Molecular markers, identification methods and applications for identifying the South China subspecies of sika deer

Abstract

The present invention provides a molecular marker, identification method and application for identifying the South China subspecies of sika deer, belonging to the field of molecular biology. The molecular marker for identifying the South China subspecies of sika deer of the present invention includes two SNP marker sites located on a 372bp fragment of the COX1 gene, wherein the two SNP sites are both C in the South China subspecies of sika deer; and A and T in non-South China subspecies of sika deer. The present invention also provides a molecular marker primer and identification method for identifying the South China subspecies of sika deer, with an identification accuracy of 100%. The present invention makes up for the deficiency of the molecular marker detection technology for identifying the South China subspecies of sika deer in the field, realizes the accurate identification of sika deer subspecies, and has important theoretical and application value for the protection and management of sika deer resources.

Description

Technical Field

[0001] The invention relates to a molecular marker, an identification method and application for identifying a South China subspecies of sika deer, and belongs to the technical field of molecular biology. Background Art

[0002] Sika deer (Cervus nippon) belongs to the class Mammalia, order Artiodactyla, family Cervidae, genus Cervus. It is an iconic animal in the East Asian monsoon region and is distributed from the Wusuli River to Vietnam. The most widely accepted view is that sika deer are divided into 13 subspecies. The six existing subspecies in Japan are the Hokkaido subspecies (Cervusnippon yesoensis), the Honshu subspecies (Cervus nippon centralis), the nominate subspecies (Cervus nipponnippon), the Yakushima subspecies (Cervus nippon yakushimae), the Mageshima subspecies (Cervus nipponmageshimae) and the Ryukyu subspecies (Cervus nippon keramae). There is one subspecies in Vietnam: the Vietnamese subspecies (Cervusnippon pseudaxis). There are 6 subspecies of Chinese sika deer, of which the North China subspecies (Cervus nippon mandarinns) and the Shanxi subspecies (Cervus nippon grassianus) are both extinct. The Northeast China subspecies (Cervus nipponhortulorum) is distributed in Liaoning, Jilin, Heilongjiang, southeastern Siberia, the Ussuri River Basin and North Korea. It is larger in size, with a blue-gray abdomen, reddish-brown hair in summer, large but sparse white spots, and inconspicuous or even no white spots in winter. The South China subspecies (Cervusnippon kopschi) is distributed in southern Anhui, northwestern Zhejiang and northeastern Jiangxi. It is small in size, with reddish-brown hair in summer, larger white spots, sparse white spots on the sides of the body, gray-brown abdomen, dark brown hair in winter, and inconspicuous white spots. The Sichuan subspecies (Cervusnippon sichuanicus) was discovered in 1964 and identified as a new subspecies of sika deer. Its habitat is mainly located in Tiebu and Baozuo Nature Reserves in Ruoergai, Sichuan. It is large in size, with a white belly, dark reddish-brown summer fur, small and dense white spots, and inconspicuous white spots in winter fur. The Taiwan subspecies (Cervus nippon taiouanus) is mainly distributed in Taiwan. It is small in size, with yellow-brown summer fur and darker color behind the neck. Both summer and winter fur have obvious large white spots.

[0003] At present, the subspecies division of sika deer is mainly based on morphological differences and geographical distribution, and there is a problem of confusion in the classification of genetic resources. The results of the study on the origin and evolution of sika deer based on the whole mitochondrial genome show that there is great genetic differentiation within the Northeast subspecies, and there is gene exchange between domestic sika deer and other sika deer subspecies, which may be natural or human factors. The South China subspecies, Sichuan subspecies and Taiwan subspecies of wild sika deer are all clustered into separate branches in the phylogenetic analysis, which indicates that the subspecies-specific SNPs of protein-coding genes in the mitochondrial genome can be used as candidate molecular markers to identify the Sichuan subspecies, South China subspecies and Taiwan subspecies.

[0004] Molecular SNP markers have the advantages of high accuracy, rich variation, and simple operation. Molecular markers are not affected by environmental factors and can directly reflect differences in animal genetic levels. Therefore, they are widely used in animal individual identification and seed provenance identification.

[0005] Currently, there is no report on the use of molecular markers to identify the South China subspecies of sika deer in this field. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker and primers and applications for identifying the South China subspecies of sika deer, in view of the deficiencies of the above-mentioned prior art, which will help solve the current problems faced in accurately identifying sika deer subspecies.

[0007] The inventors conducted in-depth research on the mtDNA sequences of samples of different subspecies of sika deer, and obtained SNP markers and identification methods that can be used to accurately identify the South China subspecies of sika deer, thus achieving accurate identification of different subspecies of sika deer, which has important theoretical and application value for the protection and management of sika deer resources.

[0008] In one aspect of the present invention, a molecular marker for identifying the South China subspecies of sika deer is provided, wherein the molecular marker comprises two SNP marker sites: S-1 and S-2, and the site information is shown in Table 1:

[0009] Table 1 SNP marker sites used in the present invention to identify the South China subspecies of sika deer

[0010] The two SNP sites S-1 and S-2 provided by the present invention are both C in the South China subspecies of sika deer; and are A and T in non-South China subspecies of sika deer. The non-South China subspecies of sika deer include Northeast China subspecies of sika deer, Sichuan subspecies of sika deer, Taiwan subspecies of sika deer, Hokkaido subspecies of sika deer, Honshu subspecies of sika deer, nominate subspecies of sika deer, and Yakushima subspecies of sika deer.

[0011] The present invention also provides molecular marker primers for identifying the South China subspecies of sika deer, and the sequences of the primer pairs are shown in SEQ ID NO. 1-SEQ ID NO. 2. The primer pairs are used to amplify the sample to be tested, and if the two SNP sites of the amplified fragment sequence are both C, the sample to be tested is the South China subspecies of sika deer; if the first SNP site is A and the second SNP site is T, the sample to be tested is not the South China subspecies of sika deer.

[0012] The present invention also provides the use of the above-mentioned molecular markers for identifying the South China subspecies of sika deer or primers for identifying the South China subspecies of sika deer in identifying the South China subspecies of sika deer; and the use of the above-mentioned molecular markers for identifying the South China subspecies of sika deer in preparing a kit or in a detection method, wherein the kit or the detection method is used to identify the South China subspecies of sika deer.

[0013] The present invention further provides a method for identifying the South China subspecies of sika deer, the method comprising: extracting DNA of a sample to be tested, performing PCR amplification using the primer pair shown in SEQ ID NO.1-SEQ ID NO.2; sequencing the PCR product, and identifying whether the sample to be tested is the South China subspecies of sika deer according to the base of the SNP marker site. If both the two SNP sites of the amplified fragment sequence are C, the sample to be tested is the South China subspecies of sika deer; if the first SNP site is A and the second SNP site is T, the sample to be tested is not the South China subspecies of sika deer.

[0014] Beneficial effects of the present invention:

[0015] (1) The present invention determines two SNP sites specific to the South China subspecies of sika deer, obtains a pair of identification primers, and establishes a method for identifying the specific SNP of the South China subspecies of sika deer. The present invention makes up for the lack of molecular detection technology for identifying the South China subspecies of sika deer in the field, and realizes the accurate identification of sika deer germplasm resources. (2) The method of the present invention uses the differential SNP of sika deer subspecies as the basis for judgment, provides a stable and reliable molecular detection method for the subspecies level identification of sika deer resources, expands the range of available marker sites for sika deer at the gene level, provides new ideas and methods for the identification of sika deer germplasm resources, and has important theoretical and application value for the mapping of DNA fingerprints of sika deer and the protection and management of wild subspecies. (3) The sites selected by the present invention have good stability and the accuracy of the identification method is extremely high. The method of the present invention was used to detect 90 sika deer samples from China and Japan. The results showed that 13 of the 90 samples were South China subspecies, and the remaining samples were not South China subspecies. The detection accuracy was 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 These are the SNP sites of mtDNA sequence differences between the South China subspecies of sika deer and other subspecies of the present invention. Cervus nippon hortulorum : Northeastern subspecies; Cervus nippon sichuanicus : Sichuan subspecies; Cervus nippon kopschi : South China subspecies; Cervus nippon taiouanus :Taiwan subspecies; Cervus nipponyesoensis:Hokkaido subspecies; Cervus nippon centralis:Honshu subspecies; Cervus nippon nippon:nominate subspecies; Cervus nippon yakushimae:Yakushima subspecies.

[0017] Figure 2 This is a diagram of the PCR results of Example 2. In the diagram, M: DNAMaker1000; Lane 1 is the band amplified by the primer pair. DETAILED DESCRIPTION

[0018] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited thereto. The methods involved in the present invention are all commonly used methods in the art unless otherwise specified, and the reagents involved can be obtained from commercial sources unless otherwise specified.

[0019] Example 1: Acquisition of specific SNP markers for identifying the South China subspecies of sika deer

[0020] 1. Screening of specific SNP loci for the South China subspecies of sika deer

[0021] Combined with the mtDNA sequences of samples of different subspecies of sika deer, including the Northeast subspecies, Sichuan subspecies, South China subspecies, Taiwan subspecies, Hokkaido subspecies, Honshu subspecies, nominate subspecies and Yakushima subspecies, Mega6.0 was used for comparison analysis, mainly targeting sites shared by the same subspecies and specific to other subspecies, and 2 differential SNP sites were screened, such as Figure 1 As shown. Both marker sites are located on the 372bp fragment of COX1 gene in the mtDNA genome of sika deer; marker S-1 is at 69bp, which is base C in the South China subspecies and base A in the non-South China subspecies; marker S-2 is located at 306bp, which is base C in the South China subspecies and base T in the non-South China subspecies. The non-South China subspecies include the Northeast subspecies of sika deer, the Sichuan subspecies of sika deer, the Taiwan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

[0022] 2. Primer design

[0023] The COX1 gene fragment was extracted using Mega6.0, and the sequence length was about 550 bp, which was used to design identification primers.

[0024] According to the intercepted target gene fragment, the identification primers were designed by combining Primer5.0 and Oligo7.0. The primer pair for amplifying the COX1 gene fragment was obtained, F: 5'ACAGACCGAAACCTAAATACAAC3' (SEQ ID NO.1); R: 5'AGTGAACAAATCCCCCTATAATAGCA3' (SEQ ID NO.2). After the primers were designed, they were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0025] Example 2: Establishment of a method for identifying the South China subspecies of sika deer

[0026] The primer pair shown in SEQ ID NO.1-SEQ ID NO.2 was used to perform PCR experiments to establish a method for identifying the South China subspecies of sika deer. The PCR amplification conditions are shown in Table 2.

[0027] Table 2 PCR amplification conditions

[0028] The PCR reaction system is shown in Table 3.

[0029] Table 3 PCR system

[0030] The PCR amplification process is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, and extension at 72°C for 30 sec, for a total of 30 cycles; extension at 72°C for another 5 min, and storage at 4°C.

[0031] 3.5 μL of PCR product was tested by 1% agarose gel electrophoresis. Figure 2 ) is consistent with the target fragment, the band is single and dense, and can be used for subsequent sequencing. The band is single and bright, and the size is consistent with the target fragment size, and can be used for sequencing.

[0032] The PCR product is sequenced, and the bases of the SNP marker sites can be used to identify whether the sample to be tested is the South China subspecies of sika deer. The sequence of the South China subspecies of sika deer is shown in SEQ ID NO.3; the sequence of the non-South China subspecies of sika deer is shown in SEQ ID NO.4.

[0033] The experimental results show that the present invention has successfully established a method for effectively distinguishing the South China subspecies of sika deer from other subspecies.

[0034] Example 3. Specific application of the method of the present invention for identifying the South China subspecies of sika deer

[0035] A total of 90 samples collected from China and Japan were selected, and genomic DNA was extracted from them. Experimenter A randomly mixed these samples and renumbered them. Experimenter B used the primers designed by the present invention to perform PCR amplification on these samples, and the amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing peak graph was viewed by Bioedit 7.0, and the peaks and valleys of the sequencing result graph were separated, without overlap and misreading, indicating that the sequencing results were credible. The sequences were aligned using Mega6.0, and the bases of the SNP sites specific to the South China subspecies of sika deer were used as the basis for judgment.

[0036] The determination was made according to the mtDNA specific SNP molecular markers determined by the present invention. The identification results are shown in Table 4, and the results are represented by yes / no as South China subspecies / non-South China subspecies. The results show that among the 90 sika deer samples, the S-1 and S-2 sites of the 13 samples K5-K17 were C and C respectively, and the S-1 and S-2 sites of the 77 samples K1-K4 and K18-K90 were A and T respectively. After checking with experimenter A, the 13 samples K5-K17 were indeed South China subspecies, with an accuracy rate of 100%, and the 77 samples K1-K4 and K18-K90 were non-South China subspecies, with an accuracy rate of 100%.

[0037] In summary, it is shown that the two SNP sites proposed in the present invention have high accuracy and good stability when used to distinguish the South China subspecies of sika deer and other subspecies.

[0038] Table 4 Test results of sika deer samples Sequence Listing <110> Specialty Products Research Institute, Chinese Academy of Agricultural Sciences <120> Molecular markers, identification methods and applications for identifying the South China subspecies of sika deer <141> 2022-05-31 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 acagaccgaa acctaaatac aac 23 <210> 2 <211> 26 <212> DNA <213> Artificial sequence <400> 2 agtgaacaaa tccccctata atagca 26 <210> 3 <211> 372 <212> DNA <213> Cervus nippon <400> 3 caccctgaag tatatatcct tattctaccc ggctttggta taatctccca tatcgtaaca 60 tactattccg gaaaaaaaga accatttggg tacataggaa tagtctgggc tataatatca 120 attgggttct tagggttcat cgtatgagcc caccacatat ttacagtcgg aatagacgtt 180 gacacacgag cctatttcac atcagctacc ataattattg ccatcccaac tggagtaaaa 240 gtctttagtt gactagcgac actccacgga ggcaatatta aatgatcacc tgctataata 300 tgagccttag gctttatttt cctttttaca gttggaggct taaccgggat tgttcttgcc 360 aattcttctc tc 372 <210> 4 <211> 372 <212> DNA <213> Cervus nippon <400> 4 caccctgaag tatatatcct tattccc ggctttggta tatatctccca tatcgtaaca 60 tactattcag gaaaaaaaga accattggg tacataggaa tagtctgggc tataatatca 120 atcggattct taggttcat cgtatgagcc caccacatat ttacagtcgg atagacgtt 180 gabacacgag cctatttcac atcagctacc atattattg ccatcccaac tggagtaaaa 240 gtctttagtt gactagcaac actcacgga gccaatatta atgatcacc tgctataata 300 tgagctttag gctttattt cctttca gttgaggct taccgggat tgttcttgcc 360 aattctctc tc 372

Claims

1. Molecular markers for identifying the South China subspecies of sika deer, characterized by: The molecular marker is located in the 372bp fragment of the COX1 gene in the mtDNA genome of sika deer, and the fragment is shown in SEQ ID NO.

3. It has two SNP sites S-1 and S-2. The S-1 site is the 69bp base of the 372bp fragment of the COX1 gene, which is C / A; the S-2 site is the 306bp base of the 372bp fragment of the COX1 gene, which is C / T; the two SNP sites S-1 and S-2 are both C in the South China subspecies of sika deer; and A and T respectively in non-South China subspecies of sika deer.

2. The molecular marker for identifying the South China subspecies of sika deer as claimed in claim 1, characterized in that: The non-South China subspecies of sika deer mentioned above are the Northeast subspecies of sika deer, the Sichuan subspecies of sika deer, the Taiwan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

3. A primer pair for identifying the South China subspecies of sika deer, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. The primer pair for identifying the sika deer south China subspecies as claimed in claim 3, characterized in that: The primer pair is used to amplify a 372 bp fragment of the sika deer COX1 gene.

5. Use of the molecular marker for identifying the South China subspecies of sika deer as claimed in claim 1 or the primer pair for identifying the South China subspecies of sika deer as claimed in claim 3 in identifying the South China subspecies of sika deer.

6. Use of the molecular marker for identifying the South China subspecies of sika deer according to claim 1 or the primer pair for identifying the South China subspecies of sika deer according to claim 3 in preparing a kit or in a detection method, characterized in that: The kit or detection method is used to identify the South China subspecies of sika deer.

7. A method for identifying the South China subspecies of sika deer, characterized in that: The method comprises the following steps: extracting DNA of a sample to be tested, and performing PCR amplification using the primer pair described in claim 3; sequencing the PCR product, and identifying whether the sample to be tested is the South China subspecies of sika deer according to the bases of the SNP marker sites; if the SNP sites S-1 and S-2 described in claim 1 in the amplified fragment sequence are both C, the sample to be tested is the South China subspecies of sika deer; if the first SNP site S-1 is A and the second SNP site S-2 is T, the sample to be tested is not the South China subspecies of sika deer.

8. A kit for identifying the South China subspecies of sika deer, characterized in that: The kit comprises the primer pair according to claim 3.

Images