A plasma exosome circRNA marker for diagnosis and prognosis monitoring of gastric cancer and its application

Abstract

The present invention provides a plasma exosome circRNA marker for the diagnosis and prognosis monitoring of gastric cancer and its application, belonging to the field of molecular diagnosis technology. The present invention first discovered hsa_circ_0006853 in gastric cancer plasma exosomes and determined its diagnostic value for gastric cancer. The present invention also provides a plasma exosome circRNA extraction kit, which can conveniently and accurately extract and detect exosome circRNA from plasma, which is conducive to the analysis and application of circRNA in plasma exosomes in the laboratory and clinic. Through experimental verification, the marker described in the present invention can effectively diagnose and monitor the prognosis of gastric cancer, and can identify patients with atrophic gastritis to a certain extent, providing an important basis for clinical early diagnosis and treatment targets.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and specifically relates to a plasma exosome circRNA marker for diagnosis and prognosis monitoring of gastric cancer and an application thereof. Background Art

[0002] Gastric cancer (GC) is the most common malignant tumor in the world. The occurrence and development of gastric cancer is a multi-factor, multi-cellular, and multi-step process. Due to the lack of specific symptoms in the early stage of gastric cancer, the vast majority of diagnosed cases are in the late stage with poor prognosis, extensive metastasis, and high recurrence. In addition, existing treatments such as chemotherapy and radiotherapy not only have strong side effects but are also prone to drug resistance. Therefore, further exploration of non-invasive molecular markers that are helpful for the early diagnosis and prognosis of gastric cancer is an important issue that needs to be solved urgently.

[0003] Circular RNA (circRNA) is a type of closed circular non-coding RNA molecule produced by reverse splicing of pre-mRNA. With the latest advances in RNA deep sequencing technology and bioinformatics, a large number of circRNAs have been found to be abundantly expressed in mammalian cells. In eukaryotic organisms, circRNAs have the characteristics of conservation, high stability, and specific expression in tissues and developmental stages. Current studies have shown that circRNAs can act as miRNA sponges, bind to proteins, translate proteins, regulate parental gene transcription, and can be transported to body fluids, and have great potential as biomarkers.

[0004] Exosomes are a type of extracellular vesicles with a diameter of 30 to 100 nm, secreted by a variety of cells, and present in almost all body fluids. They carry proteins, lipids, nucleic acid metabolites, etc. to perform intercellular communication functions, and participate in a variety of physiological and pathological processes such as immune response, viral infection, metabolism and cardiovascular disease, neurodegenerative diseases, and cancer progression. Studies have confirmed that CircRNAs are rich in exosomes, circulate through exosomes and reach receptor cells, thereby realizing their various biological functions. As a biomarker with good stability, circRNA can be enriched in exosomes in large quantities. Therefore, studying exosome circRNA markers in circulating body fluids is of great significance for the diagnosis of diseases.

[0005] At present, the existing gastric cancer diagnostic markers in clinical practice, such as CEA, CA199, and CA724, lack specificity, and there are few tumor markers that can truly serve as auxiliary diagnosis in clinical practice. Therefore, there is an urgent need to develop a method for rapid and accurate detection of exosomal circRNA in plasma. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a plasma exosome circRNA marker for the diagnosis and prognosis monitoring of gastric cancer and its application, wherein the plasma exosome circRNA marker can effectively diagnose and monitor the prognosis of gastric cancer, and can identify patients with atrophic gastritis to a certain extent, providing an important basis for early clinical diagnosis and treatment targets.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a plasma exosome circRNA extraction kit, comprising a reagent for extracting plasma exosomes and a reagent for extracting exosome circRNA;

[0009] The reagents for extracting plasma exosomes include ExoQiuck Plasma prep and Exosomeprecipitationkit;

[0010] The reagents for extracting exosome circRNA include separately packaged: miRNeasy Serum / plasmakit, chloroform and anhydrous ethanol.

[0011] The present invention provides a plasma exosome circRNA marker for the diagnosis and prognosis monitoring of gastric cancer obtained by extracting using the above-mentioned extraction kit, wherein the plasma exosome circRNA marker includes hsa_circ_0006853, and the nucleic acid sequence of hsa_circ_0006853 is shown in SEQ ID NO.1.

[0012] The present invention also provides a use of a reagent for detecting the above-mentioned plasma exosome circRNA marker in the preparation of a gastric cancer diagnostic tool.

[0013] Preferably, the reagent includes a specific primer pair designed for hsa_circ_0006853.

[0014] Preferably, the specific primer pair includes an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

[0015] The present invention also provides a gastric cancer diagnosis kit, comprising an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

[0016] Preferably, other reagents for constructing a qRT-PCR system are also included.

[0017] Preferably, a primer pair of the internal reference gene β-Actin is also included.

[0018] Preferably, the primer pair for the internal reference gene β-Actin, the upstream primer is shown as SEQ ID NO.4, and the downstream primer is shown as SEQ ID NO.5.

[0019] Preferably, a reverse transcription reagent is also included.

[0020] Beneficial effects: The present invention provides a plasma exosome circRNA marker for the diagnosis and prognosis monitoring of gastric cancer, and a plasma exosome circRNA extraction kit, which can conveniently and accurately extract and detect exosome circRNA from plasma, and is conducive to the analysis and application of laboratory and clinical plasma exosome circRNA. The present invention also provides a kit for hsa_circ_0006853, which can quickly detect a variety of circRNAs including hsa_circ_0006853, providing a valuable marker detection method for the early diagnosis and prognosis of gastric cancer, and also providing help for the analysis of more plasma exosome circRNA for application in tumor markers. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the particle size and purity of plasma exosomes separated by NTA (A), electron microscopy (B), and Western Blot identification (C) provided in an embodiment of the present invention;

[0022] Figure 2 Amplification curve and melting curve diagram of real-time fluorescence quantitative PCR of hsa_circ_0006853 and Actin molecules provided in an embodiment of the present invention;

[0023] Figure 3 Schematic diagram of agarose electrophoresis and sequencing identification of the product after real-time fluorescence quantitative PCR amplification of hsa_circ_0006853 provided in an embodiment of the present invention;

[0024] Figure 4 Schematic diagram of RNaseR experiment and gDNA experiment for circularization identification of hsa_circ_0006853 provided in an embodiment of the present invention;

[0025] Figure 5 A schematic diagram of the real-time fluorescence quantitative PCR comparison of the differential expression of plasma exosome hsa_circ_0006853 in gastric cancer patients, atrophic gastritis patients, and healthy controls before and after surgery provided in an embodiment of the present invention;

[0026] Figure 6 Schematic diagram of the ROC curve analysis of the specificity and sensitivity of plasma exosomes hsa_circ_0006853 for gastric cancer diagnosis provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0027] The present invention provides a plasma exosome circRNA extraction kit, comprising a reagent for extracting plasma exosomes and a reagent for extracting exosome circRNA;

[0028] The reagents for extracting plasma exosomes include ExoQiuck Plasma prep and Exosomeprecipitation kit;

[0029] The reagents for extracting exosome circRNA include separately packaged: miRNeasy Serum / plasma kit, chloroform and anhydrous ethanol.

[0030] The present invention does not specifically limit the sources of the reagents for extracting plasma exosomes and the reagents for extracting exosome circRNA, and conventional commercially available reagents in the art can be used. For example, in the embodiment of the present invention, ExoQiuck Plasmaprep and Exosome precipitation kit is used as a reagent for extracting plasma exosomes, purchased from SBI, item number EXOQ5TM-1; miRNeasy Serum / plasma kit, chloroform and anhydrous ethanol are used as reagents for extracting exosome circRNA, and miRNeasy Serum / plasma kit is purchased from QIAGEN, item number 217184.

[0031] Using the extraction kit of the present invention, various circRNAs including hsa_circ_0006853 can be extracted from plasma exosomes.

[0032] The present invention also provides a method for extracting plasma exosome circRNA using the above extraction kit, which specifically includes: separation and extraction of plasma exosomes and extraction of exosome circRNA.

[0033] The separation and extraction of plasma exosomes of the present invention preferably includes: mixing plasma with Thrombin and letting it stand at room temperature, centrifuging and discarding the precipitate, mixing the supernatant with ExoQiuck Plasma prep and Exosome precipitation kit and letting it stand, centrifuging and discarding the supernatant, and the precipitate is plasma exosomes.

[0034] The present invention resuspends the plasma exosomes in sterile 1x PBS and then extracts exosome circRNA, preferably including: mixing and lysing the above-mentioned exosomes with QIAzol lysis buffer (provided in the miRNeasy Serum / plasma kit), and then mixing and oscillating with an equal volume of chloroform of the exosomes; after centrifugation, the collected upper aqueous phase is mixed with anhydrous ethanol, and the mixed solution is centrifuged in a spin colum, the filtrate is discarded, the collection tube is recovered, and the previous step is repeated, and the remaining mixed solution is centrifuged through the column; the filtrate is discarded, the collection tube is recovered, RWT buffer is added, and centrifuged; the filtrate is discarded, the collection tube is recovered, RPE buffer is added, and centrifuged; the filtrate is discarded, the collection tube is recovered, 80% ethanol is added, and centrifuged; the filtrate and the collection tube are discarded, the spin colum is placed in a new 2ml collection tube, and the membrane is dried by full speed centrifugation for 5min at room temperature; the collection tube is discarded, the spin colum is placed in a new 1.5ml collection tube, and RNase-free water, carefully cover the lid, and let it stand at room temperature; centrifuge for 1 minute, add the eluted RNA solution to the middle of the membrane again, let it stand at room temperature for 3-5 minutes, and then centrifuge again for 1 minute to elute the exosome total RNA. The present invention places the obtained exosome total RNA on ice for immediate use.

[0035] The present invention also provides a plasma exosome circRNA marker for the diagnosis and prognosis of gastric cancer extracted by the above-mentioned extraction kit, wherein the plasma exosome circRNA marker includes hsa_circ_0006853, and the nucleic acid sequence of hsa_circ_0006853 is shown in SEQ ID NO.1: gggcccggcg gatgcctcctttgccggagc ttggaacaga ctcacggcca gcgaagtgagttcaatggct gaggtgag.

[0036] The present invention also provides a use of a reagent for detecting the above-mentioned plasma exosome circRNA marker in the preparation of a gastric cancer diagnostic tool.

[0037] The reagent of the present invention preferably includes a specific primer pair designed for hsa_circ_0006853, wherein the specific primer pair includes an upstream primer shown in SEQ ID NO.2: caatggctga ggtgaggggc c and a downstream primer shown in SEQ ID NO.3: ctgttccaag ctccggcaaa gg.

[0038] The present invention also provides a gastric cancer diagnosis kit, comprising an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

[0039] The kit of the present invention preferably also includes other reagents for constructing a qRT-PCR system, such as AceQ qPCRSYBR GREEN MasterMix, purchased from Vazyme, catalog number Q111-02.

[0040] The kit of the present invention preferably also includes a primer pair for the internal reference gene β-Actin, wherein the upstream primer of the primer pair for the internal reference gene β-Actin is preferably as shown in SEQ ID NO.4: cacgaaacta ccttcaactc c, and the downstream primer is preferably as shown in SEQ ID NO.5: catactcctg cttgctgatc.

[0041] The kit of the present invention preferably also includes a reverse transcription reagent, such as the HiScriptIII strand cDNA Synthesis kit used in the examples of the present invention, purchased from Vazyme, catalog number R312-01 / 02.

[0042] The following is a detailed description of a plasma exosome circRNA marker for the diagnosis and prognosis monitoring of gastric cancer provided by the present invention and its application in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1

[0044] Extraction of plasma exosome circRNA

[0045] (1) Collection and preparation of plasma

[0046] 1) Collect 8 ml of cubital venous blood using an EDTA anticoagulant blood collection tube. Immediately after blood collection, gently invert and mix 5 times to fully mix;

[0047] 2) After standing at room temperature for 30 minutes, centrifuge at 3000 rpm / min for 10 minutes to initially separate the upper plasma;

[0048] 3) Use a pipette to transfer the plasma to an RNase-free imported EP tube and centrifuge again at 3000 g / min for 15 min to remove residual cell debris;

[0049] 4) Use a pipette to transfer the upper plasma layer after centrifugation and dispense it into new RNase free imported EP tubes (260 μl / tube); store at -80°C for later use or at 4°C for immediate use.

[0050] (2) Isolation and extraction of plasma exosomes

[0051] 1) Take out the plasma from -80℃ and thaw it at 4℃. Use a pipette to transfer 250μl of the plasma into a new RNase-free imported EP tube. Then add 2μl of Thrombin and mix by gently pipetting. Let stand at room temperature for 5 minutes.

[0052] 3) Centrifuge at room temperature at 10000 rpm / min for 5 min;

[0053] 4) To avoid losing too much plasma, use a pipette to pick up the flocculent fibrin precipitate by rotating, and then add 63 μl of ExoQiuck Plasma prep and Exosome precipitation kit;

[0054] 5) Stand at 4°C for 30 min, then centrifuge at 1500 g for 30 min at 4°C;

[0055] 6) Discard the supernatant and centrifuge again at 1500g for 5 min at 4°C to remove residual liquid;

[0056] 7) Resuspend the exosome pellet at the bottom of the tube with 200 μl sterile 1x PBS and place at 4°C for 10 min to dissolve the exosomes for further use. Figure 1 shown.

[0057] (3) Extraction of exosomal circRNA

[0058] 1) Add the above exosomes to 1 ml of QIAzol lysis buffer, shake for 30 seconds to fully lyse the exosomes, then let stand at room temperature for 5 minutes, add chloroform with an equal volume of exosomes, vortex vigorously for 15 seconds, and let stand at room temperature for 2-3 minutes;

[0059] 2) Centrifuge at 4°C, 12,000 g for 15 min, pipette 750 μl of the upper aqueous phase into a new EP tube (note: do not pipette the white middle layer), then add 1.5 times the volume of pre-cooled anhydrous ethanol and mix by pipetting up and down;

[0060] 3) Pipette 700 μl of the mixed solution from the previous step into a spin column (placed in a 2 ml collection tube), and centrifuge at room temperature, 12000 g, for 15 seconds;

[0061] 4) Discard the filtrate, recycle the collection tube, repeat the previous step, and centrifuge the remaining mixed solution through the column;

[0062] 5) Discard the filtrate, recover the collection tube, add 700 μl RWT buffer, centrifuge at room temperature, 12000g, 15s;

[0063] 6) Discard the filtrate, recover the collection tube, add 500 μl RPE buffer, and centrifuge at room temperature, 12000 g, for 15 s;

[0064] 7) Discard the filtrate, recover the collection tube, add 500 μl of 80% ethanol, centrifuge at room temperature, 12000 g, 2 min;

[0065] 8) Discard the filtrate and collection tube, place the spin column in a new 2 ml collection tube (provided by the kit), and centrifuge at full speed for 5 min at room temperature to dry the membrane;

[0066] 9) Discard the collection tube, place the spin column in a new 1.5 ml collection tube (provided by the kit), add 14 μl RNase-free water to the middle of the membrane, carefully cover the lid, and let it stand at room temperature for 3-5 minutes;

[0067] 10) Centrifuge at full speed for 1 min at room temperature, add the eluted RNA solution to the middle of the membrane again, let it stand at room temperature for 3-5 min, and then centrifuge at full speed for 1 min again to elute the exosome total RNA;

[0068] 11) The obtained RNA solution was placed on ice for immediate use.

[0069] Example 2

[0070] Detection and determination of plasma exosomes hsa_circ_0006853

[0071] (1) Preparation of cDNA

[0072] 20μl reverse transcription system: 10X RT Mix 2μl, Random hexamers (50ng / nl) 1μl, HiScript Enzyme Mix 2μl, Total RNA ≤ 1ug and the remainder RNase free ddH20.

[0073] Reverse transcription program: 37°C for 15 min, 85°C for 5 s, and storage at 4°C.

[0074] The reaction product can be placed at 4°C for immediate use in qPCR reactions, or placed at -20°C for use within six months, or stored at -80°C to avoid repeated freezing and thawing.

[0075] cDNA can be appropriately diluted with RNase free ddH2O according to the expression level of the gene in the sample or directly used in the qPCR reaction system.

[0076] (2) Real-time fluorescence quantitative PCR

[0077] 20μl qPCR reaction system: 2XAceQ qPCR SYBR Green MasterMix 10μl, Forward Primer (10μM) 0.4μl, Reverse Primer (10μM) 0.4μl, cDNA 2μl and the remainder RNase free ddH2O.

[0078] Real-time fluorescence quantitative PCR reaction was carried out in a Thermofisher QuantStudio 3QS3 fluorescence quantitative PCR instrument: pre-denaturation at 95°C for 5 min; cycle reaction at 95°C for 15 s, 60°C for 30 s (fluorescence collection), 40 cycles; melting curve: 95°C for 15 s, 60°C for 30 s, 95°C for 15 s (fluorescence collection).

[0079] Primer specificity verification: The amplification curve and melting curve diagram of the real-time fluorescence quantitative PCR detection of hsa_circ_0006853 and β-actin provided in the embodiment of the present invention are as follows: Figure 2 As shown, A is the amplification curve and B is the melting curve.

[0080] Identification of PCR products after hsa_circ_0006853 amplification: Agarose gel electrophoresis was used to analyze the uniqueness of the products. Figure 4 As shown in A; TA cloning plasmid was sequenced and verified, as shown in Figure 3 As shown in B.

[0081] Circularization identification: The RNaseR digestion experiment and gDNA experiment provided in the embodiment of the present invention were used to identify the circularization of hsa_circ_0006853 to verify that the amplification product of the provided hsa_circ_0006853 primers is indeed a circular RNA. Figure 4 As shown in A and B.

[0082] Example 3

[0083] The value of plasma exosome hsa_circ_0006853 as a diagnostic marker for gastric cancer

[0084] (1) The present invention includes 59 gastric cancer patients who visited the Department of Gastrointestinal Surgery of Zhenjiang First People's Hospital, Jiangsu University Affiliated Hospital (Zhenjiang Jiangbin Hospital) and Jiangsu University Affiliated Aoyang Hospital from July 2021 to January 2022, and collects their basic data such as age, gender, tumor size, location, degree of differentiation, lymph node metastasis, distal metastasis, nerve involvement, TNM stage, histological typing, CEA, CA199, CA242, etc., collects preoperative and postoperative cubital vein and detects plasma exosome hsa_circ_0006853 levels. At the same time, 65 healthy physical examination subjects and 44 atrophic gastritis patients were included in the same period and matched by age and gender. The three groups of samples were collected at the same time, and the sampling, packaging and storage conditions were consistent, and the plasma exosome hsa_circ_0006853 content was detected and analyzed.

[0085] (2) Data analysis: The experimental data were analyzed using a relative quantitative method, with β-actin as the internal reference gene (primer sequences are shown in SEQ ID NO.4 and SEQ ID NO.5), and ΔCT = CT hsa-circ_0006853 -CT β-actin The test values ​​of individual samples were expressed, and the differences between different groups and between pre- and post-operative periods were compared. Graphpad Prism8.2.0 and SPSS20.0 were used for analysis.

[0086] (3) Results:

[0087] Comparison of plasma exosome hsa_circ_0006853 expression levels in gastric cancer patients, atrophic gastritis patients, and healthy subjects (A), as well as preoperative and postoperative expression levels in gastric cancer patients (B) Figure 5 As shown in the figure, hsa-circ_0006853 is highly expressed in the plasma exosomes of gastric cancer patients (GC-ex group), and the expression levels in the plasma exosomes of healthy subjects (Normal-ex), atrophic gastritis patients (Gastritis-ex), and gastric cancer patients increase in turn. After gastric cancer tumor tissue resection, the expression level of hsa_circ_0006853 decreases. The specificity and sensitivity of plasma exosome hsa_circ_0006853 for gastric cancer diagnosis are shown in the figure. Figure 6 As shown in the figure, in terms of diagnostic efficacy, the AUC area of ​​hsa_circ_0006853 was 0.73, and the sensitivity and specificity were 83% and 57%, respectively. The above results indicate that exosome hsa_circ_0006853 is a potential biomarker in the diagnosis and differentiation of gastric cancer and an effective prognostic monitoring indicator.

[0088] In summary, plasma exosome hsa_circ_0006853 can provide a new biomarker with potential value for the early diagnosis and differential diagnosis of gastric cancer. The provided plasma exosome circRNA detection method can provide reference and help for clinical laboratories to explore more plasma exosome circRNA markers for tumor diagnosis.

[0089] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Jiangsu University <120> A plasma exosome circRNA marker for diagnosis and prognosis monitoring of gastric cancer and its application <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 78 <212> DNA <213> Homo sapiens <400> 1 gggcccggcg gatgcctcct ttgccggagc ttggaacaga ctcacggcca gcgaagtgag 60 ttcaatggct gaggtgag 78 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 caatggctga ggtgaggggc c 21 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 ctgttccaag ctccggcaaa gg 22 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 cacgaaacta ccttcaactc c 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 catactcctg cttgctgatc 20

Claims

1. Use of a reagent for detecting plasma exosome circRNA markers in the preparation of a gastric cancer diagnostic tool, characterized in that: The plasma exosome circRNA marker is hsa_circ_0006853; the nucleic acid sequence of hsa_circ_0006853 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that: The reagents include a specific primer pair designed for hsa_circ_0006853.

3. The application according to claim 2, characterized in that: The specific primer pair includes an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

Images