A uridine diphosphate nucleic acid aptamer and its screening method and application

Abstract

The present invention discloses a nucleic acid aptamer of uridine diphosphate and a screening method and application thereof, wherein the sequence of the nucleic acid aptamer is shown in SEQ ID NO: 1; the screening method is CIVT-SELEX, i.e., the Capture-SELEX method is first used for primary screening to obtain a single-stranded nucleic acid that can bind to a target ligand, and then the in vitro transcription process is used for screening again, thereby obtaining a nucleic acid aptamer that undergoes a significant conformational change after binding to the target ligand. The present invention successfully obtains a nucleic acid aptamer sequence that can detect uridine diphosphate in an enzymatic reaction solution in a single-stranded linear form, and can respond to different concentrations of uridine diphosphate during in vitro transcription to activate and regulate downstream gene transcription; CIVT-SELEX is expected to be applied to the screening of aptamer sequences of other target ligands, and can be used for detection and as a gene element in a gene circuit for regulation.

Description

Technical Field

[0001] The invention specifically relates to a uridine diphosphate nucleic acid aptamer and a screening method and application thereof, belonging to the technical field of molecular biology. Background Art

[0002] Aptamers are a class of single-stranded oligonucleotides with high affinity for ligands such as small molecules or macromolecules. Due to their advantages such as simple preparation, low cost, small size, and good versatility, they have broad application prospects in detection and treatment. Aptamers can not only be used as target detection objects, but also can be used to regulate gene expression, similar to transcription factors to respond to various small molecules and proteins. Therefore, aptamers have been widely used to regulate transcription or translation. As gene regulatory elements, aptamers provide several practical advantages: 1) SELEX screening of nucleic acid libraries to select aptamers for any ligand of interest; 2) nucleic acid domains can be predicted and rationally designed; 3) the ease and predictability of engineered nucleic acid domains enable aptamers to be used as target binding substrates for tunable sensing and actuation.

[0003] Aptamers can be obtained through an iterative in vitro selection process called SELEX (systematic evolution of ligands by exponential enrichment). Compared with macromolecular aptamers, the selection of small molecule aptamers is more difficult due to the large size difference between aptamers and targets and the few binding sites on the target. Although aptamers with high affinity to ligands can be selected using the traditional SELEX method, it is not easy to obtain aptamers with conformational changes when the ligand binds. At present, most aptamer-based detection methods are based on structurally switched aptamers, which undergo large conformational changes in the presence of targets. In addition, aptamers have been widely used to regulate the transcription or translation of target genes, usually by combining aptamer-ligand interactions and subsequent conformational changes. Therefore, by inserting aptamers into gene circuits, the structural switching ability of aptamers can be used to construct synthetic biological switches, thereby greatly expanding the library of genetic regulatory elements. Therefore, it is both useful and challenging to develop a method that can specifically select aptamers that have conformational changes when binding to target ligands.

[0004] Scientists have developed a variety of new screening methods, such as CE-SELEX (capillary electrophoresis-SELEX), GO-SELEX (graphene oxide-SELEX), Capture-SELEX, etc.

[0005] CN201410390057.7 discloses a method for screening nucleic acid aptamers that specifically bind to alpha-fetoprotein by combining capillary electrophoresis technology with SELEX technology.

[0006] CN201710055516.X discloses a method for screening nucleic acid aptamers specific to GPC3 by combining capillary electrophoresis technology with SELEX technology.

[0007] CN202010401091.5 discloses a method for screening nucleic acid aptamers of sulfamethoxazole using non-fixed GO-SELEX technology.

[0008] CN201610646875.8 discloses a method for screening nucleic acid aptamers of human pancreatic polypeptide using GO-SELEX technology.

[0009] CN201710168491.4 discloses a method for directed screening of broad-spectrum nucleic acid aptamers of lipopolysaccharides that can recognize a variety of different Gram-negative bacterial sources using Capture-SELEX technology.

[0010] CN202010875370.5 discloses a method for in vitro screening of DNA nucleic acid aptamers for PD-L1 and its application, three technical modules, each of which adopts a SELEX technology.

[0011] SELEX technology is widely used, but due to the huge size difference between small molecule targets and oligonucleotides, it is still challenging to find high-affinity, selective DNA aptamers for small molecules. Most small molecule nucleic acid aptamers obtained by the above screening methods do not undergo significant conformational changes upon target binding; small molecules tend to simply bind to the stem-loop region of nucleic acid aptamers without affecting their conformation.

[0012] The glycosylation reaction catalyzed by glycosyltransferases (GTs) is a key step in the modification of glycoside compounds and is of great significance for the biosynthesis of plant glycoside natural products. However, only a few glycosyltransferases have been studied and their functions have been annotated. The main reason is that the heterologous expression and purification of glycosyltransferases using microbial cells is cumbersome and time-consuming, and the identification of enzyme catalytic activity usually requires expensive instruments and complex operations. In the glycosylation reaction, UDP-glucose glycosyltransferases (UGTs) transfer glucose from the sugar donor UDP-glucose to the catalytic substrate to produce UDP.

[0013] Some scholars used immobilized enzymes to prepare UDP-glucose, then used double enzyme coupling to synthesize UDP-glucuronic acid, and finally performed glycosylation modification of quercetin. UDP-glucose and UDP-glucuronic acid were prepared using bioenzymatic methods.

[0014] CN201810162561.X uses a mixed fermentation method of brewer's yeast to prepare uridine diphosphate.

[0015] Uridine diphosphate glycosyltransferase (UGT) catalyzes a wide variety of substrates, and the activity of the products varies greatly. The glycosylation reaction catalyzed by it plays a very important role in the growth, development and metabolic regulation of plants and humans. Yu Antong and other scholars focused on summarizing the functions of UGT from four aspects: UGT's participation in plant secondary metabolism, hormone regulation, stress response and detoxification reaction. At the same time, they affirmed the role and application prospects of UGT in regulating crop agronomic traits.

[0016] Uridine diphosphate glucuronosyltransferase (UGTs) is an important phase II metabolic enzyme in the body. It is highly expressed in the liver and plays an important role in the metabolism and clearance of substances. Xue Qingkai and other scholars summarized that the transcriptional regulation of UGTs by the body under liver disease conditions plays an important role in the occurrence and development of the disease. The expression and transcriptional regulation in liver disease are of great significance for disease diagnosis and treatment.

[0017] It is not easy to screen UDP-glycosyltransferase or its genetic isoforms. There are methods using nucleic acid detection and methods using UDP-glycosyltransferase.

[0018] CN201210347972.9 discloses a kit for qualitatively detecting uridine diphosphate glucuronosyltransferase 1A1 genotyping through in vitro nucleic acid detection.

[0019] Song Fajun and other scholars used bioinformatics tools and qRT-PCR technology to analyze the gene structure, systematic evolution, gene expression characteristics, protein physicochemical properties and protein structure of uridine diphosphate glycosyltransferases (UGTs) in the transcriptome database of Polygonum multiflorum.

[0020] Some scholars used high performance liquid chromatography to analyze the content of uridine diphosphate. CN201410120185.X disclosed a functional detection of the uridine diphosphate glucuronide decarboxylase gene, which used the recombinant plasmid of the uridine diphosphate glucuronide decarboxylase (UXS6) gene and the expression vector pEGX-4T-2 and introduced it into bacteria for prokaryotic expression.

[0021] Zhou Nan and other scholars conducted in-depth research on the regulatory network of UDP-glucuronosyltransferase and the related Chinese medicine-drug interactions mediated by it, providing guidance for the safer and more effective use of Chinese medicine in clinical practice.

[0022] The above methods have the problems of rigid application, high cost and low efficiency in screening aptamers of UDP and detecting UDP levels. The existing method Capture-SELEX can provide aptamers that can bind to UDP, but there may be false positive binding aptamers. Therefore, there is an urgent need for a DNA aptamer of UDP that is easy to synthesize, has strong specificity, and can undergo significant conformational changes after binding, as well as a low false positive, low-cost and efficient screening method for obtaining the aptamer.

[0023] The present invention discloses a new method called CIVT-SELEX, which combines Capture-SELEX with in vitro transcription screening to find DNA aptamers that can not only bind to ligands but also show significant conformational changes when binding. With the addition of in vitro transcription screening, only aptamers that can bind to ligands, undergo significant conformational changes, and affect downstream gene transcription will be screened out. Thus, bifunctional aptamers that can truly respond to UDP (aptamers can respond in both single-stranded and double-stranded states) are further screened out. Summary of the invention

[0024] In order to solve the problems existing in the prior art, the present invention provides a nucleic acid aptamer that can respond to uridine diphosphate in a gene circuit of an in vitro transcription system, and a screening method and application thereof. Using the in vitro transcription system as a medium, the aptamer sequence that can detect the presence of uridine diphosphate in an enzymatic reaction solution in a single-stranded state and can respond to the presence of uridine diphosphate in the system in the gene circuit, undergo significant conformational changes, and regulate the transcription process is screened. The aptamer is a bifunctional aptamer that can truly respond to uridine diphosphate (the aptamer can respond in both single-stranded and double-stranded states).

[0025] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0026] One of the purposes of the present invention is to provide a uridine diphosphate nucleic acid aptamer, the sequence of the nucleic acid aptamer is shown in SEQ ID NO: 1:

[0027] SEQ ID NO: 1:

[0028] AGGGCTATGAGCCCTGCGCCGACGTCAGGCGCACCGAGAC

[0029] The nucleic acid aptamer provided by the present invention also includes a mutant or a truncated sequence or an extended sequence of the sequence shown in SEQ ID NO: 1.

[0030] Furthermore, the 5' end or 3' end of the nucleic acid aptamer is chemically modified with FITC, amino, biotin or digoxigenin.

[0031] The second object of the present invention is to provide a screening method for UDP-nucleotide aptamers, CIVT-SELEX, which is based on the combination of the Capture-SELEX screening method of nucleic acid aptamers and the screening process of in vitro transcription.

[0032] Furthermore, the screening method comprises the following steps:

[0033] S1: Preparation of screening library: Prepare a random ssDNA library with the following sequence:

[0034] 5'-GCAACTCCTAGATGGTCTCAAACG-N40-GGACTAGATTCTA-N10-AAAAATGTGAGACCAAAGGAGAATAA-3'

[0035] S2: Complementary pairing of the ssDNA library with the single-stranded DNA Capture-Oligo labeled with biotin at the 3' end to form partial double-stranded DNA;

[0036] S3: Incubate the partial double-stranded DNA obtained in S2 with streptavidin magnetic beads overnight, so that the ssDNA library is fixed on the streptavidin magnetic beads with DNA Capture-Oligo as the medium, and wash away the ssDNA sequences that cannot be fixed to obtain the magnetic bead-CO-ssDNA Library complex;

[0037] S4: incubating the magnetic bead-CO-ssDNA Library complex obtained in S3 with the target ligand uridine diphosphate to compete with the ssDNA aptamer sequence with specific affinity to obtain an incubation mixture;

[0038] S5: Magnetic separation of the incubation mixture after S4, collecting the eluted ssDNA aptamer sequence that specifically binds to human uridine diphosphate, i.e., the ssDNA enriched library, and continuously reducing the target ligand concentration in the subsequent screening process to increase the screening pressure;

[0039] S6: Perform PCR amplification on the ssDNA enriched library obtained in S5, wherein the primers used for PCR amplification are:

[0040] Primer P1: 5′-GCAACTCCTAGATGGTCTCA-3′;

[0041] Primer P2: 5′-AGTGAAAAGTTATTCTCCTTTGGTCTC-3′;

[0042] S7: The enriched phosphorylation-labeled dsDNA library obtained by S6 amplification was digested with Lambda Exonuclease in a 37°C water bath for 30 min to obtain a ssDNA library, and after ethanol precipitation, a secondary ssDNA library for the next round of screening was obtained;

[0043] S8: cyclic screening: the secondary ssDNA library obtained in S7 is used as the secondary library for the next round of screening, and the screening process of S2 to S7 is repeated to complete the forward screening and obtain the ssDNA library after the forward screening is completed;

[0044] S9: After the forward screening, the ssDNA library is screened during in vitro transcription.

[0045] Furthermore, the steps of screening the in vitro transcription process of S9 are as follows:

[0046] S9.1: After the positive screening, the ssDNA library is amplified into a dsDNA library by PCR, and the vector carrying the promoter, output signal and terminator is connected to the dsDNA library using the Golden Gate Assembly method to obtain a connection product;

[0047] S9.2: Transform, plate, pick, perform colony PCR and gel electrophoresis verification on the ligation product with dsDNA library inserted in S9.1, select the correct insertion band, recover the corresponding linear DNA product after colony PCR and number it;

[0048] S9.3: All the recovered linear DNA containing promoter, aptamer sequence, output signal and terminator are transcribed in an in vitro transcription system with or without target uridine diphosphate, and the changes in the output signal are observed to select the aptamer sequence that can respond to the target ligand and affect the transcription of downstream genes.

[0049] The third object of the present invention is to apply the nucleic acid aptamer of uridine diphosphate to the recognition, analysis and detection of uridine diphosphate, or to apply it to the gene circuit to regulate the transcription level of downstream genes in response to uridine diphosphate.

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] 1. The nucleic acid aptamer provided by the present invention is non-toxic, has a small molecular weight, and is easy to synthesize and label;

[0052] 2. The nucleic acid aptamer provided by the present invention has strong specificity, can bind to the ligand, undergo significant conformational changes, and affect the transcription of downstream genes. It is a truly bifunctional aptamer that responds to UDP (the aptamer can respond in both single-stranded and double-stranded conditions), and can be used to identify, analyze and detect uridine diphosphate, or be used in gene circuits to respond to uridine diphosphate to regulate the transcription level of downstream genes;

[0053] 3. The synthesis cost of the nucleic acid aptamer provided by the present invention is low, the cycle is short, the reproducibility is good, and there is no false positive;

[0054] 4. The nucleic acid aptamer provided by the present invention can be used as a biological detector for rapid screening of glycosyltransferases in plants, and can also be used to screen other enzymes that do not require post-translational modification. Compared with the traditional protein heterologous expression technology, the established enzyme screening method skips the time-consuming and labor-intensive steps of the traditional method, greatly shortens the experimental cycle, and can quickly realize the screening and identification of new enzymes within 24 hours. This methodology can also be applied to other enzymes and organisms, becoming a powerful tool for efficient and rapid screening of new enzymes;

[0055] 5. The present invention discloses a new method named CIVT-SELEX, which combines the Capture-SELEX screening method and the in vitro transcription process screening. The obtained uridine diphosphate nucleic acid aptamer not only ensures the specific and conformational binding with the target ligand, but is also suitable for the regulation of transcription levels in gene circuits, providing a new method and idea for screening other target aptamers and ligand combinations for gene circuit regulation.

[0056] 6. The aptamers that can bind to the ligand screened by Capture-SELEX may contain false positive binding aptamers, which are suitable for detection in the case of single chains, but not suitable for in vivo detection and circuit regulation; while the screening method of CIVT-SELEX disclosed in the present invention combines in vitro transcription screening on the basis of Capture-SELEX, which can be used for in vitro small molecule detection and gene circuit regulation. It has broad application prospects and important scientific, social and economic value in the fields of nucleic acid aptamers as gene elements. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 The bioinformatics simulation diagram of the spatial structure of the nucleic acid aptamer Aptamer 3-83 of the present invention;

[0058] Figure 2 This is a schematic diagram of the screening process of the nucleic acid aptamer Aptamer 3-83 of the present invention;

[0059] Figure 3When the nucleic acid aptamer Aptamer 3-83 of the present invention is inserted into the downstream of the pT7 promoter as a gene element and 3WJdB is used as a reporter gene, the obtained linear DNA responds to the real-time fluorescence changes of different concentrations of uridine diphosphate in an in vitro system;

[0060] Figure 4 When the nucleic acid aptamer Aptamer 3-83 of the present invention is inserted into the downstream of the pT7 promoter as a gene element and 3WJdB is used as a reporter gene, the obtained linear DNA responds to the change in fluorescence peak value before and after adding different uridine diphosphates in the in vitro system;

[0061] Figure 5 The CD spectrum of the nucleic acid aptamer Aptamer 3-83N40 sequence of the present invention;

[0062] Figure 6 Schematic diagram of isothermal titration calorimeter analysis of affinity of nucleic acid aptamer Aptamer 3-83 binding to uridine diphosphate in the present invention;

[0063] Figure 7 The detection results of the nucleic acid aptamer Aptamer 3-83 of the present invention as a biodetector for detecting uridine diphosphate in an enzymatic reaction solution: fluorescence scanning results of 5 groups of detection reactions;

[0064] Figure 8 The detection results of the nucleic acid aptamer Aptamer 3-83 of the present invention as a biodetector for detecting uridine diphosphate in an enzymatic reaction solution are as follows: the fluorescence difference at 525 nm between the experimental group and the negative group, F0: the fluorescence value of the negative group, F1: the fluorescence value of the experimental group. DETAILED DESCRIPTION

[0065] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0066] In order to better understand the present invention, the present invention is further described below by way of examples. The examples are only used to explain the present invention and do not constitute any limitation to the present invention.

[0067] The materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources. The quantitative tests in the following examples were repeated three times, and the results were averaged. The experimental methods in the following examples, unless otherwise specified, are conventional methods.

[0068] Example 1

[0069] like Figure 2 As shown, a method for screening aptamers of uridine diphosphate comprises the following steps:

[0070] S1: Preparation of screening library: Design a random ssDNA library with a fixed region of 13 nucleotides in the middle, 40 and 10 nucleotides in the random regions at both ends of the fixed part, and fixed primers at the 5' and 3' ends (5'-GCAACTCCTAGATGGTCTCAAACG-N40-GGACTAGATTCTA-N10-AAAAATGTGAGACCAAAGGAGAATAA-3', where N40 is 40 random bases and N10 is 10 random bases. There are more than 10 million different base sequence combinations of N40 and N10 in the synthetic library), and entrust Sangon Biotech Co., Ltd. to synthesize it, and synthesize it with biotin label at the same time;

[0071] S2: Forward screening: Determine the concentration of the synthesized initial ssDNA library and the single-stranded DNA Capture Oligo (CO) labeled with biotin at the 3' end. Use 200 μL streptavidin magnetic beads (1 mg magnetic beads can bind >400 pmol biotin-labeled Capture Oligo DNA) in each round of screening, which can bind approximately 320 pmol CO. Anneal the ssDNA library and CO in an equimolar ratio in a washing buffer (Washing Buffer: 5 mM Tris-HCl, 1 M NaCl, 0.5 mM EDTA) system; Annealing program: denaturation at 95°C, 10 min, -0.1°C per second, × 350 times, until 60°C, 5 min, and place at 4°C;

[0072] S3: Take 200 μL of magnetic beads and adsorb them on a magnetic stand to remove the supernatant. Repeat the washing of the magnetic beads three times with 200 μL of Washing Buffer. Incubate the annealed ssDNA Library-CO complex with the magnetic beads on a rotator at 35 rpm / min overnight to allow the ssDNA Library-CO complex to bind to the magnetic beads through the biotin label.

[0073] S4: Collect the supernatant of the mixture incubated overnight in S3 on a magnetic stand, and wash the magnetic bead mixture four times with 200 μL Washing Buffer, collecting the supernatant each time and numbering it;

[0074] S5: Add 100 μL of Binding Buffer (10 mM Tris-HCl, 100 mM NaCl, 1 mM MgCl) containing 4 mM UDP target ligand. 2) was added to the washed ssDNA Library-CO-magnetic bead complex, mixed and placed on a rotator at 35r / min, incubated at 25°C for 60min, the target ligand competitively binds to the aptamer sequence with affinity, so that it falls off the CO-magnetic beads and is placed on a magnetic stand for adsorption, the supernatant is collected, and then the same volume of the above-mentioned Binding Buffer containing the same concentration of ligand is used for elution and the supernatant is retained, repeated twice, and numbered elution 1 / 2 / 3 respectively (in the process of positive screening, the concentration of target ligand in the system is continuously reduced to 1mM to increase the screening pressure);

[0075] S6: Wash the magnetic beads with 100 μL SSC Buffer (20 mM Tris-HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, 100 mM NaCl), incubate at 95 °C for 10 min, and release the base complementary pairing between CO and the ssDNA Library that is not bound to the target ligand at high temperature. Repeat 3 times, and collect the supernatant each time and number it HOT1 / 2 / 3;

[0076] S7: RT-qPCR absolute quantitative calculation of elution rate to monitor the screening process. The ssDNA Library used in this round of screening was diluted to 2 ng / μL and used as the amplification template for the standard curve. A gradient dilution of 10-1 to 10-7 was performed. At the same time, the above-mentioned elution 1 / 2 / 3, HOT1 / 2 / 3 and the final magnetic beads were diluted to appropriate concentrations and RT-qPCR amplification was performed simultaneously. R was calculated according to the standard curve. 2 The values ​​and amplification efficiency were used to calculate the copy numbers of elution 1 / 2 / 3, HOT1 / 2 / 3 and the final magnetic beads, and then the elution rate was calculated by the formula: {(elution 1+elution 2+elution 3) copy number / (HOT1+HOT2+HOT3+final magnetic beads) copy number}×100%; 20μL amplification system: 10μL 2×SYBR qPCR SuperMix, 2μL each of primers P1 and P2, 1μL DNA template, and DEPC water was used to make up to 20μL; amplification program: 95℃ pre-denaturation for 1min, 95℃ denaturation for 20s, 58℃ annealing for 30s, reading data, 72℃ extension for 30s, and running for 39 cycles; melting curve program: 95℃ for 10s, 65℃→95℃ for 0.5℃ / 0.5s, reading data;

[0077] Among them, the RT-qPCR amplification primers are:

[0078] Primer P1: 5′-GCAACTCCTAGATGGTCTCA-3′;

[0079] Primer P2: 5′-TTATTCTCCTTTGGTCTCACA-3′;

[0080] S8: Mix 1 / 2 / 3 of the eluted target competitive binding in each round of screening evenly into a 1.5 mL centrifuge tube, add 3M sodium acetate solution (pH=5.2) with a volume of 1 / 10 of the mixed liquid, and then add anhydrous ethanol with a volume of 2.5 times the volume of the mixed liquid, mix all evenly, place in a -20°C refrigerator for 60 min, and then centrifuge in a refrigerated centrifuge at 12000 rpm and 4°C for 30 min to precipitate DNA, carefully remove the supernatant with a pipette, add 19 μL DEPC water to the centrifuge tube after the ethanol evaporates completely, shake it to completely dissolve the precipitated DNA in water, and amplify it using high-fidelity ExTaq enzyme;

[0081] The amplification primers are:

[0082] Primer P1: 5′-GCAACTCCTAGATGGTCTCA-3′;

[0083] Primer P2-5′P: 5′-TTATTCTCCTTTGGTCTCACA -3′;

[0084] The 50μL amplification system is: 19μL DEPC water + ssDNA template, 1μL dNTP Mixture, 25μL 2×BufferMix, 2μL each of primer P1 and primer P2-5'P, 1μL High-Fidelity DNA polymerase; the amplification program is: 95℃ pre-denaturation for 30s, 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 10s, running 8-10 cycles, and 72℃ final extension for 5min (note that due to the sequence diversity of the ssDNA library, in order to reduce nonspecific amplification, the number of amplification cycles should be kept at 8-10 cycles);

[0085] S9: The amplified product was precipitated again according to the above method to obtain a dsDNA library with a 5' phosphorylation label, dissolved with an appropriate amount of water and the concentration was determined. The dsDNA was digested with Lambda Exonuclease in a 37°C water bath for 30 minutes and then precipitated again with ethanol to obtain the ssDNA library, which was used for the next round of screening;

[0086] Among them, 50 μL enzyme digestion system includes: 5 μg dsDNA, 5 μL 10×Exonuclease Reaction Buffer, 1 μL Lambda Exonuclease, and DEPC water is used to make up to 50 μL;

[0087] S10: Screening was performed during the gene circuit transcription process of the in vitro transcription system; first, the ssDNA library after 6 rounds of preliminary screening was amplified into dsDNA with correct restriction sites and recognition sites, and then the library sequence was inserted into the vector fragment containing the backbone, promoter pT7, 3WJdB and terminator through the Golden Gate Assembly method to construct a complete circular ligation product, which was divided into 23 groups of transformation cloning bacteria E. coli DH5α competent cells.

[0088] S11: A total of 1023 single colonies were picked from 23 successfully transformed plates for Colony PCR. Agarose gel electrophoresis showed that the connection was successful and 932 complete linear DNAs for transcription with promoter pT7, dsDNA aptamer sequence, output signal 3WJdB and terminator could be amplified. The linear DNAs for transcription were recovered and the corresponding single colonies were saved.

[0089] S12: Prepare an in vitro transcription system. In the in vitro transcription system with or without target ligand, screen 932 linear DNAs with inserted aptamer sequences during transcription, observe the difference in fluorescence change of the output signal 3WJdB before and after the addition of uridine diphosphate, and screen out nucleic acid aptamers with significant output signal changes.

[0090] Example 2

[0091] The linear DNA for transcription corresponding to the nucleic acid aptamer (named Aptamer 3-83) with the most significant output signal change before adding uridine diphosphate was obtained by the screening method of Example 1, and Fuzhou Shangya Biotechnology Co., Ltd. was commissioned to sequence the nucleic acid aptamer Aptamer 3-83 sequence, as shown in SEQ ID NO: 1:

[0092] SEQ ID NO: 1:

[0093] AGGGCTATGAGCCCTGCGCCGACGTCAGGCGCACCGAGAC

[0094] DNAFold network platform was used to analyze the + , 1 mM Mg + Under the condition of , the spatial structure diagram of the nucleic acid aptamer Aptamer 3-83 sequence is as follows Figure 1 The 5' end or 3' end of the nucleic acid aptamer or its mutant or its truncated sequence or its extended sequence can be chemically modified by FITC, amino, biotin or digoxigenin.

[0095] Example 3

[0096] Verification of the nucleic acid aptamer Aptamer 3-83 as a detection tool for small molecule uridine diphosphate (UDP): The feasibility of using the nucleic acid aptamer Aptamer 3-83 as a verification biodetector to screen uridine diphosphate glycosyltransferase was verified.

[0097] Four different uridine diphosphate glycosyltransferases reported in the literature were selected for enzymatic reaction. 10 μL of the enzymatic reaction solution was incubated with 10 μL Aptamer 3-83 (10 μM), and then ExoI / ExoⅢ double digestion was performed to reduce the background signal and amplify the signal gap. Then, 10×SYBR Green I was added to the mixture at a final concentration of 10×. Finally, the detection system was fixed to 100 μL with 1×BindingBuffer, and fluorescence scanning was performed at an excitation wavelength of 380 nm and an emission wavelength range of 490 nm to 620 nm. The fluorescence scanning results are shown in the figure. Figure 7 and Figure 8 The UDP content in the enzymatic reaction solution of AT17050 was the highest, and there was almost no UDP in the enzymatic reaction solution of AR42458, while UDP was present in the enzymatic reaction solutions of AR14572 and AR43718. The experimental results showed that AT17050 had the highest activity, followed by AR14572 and AR43718.

[0098] Example 4

[0099] Verify the regulatory function of nucleic acid aptamer Aptamer 3-83 as a genetic element, and the robustness of the regulatory function of nucleic acid aptamer Aptamer3-83 as a genetic element.

[0100] The RNA aptamer 3WJdB was used as the reporter output. After successful transcription, it specifically combined with the small molecule DFHBI to emit fluorescence, thereby realizing the characterization of the regulatory effect of the nucleic acid aptamer Aptamer 3-83 as a gene element; the linear DNA for transcription obtained by purifying the product after colony PCR in Example 1: pT7-ligand Aptamer 3-83-3WJdB-T500 was selected, and the linear DNA for transcription was added to the in vitro transcription reaction system with a final concentration of 0, 10, 20, 30, and 40 nM, and the uridine diphosphate concentrations were 0, 200 μM, 400 μM, 600 μM, 800 μM, and 1 mM, respectively. The reaction was carried out at 37° C. for 3 hours, and the fluorescence at the excitation light of 472 nm and the emission light of 507 nm was monitored in real time by a multifunctional microplate reader to characterize the transcription level;

[0101] like Figure 3 and Figure 4The linear DNA for transcription corresponding to the aptamer Aptamer 3-83 shown in the figure can respond to the addition of the target ligand uridine diphosphate during the transcription process, and the fluorescence peak value increases significantly. The real-time fluorescence of the experimental group with uridine diphosphate added is always higher than that of the control group without uridine diphosphate, and this promotion effect is more obvious when the ligand concentration is increased. The insertion of the aptamer Aptamer 3-83 as a gene element in the gene circuit reduces downstream transcription compared with the control group, indicating that its sequence structure is relatively tight and transcription is significantly promoted only when the uridine diphosphate ligand is present. This may be because uridine diphosphate binds to the tight aptamer sequence to make its structure loose, causing RNA polymerase to proceed downstream more smoothly, thereby showing promotion and regulation of the transcription process.

[0102] Example 5

[0103] The circular dichroism characterization of the nucleic acid aptamer Aptamer 3-83 and the target ligand uridine diphosphate and the affinity characterization of the nucleic acid aptamer Aptamer 3-83 and the target ligand uridine diphosphate were carried out respectively.

[0104] The specific operation of circular dichroism characterization of nucleic acid aptamer Aptamer 3-83 and target ligand uridine diphosphate is as follows:

[0105] 1×Binding Buffer was used to prepare 50μM uridine diphosphate, 5μM aptamer 3-83ssDNA and a mixture of the two with the same concentration, with a total volume of 200μL. The groups containing ssDNA were incubated at 95℃ for 10min before adding ligands, and then immediately placed on ice to denature ssDNA and reduce its secondary structure. The target ligand was added and incubated for 1h before scanning; the circular dichroism spectrometer parameters were set as follows: nitrogen flow rate 4-5L / min, scanning wavelength 210nm-320nm, scanning speed 50nm / min, bandwidth 1nm, and the accumulated 3 scanning data were averaged. The circular dichroism CD spectrum was obtained ( Figure 5 ).

[0106] The affinity characterization of nucleic acid aptamer Aptamer 3-83 and target ligand uridine diphosphate is as follows:

[0107] The ITC experiment of UDP-binding nucleic acid aptamer was carried out using Nano ITC isothermal titration calorimeter of Waters Company. At 25°C, in each experiment, 1500 μL of 20 μM nucleic acid aptamer candidate was heated at 95°C for 10 min in 1×Binding Buffer and immediately cooled on ice. 100 μL of 1×Binding Buffer containing 20 mM UDP- was loaded into the syringe; each time the injection titration was performed with a volume of 2 μL, 25 consecutive injections were performed, with an interval of 300 s and a rotation speed of 300 rpm.

[0108] like Figure 5 As shown, no obvious CD signal was observed when 1×Binding buffer contained 50μM UDP, indicating that the subsequent verification experiments would not be affected under this condition. The structure of Aptamer 3-83 showed a negative peak (250nm) and a positive peak (280nm) in 1×Binding buffer, which is a typical DNA A-type double-stranded structure. When UDP is present, the CD signal of Aptamer 3-83 detectable at 250nm is upregulated, and the CD signal detectable at 280nm is downregulated. This indicates that in the presence of UDP, the A-type double-stranded structure of Aptamer 3-83 itself becomes weaker, so there is an upregulation of the CD spectrum at 250nm and a downregulation at 280nm. This result confirms that the presence of UDP makes the A-type double-stranded structure of Aptamer 3-83 loose.

[0109] like Figure 6 As shown, there is a certain affinity between Aptamer 3-83 and UDP. The data collected in the ITC experiment were analyzed using Launch NanoAnalyze software, and the independent model was used for data fitting, and its Kd = 274.8μM.

[0110] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A uridine diphosphate nucleic acid aptamer, characterized in that: The sequence of the nucleic acid aptamer is SEQ ID NO: 1: AGGGCTATGAGCCCTGCGCCGACGTCAGGCGCACCGAGAC.

2. A UDP-nucleic acid aptamer according to claim 1, characterized in that: The 5' end or 3' end of the nucleic acid aptamer is chemically modified by FITC, amino, biotin or digoxigenin.

3. A method for screening UDP-nucleic acid aptamers, for screening the nucleic acid aptamer according to claim 1, characterized in that: The steps include: S1: Preparation of screening library: Prepare a random ssDNA library with the following sequence: 5'-GCAACTCCTAGATGGTCTCAAACG-N40-GGACTAGATTCTA-N10-AAAAATGTGAGACCAAAGGAGAATAA-3' S2: Complementary pairing of the ssDNA library with the single-stranded DNA Capture-Oligo labeled with biotin at the 3' end to form partial double-stranded DNA; S3: Incubate the partial double-stranded DNA obtained in S2 with streptavidin magnetic beads overnight, so that the ssDNA library is fixed on the streptavidin magnetic beads with DNA Capture-Oligo as the medium, and wash away the ssDNA sequences that cannot be fixed to obtain the magnetic bead-CO-ssDNA Library complex; S4: incubating the magnetic bead-CO-ssDNA Library complex obtained in S3 with the target ligand uridine diphosphate to compete with the ssDNA aptamer sequence with specific affinity to obtain an incubation mixture; S5: Magnetic separation of the incubation mixture after S4, collecting the eluted ssDNA aptamer sequence that specifically binds to human uridine diphosphate, i.e., the ssDNA enriched library, and continuously reducing the target ligand concentration in the subsequent screening process to increase the screening pressure; S6: Perform PCR amplification on the ssDNA enriched library obtained in S5, wherein the primers used for PCR amplification are: Primer P1: 5′-GCAACTCCTAGATGGTCTCA-3′; Primer P2: 5′-AGTGAAAAGTTATTCTCCTTTGGTCTC-3′; S7: The enriched phosphorylation-labeled dsDNA library obtained by S6 amplification was digested with Lambda Exonuclease in a 37°C water bath for 30 min to obtain a ssDNA library, and after ethanol precipitation, a secondary ssDNA library for the next round of screening was obtained; S8: cyclic screening: the secondary ssDNA library obtained in S7 is used as the secondary library for the next round of screening, and the screening process of S2 to S7 is repeated to complete the forward screening and obtain the ssDNA library after the forward screening is completed; S9: After the positive screening, the ssDNA library is screened by in vitro transcription process, and the steps include: S9.1: After the positive screening, the ssDNA library is amplified into a dsDNA library by PCR, and the vector carrying the promoter, output signal and terminator is connected to the dsDNA library using the Golden Gate Assembly method to obtain a connection product; S9.2: Transform, plate, pick, perform colony PCR and gel electrophoresis verification on the ligation product with dsDNA library inserted in S9.1, select the correct insertion band, recover the corresponding linear DNA product after colony PCR and number it; S9.3: All the recovered linear DNA containing promoter, aptamer sequence, output signal and terminator are transcribed in an in vitro transcription system with or without target uridine diphosphate, and the changes in the output signal are observed to select the aptamer sequence that can respond to the target ligand and affect the transcription of downstream genes.

4. A method for using a UDP-nucleic acid aptamer according to claim 1 for non-disease diagnosis or treatment purposes in identifying, analyzing and detecting UDP-nucleic acid.

5. A UDP-nucleic acid aptamer according to claim 1, used in a gene circuit to respond to the UDP-level in the environment for non-disease diagnosis or treatment purposes.

Images