A patterning implementation method and its application

Abstract

The present invention relates to the field of mass spectrometry detection, and discloses a patterning realization method and its application. The present invention realizes patterning through photolithography, and the hydrophilic and hydrophobic parts form regions through strong forces such as covalent bonds; the crystal pattern of the present invention is very fine, and the required pattern can be depicted at will, and through simple immersion treatment and other methods, full and smooth crystals are finally obtained, which is beneficial to subsequent detection needs, and plays an important role in the chip fields such as mass spectrometry detection and microfluidics.

Description

Technical Field

[0001] The present invention relates to the field of mass spectrometry detection, and in particular to a patterning implementation method and application thereof. Background Art

[0002] As an important means to realize the division of different functional areas of substrate materials, patterning has a wide range of application needs in many fields such as micro-nano processing, sensor detection, life sciences, etc. At present, patterning is mainly achieved through a mask, using magnetron sputtering, chemical / physical vapor deposition (CVD / PVD), evaporation, etching, lithography and other methods. Among them, magnetron sputtering, CVD / PVD, evaporation and other methods, although they can achieve fine patterns and structures, have relatively strict requirements on the materials and equipment used, and the etched surface is rough, which is not conducive to subsequent further modification and transformation; in contrast, ordinary micron-level lithography has lower requirements for materials and equipment and is easier to achieve. In the fields of biotechnology, life sciences, etc., most of the dispersed phase is aqueous phase. Therefore, hydrophilic and hydrophobic differences are one of the simplest ways to achieve patterning. By designing hydrophilic and hydrophobic dot patterns, multiple tests and multiple reactions can be performed, which greatly improves its throughput. Therefore, in the prior art, lithography is often used in conjunction with hydrophilic and hydrophobic dot arrays to achieve patterning.

[0003] Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) breaks the tradition that mass spectrometry can only analyze small molecules, and allows the study of biological macromolecules such as nucleic acids and proteins. In the past decade, nucleic acid mass spectrometry technology based on MALDI-TOF MS has become one of the mainstream methods for nucleic acid detection in many departments such as obstetrics and gynecology, pediatrics, genetics, cardiovascular medicine, oncology, and laboratory as a high-throughput, high-sensitivity, accurate and convenient technology. It has been widely used in genetic disease screening, cancer precision analysis, drug genomics detection, pathogen detection and other fields. In MALDI detection, the mixed solution of the sample and the matrix needs to be deposited on the sample target together, dried and crystallized naturally at room temperature, and then the sample target is sent to the mass spectrometer for detection. Through the preparation of hydrophilic and hydrophobic patterns, it can achieve simultaneous detection of 96 or 384 people or even more people on a substrate material, greatly improving its detection flux and detection content. In this process, the size of the sample deposition area on the sample target and the uniformity of the co-crystallization of the sample and the matrix on the sample target will directly affect the results of mass spectrometry detection. Therefore, using a suitable method to regulate the properties of the sample target surface is crucial for accurately regulating the sample deposition area and improving the uniformity of the co-crystallization of the sample and the matrix. However, at present, the hydrophilic or hydrophobic patterning method is usually composed of nanoparticles, metal / polymer films, etc. When dealing with complex solution systems, its hydrophilic / hydrophobic properties will be destroyed, and the crystallization will have problems such as defects, unevenness, incompleteness and insufficiency, and there is also a certain risk of long-term stability. Summary of the invention

[0004] In order to solve the above-mentioned problems such as unstable hydrophilic-hydrophobic structure, high cost, complex process and poor crystallization effect, we proposed a method for preparing hydrophilic-hydrophobic patterns on a substrate.

[0005] In one aspect, the present invention discloses a method for preparing a hydrophilic-hydrophobic pattern on a substrate, the steps of which are:

[0006] S1, providing substrate;

[0007] S2, treating the substrate selected in step S1 with ethanol, acetone or isopropanol, and washing and drying after the treatment;

[0008] S3, hydrophilizing the substrate in step S2 and drying it;

[0009] S4, evenly spin-coating a photoresist on the substrate obtained in step S3;

[0010] S5, placing the photolithography mask on the substrate obtained in step S4, and then performing ultraviolet exposure, immersing the exposed substrate in a developer for development, and drying after completion;

[0011] S6, subjecting the substrate obtained in S5 to a hydrophobic treatment, and then placing the substrate in a methanol, ethanol or acetone solvent to obtain a hydrophilic and hydrophobic pattern;

[0012] The hydrophobic treatment is to dissolve a hydrophobic agent in an organic solvent to form a hydrophobic treatment agent, and then immerse the substrate in the hydrophobic treatment agent; after immersion, ultrasonically clean the substrate in a pure hydrophobic treatment agent, and then blow dry the substrate.

[0013] On the other hand, the invention discloses a method for preparing a hydrophilic and hydrophobic pattern on a substrate, the steps of which are:

[0014] S1, providing substrate;

[0015] S2, treating the substrate selected in step S1 with ethanol, acetone or isopropanol, and washing and drying after the treatment;

[0016] S3, hydrophilizing the substrate in step S2 and drying it;

[0017] S4, subjecting the substrate obtained in S3 to a hydrophobic treatment;

[0018] S4, evenly spin-coating a photoresist on the substrate obtained in step S4;

[0019] S5, placing the photolithography mask on the substrate obtained in step S4, and then performing ultraviolet exposure, immersing the exposed substrate in a developer for development, and drying after completion;

[0020] S6, placing the substrate obtained in S5 in a methanol, ethanol or acetone solvent to obtain a hydrophilic and hydrophobic pattern;

[0021] The hydrophobic treatment is to dissolve a hydrophobic agent in an organic solvent to form a hydrophobic treatment agent, and then immerse the substrate in the hydrophobic treatment agent; after immersion, ultrasonically clean the substrate in a pure hydrophobic treatment agent, and then blow dry the substrate.

[0022] The immersion time is more than 1 hour, and the "immersion" mentioned in the present invention means that the hydrophobic treatment reagent completely covers the substrate.

[0023] Preferably, the hydrophobic agent is a long-chain alkyl silane or a fluorine-containing silane, and the long-chain alkyl silane or the fluorine-containing silane is selected from octadecyltrichlorosilane, hexadecyltrimethoxysilane or heptadecafluorodecyltrimethoxysilane.

[0024] There is no particular limitation on the organic solvent of the present invention. The organic solvent is used to dissolve silane but does not dissolve photoresist, so a low-polarity solvent is preferred. The low polarity of the present invention means that the polarity is lower than that of methanol.

[0025] Preferred are dichloromethane, chloroform, ethylene dichloride, carbon tetrachloride or carbon disulfide.

[0026] The organic solvent is preferably an alkane containing chlorine substitution.

[0027] More preferably, it is selected from dichloromethane, chloroform or dichloroethane.

[0028] Preferably, the spin coating condition is 100-3000 rpm, 1S or more.

[0029] Preferably, the spin coating is performed in stages, and more preferably the initial rotation speed is 100-500 rpm, 1 s-1 min, and then 1000-2000 rpm, 10 s-1 min.

[0030] Preferably, the size and spacing of the mask pattern can be adjusted as needed, preferably with a diameter of 500um, a spacing of 2.25mm for 96 people, and 1.125mm for 384 people.

[0031] Preferably, the substrate is selected from a material with a smooth surface, wherein the smoothness means that the surface roughness is Ra≤1um, preferably Ra≤100nm, and more preferably Ra≤10nm.

[0032] The smooth material described in the present invention refers to a substrate with a surface roughness of Ra≤1um, because the downstream is to judge the quality by looking at the morphology of the substrate after the substrate is pre-embedded. If the surface of the substrate is not smooth, the substrate crystallization will be uneven, large blocks or coffee ring effect will appear.

[0033] The present invention has no special requirements on the material, and only requires a smooth surface.

[0034] Preferably, the substrate is selected from materials such as single crystal silicon, silicon wafer, stainless steel, other metals, glass, plastic, etc., more preferably single crystal silicon.

[0035] Preferably, the hydrophilization treatment is: treating the surface of the substrate with oxygen / air plasma or piranha solution.

[0036] The surface of the substrate is treated with oxygen / air plasma for more than 1 second, and then immersed in pure water for more than 1 minute after the treatment;

[0037] The piranha solution is a solution of concentrated sulfuric acid and hydrogen peroxide solution in a ratio of 3:1 to 7:1, and the treatment is performed for more than 1 minute. Preferably, heating can be performed at the same time, and the heating conditions are: heating at 80 to 100° C. for 10 to 30 minutes.

[0038] Preferably, the spin-on photoresist is a negative photoresist.

[0039] The hydrophobic treatment process of the present invention does not contain any alcohols, ketones, etc. This process requires the retention of glue, and alcohols and ketones will cause glue removal, affecting the effective formation of the hydrophilic and hydrophobic pattern.

[0040] Preferably, the organic solvent is a chlorine-substituted alkane, which has a better effect.

[0041] In another aspect, the present invention discloses application of the substrate in nucleic acid mass spectrometry.

[0042] In another aspect, the present invention provides a mass spectrometry chip, the chip comprising a matrix and the above-mentioned substrate, the matrix comprising: hydroxypicolinic acid and ammonium hydrogen citrate.

[0043] On the other hand, the present invention discloses an application of a hydrophobic treatment reagent in nucleic acid mass spectrometry, wherein the reagent comprises a long-chain alkyl silane or a fluorine-containing silane and an organic solvent, wherein the long-chain alkyl silane or the fluorine-containing silane is selected from octadecyltrichlorosilane, hexadecyltrimethoxysilane or heptadecafluorodecyltrimethoxysilane, and the organic solvent is selected from dichloromethane, chloroform, dichloroethane, carbon tetrachloride or carbon disulfide.

[0044] The drying described in the present invention is nitrogen drying.

[0045] Beneficial effects:

[0046] The hydrophobic treatment process of the present invention does not contain any alcohols, ketones, etc., ensuring the quality of the hydrophobic pattern. The present invention realizes patterning through photolithography, and the hydrophilic and hydrophobic parts are formed by strong forces such as covalent bonds. The pattern of the present invention is very fine and can be arbitrarily depicted. There will be no problems such as degumming and pollution during the operation. And after subsequent treatment or application to mass spectrometry to react with the detection solution, the pattern will not be destroyed. At the same time, the preparation method is simple and fast, and can be achieved only through simple operations such as solution immersion, and the crystal is full and flat. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 It is a crystallization diagram of the method of the present invention;

[0048] Figure 2 It is a detection application diagram of the method of the present invention;

[0049] Figure 3 The crystal diagrams of substrates replaced by the method of the present invention are 3a (stainless steel), 3b (glass), 3c (plastic), and 3d (iron plate).

[0050] Figure 4 Replace the hydrophilic treatment crystal diagram for the method of the present invention;

[0051] Figure 5The crystal diagram of the hydrophobic reagent replacement method of the present invention, 5a (hexadecyltrimethoxysilane), 5b (heptadecafluorodecyltrimethoxysilane);

[0052] Figure 6 The organic solvent crystallization diagrams for the method of the present invention are 6a (chloroform), 6b (ethylene dichloride), 6c (carbon tetrachloride), and 6d (carbon disulfide);

[0053] Figure 7 This is the crystallization diagram of the method of comparative example 1;

[0054] Figure 8 The detection application diagram for comparative example 1;

[0055] Fig. 9 This is the crystallization diagram of the method of comparative example 2;

[0056] Fig.10 This is the crystallization diagram of the method of Comparative Example 3. DETAILED DESCRIPTION

[0057] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings in the embodiments of the present invention.

[0058] The method and application of the present invention are further illustrated by the following examples, but these examples are not intended to limit the present invention.

[0059] The present invention realizes patterning through photolithography, and the hydrophilic and hydrophobic parts are both formed by strong forces such as covalent bonds, so as to maintain the stability of the hydrophilic and hydrophobic regions in the case of complex solutions and ensure the flatness of the final detected crystals.

[0060] Example 1 Substrate treatment method of the present invention

[0061] The specific operations are as follows:

[0062] S1: Use single crystal silicon wafer;

[0063] S2: treating the substrate selected in step S1 with ethanol, washing with purified water and drying after the treatment;

[0064] S3: The substrate in step S2 is treated with oxygen / air plasma (300W plasma cleaning machine, air flow, 1min), and after the treatment, it is immersed in pure water for 5s;

[0065] S4: evenly spin-coating the photoresist on the substrate obtained in step S3, the spin-coating conditions being (e.g., initial rotation speed of 500 rpm, 10 s, then 2000 rpm, 30 s);

[0066] S5: placing a photolithography mask on the substrate obtained in step S4, wherein the diameter of the mask pattern is 500 um, the spacing is 2.25 mm, and then performing ultraviolet exposure for 30 seconds; immersing the exposed substrate in a developer for development to obtain a pattern;

[0067] S6: The substrate obtained in S5 is subjected to hydrophobic treatment, specifically, octadecyltrichlorosilane is dissolved in dichloromethane to form a hydrophobic treatment reagent, and the concentration is prepared to be 1% v / v; then the substrate is immersed in the hydrophobic treatment reagent for 1 hour; after the immersion is completed, it is ultrasonically cleaned in pure hydrophobic treatment reagent, and then blown dry; after completion, it is placed in 100% methanol to obtain a hydrophilic and hydrophobic pattern;

[0068] S7: The matrix covers the hydrophilic area of ​​the substrate to form a 100 μm crystalline area to prepare a chip.

[0069] S8: The chip in S7 is placed in the vacuum environment of the ion source of the mass spectrometer, and the crystals formed between the sample and the matrix are irradiated by laser to generate charged particles. The flight time of the charged particles can be calculated under the action of the electric field.

[0070] The mass spectrometer used in this example is the EXS3000 mass spectrometer produced by Zhongyuan Huiji Biotechnology Co., Ltd.

[0071] The purified water used in this embodiment is Wahaha purified water purchased from the market.

[0072] A. Crystallization Detection

[0073] The results are as follows Figure 1 As shown, the results show that the method of the present invention has full crystals.

[0074] B. Detection Application

[0075] The above chip was used to detect 20 loci of the deafness gene:

[0076] Four SNP mutation sites on the GJB2 gene: rs80338943 (235delC), rs750188782 (176_191del16), rs111033204 (299300delAT), and rs80338939 (35delG);

[0077] Two SNP mutation sites on the GJB3 gene: rs74315318 (547G>A) and rs74315319 (538C>T);

[0078] Eleven SNP mutation sites on the SLC26A4 gene: rs111033220 (1229C>T), rs201562855 (1174A>T), rs111033305 (1226G>A), rs200455203 (1975G>C), rs111033318 (2027T>A), rs121908363 (2162C>T), rs121908362 (2168A>G), rs1057516953 (281C>T), rs111033380 (589G>A), rs192366176 (IVS15+5G>A), rs111033313 (IVS7-2A>G);

[0079] There are three SNP mutation sites on the 12S rRNA gene: rs267606617 (1555A>G), rs267606619 (1494C>T) and rs267606618 (1095T>C).

[0080] The specific operations are as follows:

[0081] S1: Extraction of sample DNA;

[0082] S2: multiplex PCR reaction;

[0083] S3: phosphatase digestion treatment;

[0084] S4: Single base extension reaction

[0085] S5: resin desalting treatment;

[0086] S6: Use a pipette or spotter to transfer the reaction product to the detection chip, and use the MALDI-tof EXS3000 mass spectrometer of Chongqing Zhongyuan Huiji Biotechnology Co., Ltd. for detection.

[0087] The primers for the multiplex PCR reaction are as follows:

[0088]

[0089]

[0090] The primers for the single base extension reaction are as follows:

[0091] serial number sequence Site name SEQ-ID-NO.23 ctccacagtcaagca 1975G>C SEQ-ID-NO.24 gcctttgggatcagc 1174A>T SEQ-ID-NO.25 caccactgctctttccc 1226G>A SEQ-ID-NO.26 agaaccttaccacccgc 2027T>A SEQ-ID-NO.27 acatccggctatgggcc 235delC SEQ-ID-NO.28 gcagtagcaattatcgtc IVS7-2A>G SEQ-ID-NO.29 cgtacacaccgcccgtcac 1494C>T SEQ-ID-NO.30 cgtggactgctacattgcc 538C>T SEQ-ID-NO.31 gtcatttcgggagttagta 281C>T SEQ-ID-NO.32 cagtgctctcctggacggcc 1229C>T SEQ-ID-NO.33 tgcacgtggcctaccggagac 299_300delAT SEQ-ID-NO.34 ggattagataccccactatgct 1095T>C SEQ-ID-NO.35 tctgtagatagagtatagcatca 2168A>G SEQ-ID-NO.36 gatggggaagtagtgatcgtagc 176_191del16 SEQ-ID-NO.37 tgccagtgccctgactctgctggtt 589G>A SEQ-ID-NO.38 acccctacgcatttatatagaggag 1555A>G SEQ-ID-NO.39 aaaaaatgtatcaagtccacagtaa IVS15+5G>A SEQ-ID-NO.40 gggcacgctgcagacgatcctggggg 35delG SEQ-ID-NO.41 ccatgaagtaggtgaagattttcttct 547G>A SEQ-ID-NO.42 aaaggacacattctttttga 2162C>T

[0092] The results are as follows Figure 2 As shown, the results show that the present invention has high resolution and can completely detect all mutations.

[0093] Example 2 Effect of changing the conditions of the substrate treatment method of the present invention

[0094] A. Replace the substrate

[0095] The process was carried out according to the steps in Example 1, and the substrates were replaced with stainless steel, other metals, glass, and plastic. The results were as follows: Figure 3 a (stainless steel), 3b (glass), 3c (plastic), 3d (iron plate), the results show that the crystal morphology will not be affected after the substrate is replaced in the present invention.

[0096] B. Replace the hydrophilic treatment steps

[0097] Replace S3 in Example 1 with:

[0098] S3: Use piranha solution for treatment (a solution of concentrated sulfuric acid and hydrogen peroxide solution mixed in a ratio of 3:1, treated for 20 minutes, 90°C, heated for 10 minutes) The treatment results are as follows Figure 4 As shown, the results show that the crystal morphology will not be affected by replacing the hydrophilization treatment step of the present invention.

[0099] C. Replace the hydrophobic treatment reagent

[0100] (1) The steps in Example 1 were followed, and the hydrophobic reagent was replaced with hexadecyltrimethoxysilane and heptadecafluorodecyltrimethoxysilane. The results are as shown in 5a (hexadecyltrimethoxysilane) and 5b (heptadecafluorodecyltrimethoxysilane). The results show that the crystal morphology of the present invention is not affected by replacing the hydrophobic reagent.

[0101] (2) The steps in Example 1 were followed, and the organic solvent was replaced with chloroform, dichloroethane, carbon tetrachloride, and carbon disulfide. The results are shown in 6a (chloroform), 6b (dichloroethane), 6c (carbon tetrachloride), and 6d (carbon disulfide). The results show that the crystal morphology of the present invention is not affected by replacing the hydrophobic reagent.

[0102] Comparative Example 1

[0103] The specific operations are as follows:

[0104] This embodiment [does not use photolithography, uses a stainless steel mask]

[0105] S1: Use single crystal silicon wafer;

[0106] S2: treating the substrate selected in step S1 with ethanol, washing with purified water and drying after the treatment;

[0107] S3: The substrate in step S2 is treated with oxygen / air plasma (300W plasma cleaning machine, air flow, 1 min), and after the treatment, it is immersed in pure water for 5s;

[0108] S4: evenly spin-coating the photoresist on the substrate obtained in step S3, the spin-coating conditions being (e.g., initial rotation speed of 500 rpm for 10 s, then 2000 rpm for 30 s);

[0109] S5: Apply glue (any commonly used adhesive) to the back of the stainless steel mask, and then bond the stainless steel mask to the substrate;

[0110] S6: soaking the above substrate in a hydrophobic reagent, specifically dissolving octadecyltrichlorosilane in dichloromethane to form a hydrophobic treatment reagent, and preparing a concentration of 1% v / v; then immersing the substrate in the hydrophobic treatment reagent for 1 hour; after the immersion is completed, ultrasonically cleaning in pure hydrophobic treatment reagent, and then drying, and then placing in 100% methanol to obtain a hydrophilic and hydrophobic pattern;

[0111] S7: Use appropriate acetone to dissolve the adhesive and remove the stainless steel template; then immerse the substrate in acetone for 5 minutes, ultrasonicate for 2 minutes, and repeat several times until the adhesive is completely removed to obtain a hydrophobic lattice target plate;

[0112] A. Crystallization Detection

[0113] The results are as follows Figure 7 As shown, the results show that the crystallization is not smooth.

[0114] B. Detection Application

[0115] The operation method is consistent with the detection application in Example 1

[0116] The results are as follows Figure 8 As shown, the results show that the substrate processing method in Example 3 has low resolution and cannot fully detect all mutations.

[0117] Comparative Example 2

[0118] This embodiment does not use photolithography, but uses a stainless steel mask and a coating method (PTFE) to make it hydrophobic.

[0119] S1: Use single crystal silicon wafer;

[0120] S2: treating the substrate selected in step S1 with ethanol, washing with purified water and drying after the treatment;

[0121] S3: The substrate in step S2 is treated with oxygen / air plasma (300W plasma cleaning machine, air flow, 1 min), and after the treatment, it is immersed in pure water for 5s;

[0122] S4: Preparation of PTFF (polytetrafluoroethylene) super hydrophobic coating:

[0123] Solution preparation: Mix PTFE concentrate (commercial product, 60%wt concentration) with pure water to form PTFE dispersion (10%-40%wt), and stir the dispersion evenly by magnetic stirring or mechanical stirring;

[0124] Spin coating: Use a dropper to drop the above spin coating liquid onto the substrate (4-inch substrate, drop 0.5mL-2mL), pre-coat on a spin coater, 500rpm, 30s; then spin coat at 1000-5000rpm / min for 60s;

[0125] Drying: Bake in an oven at 80° for 20 minutes and then take out to obtain a PTFE coating;

[0126] S5: Clamp the stainless steel mask and silicon wafer with a clamp, put them into a plasma cleaning machine, 50W-500W power, process for 1min-60min; take them out to obtain a hydrophilic and hydrophobic dot matrix

[0127] This solution has poor stability and the PTFE membrane is easy to fall off

[0128] The results are as follows Fig. 9 Shown

[0129] The results showed that the crystallization was uneven and incomplete.

[0130] Comparative Example 3

[0131] This embodiment uses photolithography, and the hydrophobic nanostructure

[0132] The specific operations are as follows:

[0133] S1: Select single crystal silicon as the substrate;

[0134] S2: ultrasonically clean the single crystal silicon substrate in acetone, chloroform, ethanol and ultrapure water respectively, and then take out the substrate and dry it;

[0135] S3: The dried substrate is treated with O2-Plasma at a power of 200W for 10 minutes for hydrophilization, then rinsed with water and dried with nitrogen; S4: A positive photoresist is evenly spin-coated on the substrate at a speed of 500 to 5000 rpm for 5 to 50 seconds;

[0136] S5: placing a photolithography mask on the substrate, wherein the size of the mask pattern is 100-2000 μm, the spacing is 500-5000 μm, and exposing it under a UV lamp for 2-300 seconds; placing the exposed substrate in a developer for development, then taking out the substrate, and drying it with nitrogen gas to obtain a photoresist dot matrix;

[0137] S6: placing the substrate in a mixed solution of H2SO4:H2O2=3:1, heating at 100°C for 10 minutes for hydrophilization, then depositing silver nanoparticles on the hydrophilized substrate, wet-etching the obtained substrate for 1 to 30 minutes, then cleaning the substrate and drying it with nitrogen, thereby preparing a nanostructure on the substrate;

[0138] S7: Disperse polytetrafluoroethylene in an ethanol solution to form a dispersion, then spray the dispersion on a substrate, and heat the substrate to 100-200°C to remove the solvent, so that the substrate surface has hydrophobicity. Then, the substrate is cleaned, the photoresist is removed, and the substrate is dried with nitrogen gas, so that a bare silicon area with a hydrophilic center and a super-hydrophobic area with a nanostructure around it can be prepared on the substrate.

[0139] S8: The matrix covers the hydrophilic area of ​​the substrate to form a 100 μm crystallization area to prepare a chip.

[0140] S9: The chip in S8 is placed in the vacuum environment of the mass spectrometer ion source, and the crystals formed between the sample and the matrix are irradiated by laser to generate charged particles. The flight time of the charged particles can be calculated under the action of the electric field.

[0141] The mass spectrometer used in this example is the EXS3000 mass spectrometer produced by Zhongyuan Huiji Biotechnology Co., Ltd.

[0142] The purified water used in this embodiment is Wahaha purified water purchased from the market.

[0143] Crystallization detection

[0144] The results are as follows Fig.10 As shown, the results show that the crystallization is not smooth. Sequence Listing <110> Zhongyuan Huiji Biotechnology Co., Ltd. <120> A patterning implementation method and its application <130> 2022.6.29 <160> 42 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> synthesis <400> 1 agggtcgaag gtggatttag cag 23 <210> 2 <211> twenty four <212> DNA <213> synthesis <400> 2 tcagagcggt caagttgaaa tctc 24 <210> 3 <211> 21 <212> DNA <213> synthesis <400> 3 ggttggtcaa tttcgtgcca g 21 <210> 4 <211> 21 <212> DNA <213> synthesis <400> 4 ggatatgaag caccgccagg t 21 <210> 5 <211> 23 <212> DNA <213> synthesis <400> 5 ccagagcaaa ccgcccagag tag 23 <210> 6 <211> 23 <212> DNA <213> synthesis <400> 6 tctccccctt gatgaacttc ctc 23 <210> 7 <211> 23 <212> DNA <213> synthesis <400> 7 gctcatcatt gagttcctct tcc 23 <210> 8 <211> 23 <212> DNA <213> synthesis <400> 8 ctccccagcc tccaccagct tgt 23 <210> 9 <211> 22 <212> DNA <213> synthesis <400> 9 gcccatcttg gagtggctcc cc 22 <210> 10 <211> 25 <212> DNA <213> synthesis <400> 10 agccaacatc ttaccttgca gcgtg 25 <210> 11 <211> 21 <212> DNA <213> synthesis <400> 11 tctcgtatcc agcagcaatg g 21 <210> 12 <211> 23 <212> DNA <213> synthesis <400> 12 tagcacctga cctaaaacaa cgt 23 <210> 13 <211> 25 <212> DNA <213> synthesis <400> 13 gacacaaaat cccagtccct attcc 25 <210> 14 <211> 20 <212> DNA <213> synthesis <400> 14 gaacaccaca ctcaccccct 20 <210> 15 <211> 21 <212> DNA <213> synthesis <400> 15 ggaccaccac gcagagtagg c 21 <210> 16 <211> 21 <212> DNA <213> synthesis <400> 16 ttgtcctgct aagctcggtg c 21 <210> 17 <211> 23 <212> DNA <213> synthesis <400> 17 attttctatg gcaatgtcga tgg 23 <210> 18 <211> 22 <212> DNA <213> synthesis <400> 18 ctattcctga ttggacccca gt 22 <210> 19 <211> 22 <212> DNA <213> synthesis <400> 19 gaacgttccc aaagtgccaa tc 22 <210> 20 <211> 22 <212> DNA <213> synthesis <400> 20 cctgttgcaa tactggacaa cc 22 <210> 21 <211> 20 <212> DNA <213> synthesis <400> 21 gctggagcaa tgcgggttct 20 <210> 22 <211> 28 <212> DNA <213> synthesis <400> 22 ggaaccttga ccctcttgag atttcact 28 <210> 23 <211> 15 <212> DNA <213> synthesis <400> 23 ctccacagtc aagca 15 <210> 24 <211> 15 <212> DNA <213> synthesis <400> 24 gcctttggga tcagc 15 <210> 25 <211> 17 <212> DNA <213> synthesis <400> 25 caccactgct ctttccc 17 <210> 26 <211> 17 <212> DNA <213> synthesis <400> 26 agaaccttac cacccgc 17 <210> 27 <211> 17 <212> DNA <213> synthesis <400> 27 acatccggct atgggcc 17 <210> 28 <211> 18 <212> DNA <213> synthesis <400> 28 gcagtagcaa ttatcgtc 18 <210> 29 <211> 19 <212> DNA <213> synthesis <400> 29 cgtacacacc gcccgtcac 19 <210> 30 <211> 19 <212> DNA <213> synthesis <400> 30 cgtggactgc tacattgcc 19 <210> 31 <211> 19 <212> DNA <213> synthesis <400> 31 gtcatttcgg gagttagta 19 <210> 32 <211> 20 <212> DNA <213> synthesis <400> 32 cagtgctctc ctggacggcc 20 <210> 33 <211> 21 <212> DNA <213> synthesis <400> 33 tgcacgtggc ctaccggaga c 21 <210> 34 <211> 22 <212> DNA <213> synthesis <400> 34 ggattagata ccccactatg ct 22 <210> 35 <211> 23 <212> DNA <213> synthesis <400> 35 tctgtagata gagtatagca tca 23 <210> 36 <211> 23 <212> DNA <213> synthesis <400> 36 gatggggaag tagtgatcgt agc 23 <210> 37 <211> 25 <212> DNA <213> synthesis <400> 37 tgccagtgcc ctgactctgc tggtt 25 <210> 38 <211> 25 <212> DNA <213> synthesis <400> 38 acccctacgc atttatatag aggag 25 <210> 39 <211> 25 <212> DNA <213> synthesis <400> 39 aaaaaatgta tcaagtccac agtaa 25 <210> 40 <211> 26 <212> DNA <213> synthesis <400> 40 gggcacgctg cagacgatcc tggggg 26 <210> 41 <211> 27 <212> DNA <213> synthesis <400> 41 ccatgaagta ggtgaagatt ttcttct 27 <210> 42 <211> 20 <212> DNA <213> synthesis <400> 42 aaaggacaca ttctttttga 20

Claims

1. A method for preparing a hydrophilic-hydrophobic pattern on a substrate, comprising the steps of: S1, providing substrate; S2, treating the substrate selected in step S1 with ethanol, acetone or isopropanol, and washing and drying after the treatment; S3, hydrophilizing the substrate in step S2 and drying it; S4, evenly spin-coating a photoresist on the substrate obtained in step S3; S5, placing the photolithography mask on the substrate obtained in step S4, and then performing ultraviolet exposure, immersing the exposed substrate in a developer for development, and drying after completion; S6, subjecting the substrate obtained in S5 to a hydrophobic treatment, and then placing the substrate in a methanol, ethanol or acetone solvent to obtain a hydrophilic and hydrophobic pattern; The hydrophobic treatment is to dissolve a hydrophobic agent in an organic solvent to form a hydrophobic treatment agent, and then immerse the substrate in the hydrophobic treatment agent; after immersion, ultrasonically clean the substrate in a pure hydrophobic treatment agent, and then blow dry the substrate.

2. A method for preparing a hydrophilic and hydrophobic pattern on a substrate, comprising the steps of: S1, providing substrate; S2, treating the substrate selected in step S1 with ethanol, acetone or isopropanol, and washing and drying after the treatment; S3, hydrophilizing the substrate in step S2 and drying it; S4, subjecting the substrate obtained in S3 to a hydrophobic treatment; S4, evenly spin-coating a photoresist on the substrate obtained in step S4; S5, placing the photolithography mask on the substrate obtained in step S4, and then performing ultraviolet exposure, immersing the exposed substrate in a developer for development, and drying after completion; S6, placing the substrate obtained in S5 in a methanol, ethanol or acetone solvent to obtain a hydrophilic and hydrophobic pattern; The hydrophobic treatment is to dissolve a hydrophobic agent in an organic solvent to form a hydrophobic treatment agent, and then immerse the substrate in the hydrophobic treatment agent; after immersion, ultrasonically clean the substrate in a pure hydrophobic treatment agent, and then blow dry the substrate.

3. The method according to claim 1 or 2, characterized in that The hydrophobic agent is selected from long-chain alkyl silane or fluorine-containing silane.

4. The method according to claim 3, characterized in that The hydrophobic agent is selected from octadecyltrichlorosilane, hexadecyltrimethoxysilane or heptadecafluorodecyltrimethoxysilane.

5. The method according to claim 1 or 2, characterized in that: The organic solvent is selected from low polarity solvents.

6. The method according to claim 5, characterized in that The low polarity solvent is selected from dichloromethane, chloroform, ethylene dichloride, carbon tetrachloride or carbon disulfide.

7. The method according to claim 6, characterized in that The low polarity solvent is selected from dichloromethane, chloroform or dichloroethane.

8. The method according to claim 1 or 2, characterized in that: The substrate is selected from a material with a smooth surface, wherein the smoothness means that the surface roughness is Ra≤1um.

9. The method according to claim 8, characterized in that The substrate is selected from single crystal silicon, silicon wafer, stainless steel, glass, iron or plastic.

10. The method according to claim 9, characterized in that The substrate is single crystal silicon.

11. The method according to claim 1 or 2, characterized in that: The hydrophilization treatment is: treating the surface of the substrate with oxygen / air plasma or piranha solution; The surface of the substrate is treated with oxygen / air plasma for more than 1 second, and then immersed in pure water for more than 1 minute after the treatment; The piranha solution is a solution of concentrated sulfuric acid and hydrogen peroxide solution in a ratio of 3:1-7:1, and the treatment is performed for more than 1 minute.

12. Use of the substrate prepared by the method according to any one of claims 1 to 11 in nucleic acid mass spectrometry.

13. A chip for mass spectrometry, the chip comprising a matrix and a substrate prepared by the method according to any one of claims 1 to 11, the matrix comprising: Hydroxypicolinic acid and ammonium hydrogen citrate.

14. Use of a hydrophobic treatment reagent in treating a nucleic acid mass spectrometry substrate, characterized in that: The reagent comprises a long-chain alkylsilane or a fluorine-containing silane and an organic solvent, wherein the organic solvent is selected from dichloromethane, chloroform, dichloroethane, carbon tetrachloride or carbon disulfide; The substrate also has a photoresist on it.

15. The use according to claim 14, characterized in that The long-chain alkylsilane or fluorine-containing silane is selected from octadecyltrichlorosilane, hexadecyltrimethoxysilane or heptadecafluorodecyltrimethoxysilane.

Images