ser Gln Ser Trp Glu Phe 325 330 335 Leu Asp Ala Leu Thr Asn Cys Thr Leu Leu Glu Arg Leu Leu Leu Thr 340 345 350 Gly Asn Gln Leu Gln Gly Val Leu Pro Asn Ser Val Gly Asn Leu Ser 355 360 365 Ser Asn Leu Asn Asp Leu Thr Leu Ser Ile Asn Met Leu Tyr Gly Leu 370 375 380 Val Pro Thr Ser Ile Gly Asn Leu His Lys Leu Thr Thr Leu Lys Leu 385 390 395 400 Ser Leu Asn Ser Phe Thr Gly Pro Ile Asn Gly Trp Ile Gly Asn Leu 405 410 415 Val Asn Leu Gln Ala Leu Tyr Leu His His Asn Asn Phe Ser Gly His 420 425 430 Ile Pro Asp Ser Ile Gly Asn Val Ser Lys Leu Leu Asp Leu Thr Leu 435 440 445 Glu Ala Asn Asn Phe His Gly Pro Ile Pro Ser Ser Leu Gly Lys Leu 450 455 460 Gln Leu Leu Ser Ile Leu Asp Leu Ser Tyr Asn Asn Leu Glu Gly Asn 465 470 475 480 Ile Pro Lys Asp Leu Ile Ala Ile Ser Val Val Gln Cys Thr Leu Ser 485 490 495 His Asn Asn Leu Glu Gly Arg Ile Pro Tyr Val Gly Asn His Leu Gln 500 505 510 Leu Ser Tyr Leu Asp Leu Ser Ser Asn Lys Leu Thr Gly Glu Ile Pro 515 520 525 Pro Thr Leu Gly Thr Cys Gln Gln Leu Gln Thr Val Ile Leu Asp Ser 530 535 540 Asn Phe Leu Ser Gly Ser Ile Pro Ala Leu Phe Gly Gln Leu Gly Ser 545 550 555 560 Leu Thr Val Leu Asn Leu Ser Arg Asn Asn Phe Ser Gly Ser Ile Pro 565 570 575 Ile Ser Leu Ser Lys Leu Gln Leu Leu Thr Gln Leu Asp Leu Ser His 580 585 590 Asn His Leu Asp Gly Glu Val Pro Thr Glu Gly Val Phe Thr Asn Thr 595 600 605 Thr Ala Ile Ser Leu Asp Asp Asn Trp Gln Leu Cys Gly Gly Val Leu 610 615 620 Glu Leu His Met Pro Pro Cys Pro Asn Pro Met Gln Lys Arg Ile Val 625 630 635 640 Trp Arg His Tyr Phe Val Ile Ile Ala Ile Pro Val Ile Gly Ile Val 645 650 655 Ser Leu Thr Leu Val Ile Tyr Phe Ile Ile Ser Arg Arg Lys Val Pro 660 665 670 Arg Thr Arg Leu Ser Leu Ser Phe Ser Gly Glu Gln Phe Pro Lys Val 675 680 685 Ser Tyr Lys Asp Leu Ala Gln Ala Thr Asp Asn Phe Thr Glu Ser Ser 690 695 700 Leu Val Gly Arg Gly Ser His Gly Ser Val Tyr Lys Gly Arg Leu Ile 705 710 715 720 Thr Pro Glu Pro Met Val Val Ala Val Lys Val Phe Asp Leu Ala Met 725 730 735 Glu Gly Thr Asn Gly Ser Phe Ile Ser Glu Cys Gln Ala Leu Arg Asn 740 745 750 Ile Arg His Arg Asn Leu Val Pro Ile Leu Thr Ala Cys Ser Thr Ile 755 760 765 Asp Asn Met Gly Asn Asp Phe Lys Ala Leu Val Tyr Arg Phe Met Pro 770 775 780 Asn Gly Ser Leu Asp Thr Trp Leu His Ser Pro Gly Tyr Gly Asn Leu 785 790 795 800 Asp Leu Ser Gln Arg Leu Lys Ile Ile Val Asp Ile Ala Asp Ala Leu 805 810 815 Arg Tyr Ile His His Asp Cys Glu Thr Pro Ile Ile His Cys Asp Leu 820 825 830 Lys Pro Ser Asn Ile Leu Leu Asp Asp Asn Met Gly Ala His Leu Ala 835 840 845 Asp Phe Gly Ile Ala Arg Phe Tyr Leu Glu Thr Ile Ser Gln Thr Val 850 855 860 Gly Asp Ser Arg Ser Thr Gly Thr Ile Asn Leu Lys Gly Thr Ile Gly 865 870 875 880 Tyr Ile Ser Pro Glu Tyr Ala Gly Gly Ser Phe Leu Ser Thr Cys Gly 885 890 895 Asp Val Tyr Ser Phe Gly Val Val Leu Met Glu Met Leu Thr Gly Lys 900 905 910 Arg Pro Thr Asp 915

Claims

1. A broad-spectrum disease resistance gene in sorghum SbRK1 , characterized in that: The nucleotide sequence is as shown in SEQ ID NO.1, or a nucleotide sequence in which one or more nucleotides are replaced and encodes the same amino acid sequence.

2. A coding protein, characterized in that: Sorghum broad-spectrum disease resistance gene SbRK1 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A method comprising the method according to claim 1 SbRK1 pBWA(V)-Ubi-SbRLK1-GFP overexpression vector of the gene.

4. A host containing the pBWA(V)-Ubi-SbRLK1-GFP overexpression vector according to claim 3, wherein the host is a non-plant cell.

5. Use of the gene according to claim 1 or the encoded protein according to claim 2 or the overexpression vector according to claim 3 in improving sorghum resistance to smut, rice resistance to rice blast, rice false smut and rice resistance to bacterial blight.

Images