A genetically modified Trichoderma reesei engineered strain and its preparation method and application

Abstract

The invention relates to a genetically modified Trichoderma reesei engineering strain and a preparation method and application thereof. Conventional Trichoderma reesei is used as a starting strain, endogenous rce1 is knocked out through genetic modification, bgl1B from Aspergillus niger is overexpressed, and a genetically engineered bacterium TR-HH01 is obtained. When an enzyme liquid obtained by fermenting the conventional Trichoderma reesei is used to enzymolyze a straw substrate, higher glucose components, xylose components and enzymolysis total sugars can be obtained, and cellobiose components are significantly reduced, indicating that after genetic modification, the engineering strain TR-HH01 can be induced to produce higher cellulase, xylanase, and β-glucosidase components in the cellulase, so that there is no need to add exogenous β-glucosidase, thereby greatly reducing the cost of industrial application of cellulase.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology, and specifically relates to the transformation of genetic material of microorganisms, specifically the genetic engineering transformation of the fungus Trichoderma reesei. Background Art

[0002] As the shortage of petrochemical raw materials and environmental pollution become increasingly severe, the demand for green and environmentally friendly new energy and new materials is becoming increasingly urgent. As the only renewable and recyclable raw material, biomass has an irreplaceable position in the industrial development of replacing petroleum to produce new materials. Plant lignocellulosic materials, such as abandoned crop straw, are the most abundant source of biomass raw materials, with China alone producing hundreds of millions of tons annually. After pretreatment and cellulase degradation, the monosaccharides converted from cellulose and hemicellulose can be fermented into small molecule products such as lactic acid, which can then be synthesized into material products such as polylactic acid, which is degradable plastic. Such a new material biorefining industry can meet urgent market needs and solve environmental problems caused by petrochemical refining, such as "white pollution."

[0003] In the process of utilizing lignocellulose, the degradation and saccharification of cellulase is a key step. However, the current production cost of cellulase is high and the price is expensive. It cannot meet the production and profit needs of the development of the biorefining industry, and has become an important bottleneck for the industrialization of new biomass materials. Trichoderma reesei RUT-C30 is the most widely used cellulase producer today. At present, the research and development of the process of producing cellulase by Trichoderma reesei is relatively mature. To further improve the enzymatic activity and yield of cellulase, it is necessary to start from the perspective of optimizing the source strain, use synthetic biology raw materials and advanced technologies such as gene editing, and design and genetically modify Trichoderma reesei engineered strains with stronger cellulase production capabilities.

[0004] The cellulase components induced by Trichoderma reesei include exoglucanase, endoglucanase and β-glucosidase. In the process of cellulase degradation of cellulose, exoenzymes and endoenzymes synergistically degrade cellulose into cellooligosaccharides (mainly cellobiose), and then β-glucosidase degrades cellobiose into the final product glucose for the production of downstream new energy and new materials. The three enzyme components are controlled by different genes, respectively, of which the enzymes encoded by the exoenzyme genes account for 95% of the entire cellulase system, while the enzymes encoded by the β-glucosidase genes are less than 5%. The lack of β-glucosidase seriously restricts the degradation of cellulose. At present, the deficiency in the enzyme system is compensated by the additional supplementation of β-enzyme, but this not only increases the cost of enzymolysis, but also increases the complexity of manual operation. Therefore, it is necessary to improve the expression level of β-glucosidase and optimize the enzyme system composition of Trichoderma reesei to produce cellulase. Summary of the invention

[0005] In order to overcome the above-mentioned defects in the prior art, the present invention clones bgl1B derived from Aspergillus niger, constructs an overexpression vector of the gene, and overexpresses it in Trichoderma reesei, making up for the insufficient β-glucosidase produced by Trichoderma reesei and the imperfect cellulose complex enzyme system. In addition, the present invention constructs a CRISPR-Cas9 knockout vector of rce1, a transcriptional inhibitor of cellulase-related genes, for Trichoderma reesei. The rce1 gene is successfully knocked out by the vector, and the expression level of cellulase-related genes is further improved. The inhibitory effect of the rce1 gene on the expression level of cellulase genes is verified, and its possibility as a negative transcriptional regulatory factor is confirmed. Finally, the present invention screens out the double-modified Trichoderma reesei engineering strain, and performs targeted process optimization on it from the perspective of the process of producing cellulase, further improving the ability of the engineering strain to produce cellulase, and providing an excellent engineering strain for the industrial production of cellulase from a microscopic and macroscopic perspective. The following technical solutions are provided:

[0006] The first aspect of the present invention is to provide a method for genetically modifying Trichoderma reesei, wherein the method is to knock out the expression of the endogenous gene rce1 and overexpress exogenous bgl1B. Preferably, the Trichoderma reesei is RUT-C30; preferably, the exogenous bgl1B is derived from Aspergillus niger, and preferably, the coding sequence of bgl1B is shown in SEQ ID NO: 1. Preferably, the method for knocking out the expression of the endogenous gene rce1 includes but is not limited to homologous recombination, RNA interference, ZFN, TALENs, CRISPR-Cas9. Preferably, the gene editing adopts the CRISPR-Cas9 system, wherein the sequence of sgRNA is shown in SEQ ID NO: 2; more preferably, the CRISPR-Cas9 system is to clone the Cas9 expression frame and sgRNA into the same expression plasmid to transform the host cell; more preferably, the plasmid also includes a promoter, a resistance gene fragment, and a terminator element; wherein the sgRNA sequence-related elements are obtained by connecting in the following manner: HH ribozyme-gRNA-rce1 (RUT-C30)-sgRNA_backbone-HDV ribozyme fragment is obtained by a base synthesis method, wherein the HH ribozyme sequence is shown in SEQ ID NO: 3; the sgRNA_backbone sequence is shown in SEQ ID NO: 4; the HDV ribozyme sequence is shown in SEQ ID NO: 5.

[0007] In another preferred embodiment, the method further comprises detecting genes related to genetically modified Trichoderma reesei, wherein the related genes include endogenous rce1 and exogenous bgl1B, and strains with successful knockout of rce1 gene and successful transformation of bgl1B are selected as candidate strains for enzyme activity detection.

[0008] In another preferred embodiment, the method further comprises using RT-QPCR method to determine the expression levels of related genes: exonuclease gene cbh1, endonuclease gene egl1, and β-glucosidase gene bgl1, and finally obtaining an engineered strain with the highest filter paper enzyme activity and the highest enzyme gene expression level.

[0009] The second aspect of the present invention provides a genetically engineered bacterium produced by the method described in the first aspect.

[0010] The third aspect of the present invention provides the use of the genetically engineered bacteria described in the second aspect in the fermentation production of cellulase. In a specific embodiment, the conditions for the fermentation production of cellulase include culturing seeds for 25 to 35 hours, a transplanting amount of 10 to 15%, and an initial pH of 5 to 6. In a preferred embodiment, the fermentation is an industrial production fermentation, and the volume of the fermentation tank is 200L to 500L.

[0011] The beneficial effects of the present invention are:

[0012] 1) Using conventional Trichoderma reesei as the starting strain, the genetically engineered strain TR-HH01 was obtained by knocking out the endogenous rce1 through genetic engineering and overexpressing bgl1B from Aspergillus niger. When the enzyme liquid obtained by fermentation was used to hydrolyze the straw substrate, higher glucose components, xylose components and total enzymatic sugars were obtained, and the cellobiose component was significantly reduced, indicating that after genetic modification, the engineered strain TR-HH01 can be induced to produce higher cellulase, xylanase, and β-glucosidase components in cellulase, so that there is no need to add additional exogenous β-glucosidase, which greatly reduces the cost of industrial application of cellulase.

[0013] 2) The engineered strain TR-HH01 was scaled up and verified in a 300 L fermenter under the optimal fermentation conditions. The engineered strain and fermentation process developed in the present invention have obvious advantages and can provide good support for the industrial production of cellulase. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the structure of plasmid pBARGPE1-bgl1B;

[0015] Figure 2 Schematic diagram of the structure of plasmid pCRISPR-rce1;

[0016] Figure 3 pBARGPE1-bgl1B was transformed into Trichoderma reesei RUT-C30 strain for PCR verification results;

[0017] Figure 4 PCR verification results of pCRISPR-rce1 transformed Trichoderma reesei RUT-30 strain;

[0018] Figure 5 PCR was used to verify whether the rce1 gene was successfully knocked out;

[0019] Figure 6 Filter paper enzyme activity bar graph under different fermentation conditions;

[0020] Figure 7 Enzyme production of TR-HH01 strain in industrial fermentation. DETAILED DESCRIPTION

[0021] The purposes and functions of the present invention and methods for achieving these purposes and functions will be explained below with reference to exemplary embodiments. However, the present invention is not limited to the exemplary embodiments disclosed below; it can be implemented in different forms. The essence of the description is only to help those skilled in the relevant art to comprehensively understand the specific details of the present invention.

[0022] Example 1 Construction of overexpression vector pBARGPE1-bgl1B

[0023] The Ppdc promoter sequence (1534 bp) and the Tpdc terminator sequence (1030 bp) were derived from Trichoderma reesei, and the bgl1B gene (Gene ID: 4980363) was derived from Aspergillus niger, and the sequence was shown in SEQ ID NO: 1. The above fragments were cloned by PCR technology and constructed into the backbone vector pBARGPE1 (purchased from addgene) to obtain the bgl1B overexpression plasmid pBARGPE1-bgl1B. The full sequence of the plasmid is 8952 bp. The structural schematic diagram of the plasmid is shown in Figure 1 shown.

[0024] Example 2 Construction of CRISPR-Cas9 gene knockout vector pCRISPR-rce1

[0025] 1. Design of sgRNA sequence for rce1 gene

[0026] The rce1 gene sequence was obtained from NCBI, and the CDS region (Sequence coding for aminoacidsin protein, which is a sequence encoding a protein product) was marked. http: / / grna.ctegd.uga.edu / The website designs sgRNA for the first CDS region of the rce1 gene. The sgRNA sequence designed by the present invention is: tgggtgagtgcacctgatgatgg (SEQ ID NO: 2), marked as gRNA-rce1 (RUT-C30).

[0027] 2. Construction of CRISPR-Cas9 gene knockout vector for rce1

[0028] Resistance screening fragments were obtained: gpda promoter fragment (gpda promoter, 2129 bp), hygromycin resistance gene fragment (hph, 1144 bp), and trpC terminator fragment (trpC terminator, 764 bp) were derived from pAN7-1 plasmid (purchased from addgene). The gpda promoter-hph-trpC terminator fragment was cloned and assembled by PCR and Gibson Assembly technology for use.

[0029] Cas9 expression cassette fragments were obtained: ptef promoter fragment (ptef promoter, 886 bp), Cas9 fragment (4104 bp), and ptef terminator fragment (ptef terminator, 489 bp) were derived from plasmid pFC334 (purchased from addgene), and the above fragments were cloned and assembled by PCR and Gibson Assembly technology.

[0030] Assembly of sgRNA-related sequence elements: The HH ribozyme-gRNA-rce1 (RUT-C30)-sgRNA_backbone-HDV ribozyme fragment was obtained by base synthesis, wherein the HH ribozyme sequence is shown in SEQ ID NO: 3; the sgRNA_backbone sequence is shown in SEQ ID NO: 4; and the HDV ribozyme sequence is shown in SEQ ID NO: 5. In addition, the inherent fragments on the plasmid (such as AmpR, ori and other fragments) were also obtained by conventional molecular cloning techniques. Finally, the above-mentioned fragments were connected together by enzyme ligation to obtain the CRISPR-Cas9 gene knockout vector pCRISPR-rce1 of the rce1 gene. The full sequence of the plasmid is 11762bp ( Figure 2 ).

[0031] The above plasmids were extracted using the plasmid extraction kit (spin column type, DPP103-02) of Tiangen Biochemical Technology Co., Ltd. for subsequent transformation.

[0032] Example 3 Plasmid transformation host and screening

[0033] 1. Transformation of Trichoderma reesei RUT-C30 strain with vector pBARGPE1-bgl1B

[0034] 1) Transformation: The vector pBARGPE1-bgl1B constructed in step 2.1 was transformed into the Trichoderma reesei RUT-C30 strain (conventional step), and spread on a resistance screening medium. The resistance screening marker was bleomycin (blpR, working concentration 100 ug / ml).

[0035] Among them, the above resistance screening medium formula is: 1M D-sorbitol, 20g / L glucose, 15g / L KH2PO4, 5g / L(NH4)2SO4, 0.6g / L MgSO4·7H2O, 0.6g / L CaCl2, 0.005g / LFeSO4·7H2O, 0.0016g / LMnSO4·H2O, 0.0014g / L ZnSO4·7H2O, 0.002g / L CoCl2, and 20g / L agar powder.

[0036] Sterilize in a high-pressure steam autoclave (121°C, 25 min); wait until the temperature cools to 45-50°C (not too hot to touch), add bleomycin (blpR, working concentration 100ug / ml) and ampicillin (final concentration 100μg / mL) in an ultra-clean workbench, then pour into a plastic culture dish and cool for use.

[0037] 2) Propagation: The monoclonal transformants grown on the resistance screening medium were picked up with a sterile toothpick and transferred to Trichoderma agar medium without hygromycin for propagation. After 7 days of growth, 10 mL of sterile water was added and the spore suspension was scraped and stored in a 4°C refrigerator for later use.

[0038] The above Trichoderma agar medium formula is: 10g / L glucose, 2g / L corn steep liquor, 2.8g / LKH2PO4, 3.92g / L(NH4)2SO4, 0.84g / L MgSO4·7H2O, 0.84g / L urea, 2g / L Tween-80, 0.014g / L FeSO4·7H2O, 0.00436g / L MnSO4·H2O, 0.00392g / LZnSO4·7H2O, 0.0056g / L CoCl2, 20g / L agar; after preparation, adjust the pH to 4.8 with 2M NaOH solution.

[0039] Sterilize in a high-pressure steam autoclave (121°C, 25 min); wait until the temperature cools to 45-50°C (not too hot to touch), add ampicillin (final concentration 100 μg / mL) in an ultra-clean workbench, and then pour into a plastic culture dish to cool for use.

[0040] 3) Trichoderma strain culture: The spore suspension of the transformant and Trichoderma reesei RUT-C30 strain was inoculated into a Trichoderma strain culture medium (100 mL) at a spore inoculation amount of 10^9 cell / L. After the inoculation, overnight culture was completed to obtain the hyphae of the transformant.

[0041] The culture medium formula of the above Trichoderma species is: 12g / L glucose, 0.7g / L corn steep liquor, 1.96g / LKH2PO4, 1.372g / L(NH4)2SO4, 0.294g / L MgSO4·7H2O, 0.294g / L urea, 0.0049g / L FeSO4·7H2O, 0.0015g / L MnSO4·H2O, 0.0014g / L ZnSO4·7H2O, 0.002g / LCoCl2.

[0042] Sterilize in a high-pressure steam autoclave (121°C, 25 min); wait until the temperature cools to 45-50°C (not too hot to touch), add ampicillin (final concentration 100 μg / mL) in an ultra-clean workbench, and then pour into a plastic culture dish to cool for use.

[0043] DNA extraction: The DNA of Trichoderma mycelium cultured overnight was extracted using the Tiangen Biochemical Technology Co., Ltd. Quick Plant Genomic DNA Extraction System (DP-321). The operation was performed according to the kit instructions.

[0044] Primer design: The relevant primers for verifying the success of plasmid transformation are designed as follows (5'-3'):

[0045] bgl1B-F: tgcctccggactttctctgg (SEQ ID NO: 6);

[0046] bgl1B-R: gctatctccctctgcgctctt (SEQ ID NO:7).

[0047] Agarose gel electrophoresis: With plasmid (replaced by P) as positive control and Trichoderma reesei RUT-C30 (replaced by W) as negative control, PCR amplification and agarose gel electrophoresis (conventional steps) were performed on transformant DNA and control DNA using primers bgl1B-F and bgl1B-R designed on the bgl1B gene. A total of 9 transformants were selected in the present invention, of which 4 had the target band ( Figure 3 ), indicating that the transformation of 4 strains was successful.

[0048] The above 4 positive transformants (named A1, A2, A3, and A4, respectively) were verified by shake flask fermentation. After the fermentation, the cellulase activity was determined. The present invention quantified the cellulase activity by filter paper activity (FPA), and the standard enzyme activity determination method recommended by the International Union of Pure and Applied Chemistry (IUPAC) was used for determination. The enzyme activity results on the seventh day were 4.81, 6.21, 5.1, and 3.7 FPU / mL, respectively. The transformant A2 with the highest enzyme activity was propagated and set aside.

[0049] 2. Transformation of vector pCRISPR-rce1 into Trichoderma reesei RUT-C30 strain

[0050] Transformation: The vector pCRISPR-rce1 constructed in step 2.2 was transformed into the A2 strain obtained in 3.1 (conventional step), and spread on the resistance screening medium. The resistance screening marker was hygromycin (hph, working concentration 100ug / ml).

[0051] Among them, the above resistance screening medium formula is: 1M D-sorbitol, 20g / L glucose, 15g / L KH2PO4, 5g / L(NH4)2SO4, 0.6g / L MgSO4·7H2O, 0.6g / L CaCl2, 0.005g / LFeSO4·7H2O, 0.0016g / LMnSO4·H2O, 0.0014g / L ZnSO4·7H2O, 0.002g / L CoCl2, and 20g / L agar powder.

[0052] Sterilize in a high-pressure steam autoclave (121°C, 25 min); wait until the temperature cools to 45-50°C (not too hot to touch), add hygromycin (hph, working concentration 150ug / ml) and ampicillin (final concentration 100μg / mL) in an ultra-clean workbench, then pour into a plastic culture dish to cool for use.

[0053] Propagation: The monoclonal transformants grown on the resistance screening medium were picked up with a sterile toothpick and transferred to Trichoderma agar medium without hygromycin for propagation. After 7 days of growth, 10 mL of sterile water was added and the spore suspension was scraped and stored in a 4°C refrigerator for later use.

[0054] The above Trichoderma agar medium formula is: 10g / L glucose, 2g / L corn steep liquor, 2.8g / LKH2PO4, 3.92g / L(NH4)2SO4, 0.84g / L MgSO4·7H2O, 0.84g / L urea, 2g / L Tween-80, 0.014g / L FeSO4·7H2O, 0.00436g / L MnSO4·H2O, 0.00392g / LZnSO4·7H2O, 0.0056g / L CoCl2, 20g / L agar; after preparation, adjust the pH to 4.8 with 2M NaOH solution.

[0055] Sterilize in a high-pressure steam autoclave (121°C, 25 min); wait until the temperature cools to 45-50°C (not too hot to touch), add ampicillin (final concentration 100 μg / mL) in an ultra-clean workbench, and then pour into a plastic culture dish to cool for use.

[0056] Trichoderma culture: The spore suspension of the transformant and Trichoderma reesei RUT-C30 strain was inoculated into Trichoderma culture medium (100 mL) at a spore inoculation amount of 10^9 cell / L. After inoculation, overnight culture was completed to obtain mycelium of the transformant.

[0057] The culture medium formula of the above Trichoderma species is: 12g / L glucose, 0.7g / L corn steep liquor, 1.96g / LKH2PO4, 1.372g / L(NH4)2SO4, 0.294g / L MgSO4·7H2O, 0.294g / L urea, 0.0049g / L FeSO4·7H2O, 0.0015g / L MnSO4·H2O, 0.0014g / L ZnSO4·7H2O, 0.002g / LCoCl2.

[0058] Sterilize in a high-pressure steam autoclave (121°C, 25 min); wait until the temperature cools to 45-50°C (not too hot to touch), add ampicillin (final concentration 100 μg / mL) in an ultra-clean workbench, and then pour into a plastic culture dish to cool for use.

[0059] DNA extraction: The DNA of Trichoderma mycelium cultured overnight was extracted using the Tiangen Biochemical Technology Co., Ltd. Quick Plant Genomic DNA Extraction System (DP-321). The operation was performed according to the kit instructions.

[0060] Primer design: The relevant primers for verifying the success of plasmid transformation are designed as follows (5'-3'):

[0061] CRISPR-F:TCAGAGAGGTCAAGGTCATC (SEQ ID NO:8);

[0062] CRISPR-R: CTCTCCATGATGGTGATTCC (SEQ ID NO: 9).

[0063] Agarose gel electrophoresis: With the plasmid (replaced by P) as the positive control and Trichoderma reesei RUT-C30 (replaced by W) as the negative control, the primers CRISPR-F and CRISPR-R designed on the pCRISPR-rce1 plasmid were used to perform PCR amplification and agarose gel electrophoresis (conventional steps) on the transformant DNA and the control DNA. A total of 12 transformants were selected in the present invention, of which 7 had the target band ( Figure 4 ), proving that these 7 strains were successfully transformed.

[0064] The region spanning sgRNA on the knockout gene rce1 was used as the target fragment, and the primers were used to amplify the obtained positive transformant DNA. The original strain RUT C30 was used as a positive control, and the amplified products were subjected to agarose gel electrophoresis ( Figure 5 ). In the figure, lane M is a marker, lanes 1, 2, 3, 4, 5, 6, and 7 are genomic amplification bands of 7 transformants, and lane W is the amplification band of the original strain RUTC30. Among them, 5 transformants have no target bands, and the remaining transformants have bands with the original strain, so the rce1 gene of the 5 transformants was successfully knocked out.

[0065] The above 5 transformants were fermented in shake flasks, and the filter paper enzyme activity was determined on the third day of fermentation. The RT-QPCR method was used to determine the expression levels of related genes: exonuclease gene cbh1, endonuclease gene egl1, and β-glucosidase gene bgl1. Finally, the engineered strain with the highest filter paper enzyme activity and the highest enzyme gene expression was obtained, which was named TR-HH01.

[0066] Example 4 TR-HH01 strain fermentation and enzyme activity determination

[0067] 1) The shake flask fermentation process of TR-HH01 is as follows: the shake flask seeds and the shake flask fermentation medium system are both 100 ml, the spore inoculation amount of the shake flask seeds is 10^7 cell / L, the seed culture time is 18 h, the seed to fermentation transfer amount is 10%, the seed and fermentation process culture conditions are 30°C, 180 rpm, pH is not controlled, and the fermentation culture time is 3 days.

[0068] The components of the above shake flask seed culture medium are: glucose 22g / L, corn steep liquor 1.7g / L, potassium dihydrogen phosphate 2g / L, ammonium sulfate 0.5g / L, magnesium sulfate 0.83g / L, ferrous sulfate heptahydrate 0.005g / L, manganese sulfate monohydrate 0.0015g / L, zinc sulfate heptahydrate 0.0014g / L, cobalt chloride 0.002g / L, add water to make up to 100 ml. After preparation, sterilize at 121°C for 25min, cool and set aside;

[0069] The components of the above shake flask fermentation medium are: 2% steam-exploded corn stalks, 2g / L corn steep liquor, 1g / L potassium dihydrogen phosphate, 2g / L ammonium sulfate, 3g / L magnesium sulfate heptahydrate, 0.005g / L ferrous sulfate heptahydrate, 0.0015g / L manganese sulfate monohydrate, 0.0014g / L zinc sulfate heptahydrate, 0.002g / L cobalt chloride, add water to make up to 100mL, sterilize at 121°C for 25min after preparation, and cool for use;

[0070] 2) Detection of related enzyme expression

[0071] RNA extraction, reverse transcription, and RT-QPCR analysis were performed using the EASYspin Plus Plant RNA Rapid Extraction Kit, Takara's Reverse Transcription Kit RR047A, and RT-QPCR Kit RR420A. The internal reference gene was sar1.

[0072] The relevant primer designs used in the above RT-QPCR process are shown in Table 1:

[0073] Table 1 Primer sequences used

[0074] Primer name Primer sequence (5'-3') Qsar1-F TGGATCGTCAACTGGTTCTACGA(SEQ ID NO:10) Qsar1-R GCATGTGTAGCAACGTGGTCTTT(SEQ ID NO:11) Qcbh1-F ACGAGTTCTCTTTCGATGTTGATG(SEQ ID NO:12) Qcbh1-R CGGTGTTGGTGGGATACTTG(SEQ ID NO:13) Qeg1-F ACTACAACTCGTGCACCGTC(SEQ ID NO:14) Qeg1-R CCGAGGTCGTGACGCCCGAG(SEQ ID NO:15) Qbgl1B-F ATAGATACGGTCAGCCTAAG(SEQ ID NO:16) Qbgl1B-R CCATATAAGCCCTCACATTC(SEQ ID NO:17)

[0075] The enzyme activity FPA of TR-HH01 after 3 days of shake flask fermentation was 4.01 IU / mL, and the enzyme activity FPA of RUT-C30 after 3 days of shake flask fermentation was 2.01 IU / mL; the relative expression levels of cbh1, egl1, and bgl1 genes of TR-HH01 relative to RUT-C30 were 59, 43, and 78, respectively.

[0076] Example 5 Optimization of Fermentation Process of Cellulase-Producing Engineering Strains

[0077] The engineered strain TR-HH01 obtained by synthetic method was used to explore the pilot fermentation process.

[0078] Seed culture time and transplanting amount: Collect spores from the plate culture medium (concentration 10^8cell / mL), inoculate into the seed culture medium with an inoculation amount of 10^9cell / L, and culture at 180rpm and 30℃ for 18h, 24h, 30h, and 36h respectively. Then transplant the seed liquid into the fermentation culture medium with transplanting amounts of 8%, 10%, 12%, and 15% respectively.

[0079] The components of the seed tank culture medium are: 22g / L glucose, 1.7g / L corn steep liquor, 2g / L potassium dihydrogen phosphate, 0.5g / L ammonium sulfate, 0.83g / L magnesium sulfate, 0.005g / L ferrous sulfate heptahydrate, 0.0015g / L manganese sulfate monohydrate, 0.0014g / L zinc sulfate heptahydrate, 0.002g / L cobalt chloride, add water to make up to 1L. After preparation, sterilize at 121°C for 25min, cool and set aside;

[0080] The fermentation medium components are: 2% steam-exploded corn stalks, 2g / L corn syrup powder, 1g / L potassium dihydrogen phosphate, 2g / L ammonium sulfate, 3g / L magnesium sulfate heptahydrate, 0.005g / L ferrous sulfate heptahydrate, 0.0015g / L manganese sulfate monohydrate, 0.0014g / L zinc sulfate heptahydrate, 0.002g / L cobalt chloride, add water to make the volume to 10L, sterilize at 121°C for 25min after preparation, and cool for use;

[0081] pH control during fermentation: During the fermentation process, the temperature was set at 30°C, the DO was set at 30%, and the initial pH was set at 4.5 and 5.5 respectively. The enzyme activity on the filter paper was measured from the second day until the enzyme was produced and put into the tank on the seventh day.

[0082] The present invention compares the highest enzyme activity measured under each condition ( Figure 6 ), showing that at 30 h of seed culture, 12% transplanting amount, and an initial pH of 5.5, the engineered strain TR-HH01 could obtain the highest filter paper enzyme activity of 10.5 IU / mL.

[0083] Example 6 Amplification of cellulase-producing engineered strains

[0084] The engineered strain TR-HH01 was obtained by the method of the above embodiment, and the optimal fermentation conditions obtained in Example 5 were used for scale-up verification in a 300L fermentation tank, and the starting strain Trichoderma reesei RUT-C30 was used for enzyme activity control. Samples were taken from the second day to measure the enzyme activity on filter paper until the tank was taken down on the seventh day of fermentation. The results showed that ( Figure 7 ), the engineered strain and fermentation process developed by the present invention have obvious advantages and can provide good support for the industrial production of cellulase.

[0085] The enzyme liquid obtained after the fermentation of the two strains was used to enzymatically hydrolyze the straw pretreated by steam explosion, and the enzymatic sugars were compared. The results showed that (Table 2) compared with the starting strain RUT-C30, when the enzyme liquid obtained by fermentation of the engineered strain TR-HH01 was used to enzymatically hydrolyze the straw substrate, higher glucose components, xylose components and total enzymatic sugars were obtained, and the cellobiose component was significantly reduced, indicating that after genetic modification, the engineered strain TR-HH01 can be induced to produce higher levels of cellulase, xylanase, and β-glucosidase components in cellulase, so that there is no need to add additional exogenous β-glucosidase, which greatly reduces the cost of industrial application of cellulase.

[0086] Table 2 Enzymatic hydrolysis total sugar

[0087]

[0088]

[0089] Among them, the method for determining the total sugar by enzymatic hydrolysis is as follows:

[0090] ①100ml system: weigh 15g corn stalks pretreated by steam explosion (195℃, 15min) in a 250ml shake flask, add fermented cellulase solution (45%), make up the rest with water, stir with a glass rod, and enzymolyze for 24h in a shaker at 180rpm and 50℃;

[0091] ② Take out about 2 ml of enzymatic hydrolysate into a glass test tube, put it into boiling water and boil for 5-10 minutes to inactivate the enzyme activity, then pour the enzymatic hydrolysate in the test tube into a 1.5 ml centrifuge tube, centrifuge to obtain the supernatant, and dilute it 20 times with purified water.

[0092] ③ After passing through the membrane, the peak areas of glucose, cellobiose and xylose were measured in the liquid phase, and the concentrations of glucose (g / l), cellobiose (g / l) and xylose (g / l) were calculated according to the standard curve formula. The total sugar concentration (g / l) after enzymatic hydrolysis was calculated as follows: C 总糖 =C 葡萄糖 +C 纤维二糖 +C 木糖 .

[0093] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for preparing a genetically modified Trichoderma reesei engineered strain, wherein the method is to knock out the endogenous gene rce1 Expression of bgl1B, The Trichoderma reesei is RUT-C30; the exogenous bgl1B is derived from Aspergillus niger, and the bgl1B The coding sequence is shown in SEQ ID NO: 1, and the knockout endogenous gene rce1 The method for expressing is gene editing, and the gene editing adopts the CRISPR / Cas9 system, wherein the sequence of sgRNA in the CRISPR / Cas9 system is shown in SEQ ID NO:2; the sgRNA sequence-related elements are obtained by connecting and assembling in the following manner: the HH ribozyme-gRNA-rce1 (RUT-C30)-sgRNA_backbone-HDV ribozyme fragment is obtained by a base synthesis method, wherein the HH ribozyme sequence is shown in SEQ ID NO:3; the sgRNA_backbone sequence is shown in SEQ ID NO:4; the HDVribozyme sequence is shown in SEQ ID NO:5; wherein gRNA-rcel (RUT-C30) is the sgRNA shown in SEQ ID NO:

2.

2. The method according to claim 1, characterized in that The CRISPR / Cas9 system is to clone the Cas9 expression frame and sgRNA into the same expression plasmid to transform the host cell.

3. The method according to claim 2, characterized in that The plasmid also includes a promoter, a resistance gene fragment and a terminator element.

4. The method according to claim 3, characterized in that The method also includes detecting genetically modified Trichoderma reesei related genes, wherein the related genes include endogenous rce1 and exogenous bgl1B ,Will rce1 Successful gene knockout and bgl1B The successfully transformed strains were used as candidate strains for enzyme activity testing.

5. The method according to claim 4, characterized in that The method also includes using RT-QPCR method to determine the related gene: exonuclease gene cbh1 , endonuclease gene egl1 , β-glucosidase gene bgl1 The expression level was increased, and finally the engineering strain with the highest filter paper enzyme activity and the highest enzyme gene expression level was obtained.

6. A genetically modified engineered strain of Trichoderma reesei, characterized in that: The strain is a genetically engineered bacterium produced according to the method described in any one of claims 1 to 5.

7. Use of the genetically engineered strain according to claim 6 in the fermentation production of cellulase.

8. The use according to claim 7, characterized in that: The conditions for fermenting and producing cellulase include seed culture for 25-35 hours, a transplanting amount of 10-15%, and an initial pH of 5-6.

9. The use according to claim 8, characterized in that: The fermentation is industrial production fermentation, and the volume of the fermentation tank is 200L~500L.

Images