A recombinant Vibrio natrii with high pullulanase production, and its construction method and application

Abstract

The present invention discloses a recombinant Vibrio natrii that produces high-yield pullulanase. The recombinant Vibrio natrii is obtained by introducing a recombinant plasmid OmpA-PulA into a host Vibrio natrii. The recombinant plasmid OmpA-PulA is constructed by connecting a pullulanase encoding gene and an OmpA signal peptide encoding gene with an expression vector. The present invention also discloses a method for efficiently fermenting pullulanase using the recombinant Vibrio natrii. The present invention realizes the secretory expression of pullulanase PulA in Vibrio natrii for the first time, and produces pullulanase PulA using the fermentation method of the present invention, with an extracellular enzyme activity of up to 83.3U·mL ‑1 , is the enzyme activity in Escherichia coli 7.3U·mL ‑1 The vitality is significantly improved by 11.4 times.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme engineering, and particularly relates to a recombinant natriuretic vibrio capable of producing high-yield pullulanase, a construction method and an application thereof. Background Art

[0002] Pullulanase is a starch debranching enzyme of the GH13 glycoside hydrolase family. It can act on α-1,6-glucosidic bonds and can efficiently hydrolyze pullulan polysaccharides and branched dextrins with lower molecular weight. It is widely used in the production of starch sugar, resistant starch, cyclodextrin and other products. Because pullulanase protein molecules are generally large, generally containing more than 900 amino acids, and the molecular weight of a single subunit is about 100kDa; in addition, a single pullulanase subunit usually contains 6 domains and some unique amino acid sequences, which makes pullulanase very easy to form inclusion bodies, difficult to secrete outside the cell, and low extracellular expression level.

[0003] At present, pullulanase is mainly heterologously expressed in Escherichia coli, Bacillus subtilis, and Pichia pastoris. However, the Escherichia coli expression system has the disadvantages of poor protein folding, easy formation of inclusion bodies, and poor extracellular secretion efficiency; although the Bacillus subtilis expression system has strong secretion ability, it is easy to produce incompletely folded pullulanase and secrete more extracellular proteases, which is easy to degrade exogenous proteins and affect subsequent applications; and Pichia pastoris is a eukaryotic organism with post-translational modification and codon preference of proteins. In addition, the problem of low extracellular expression level of pullulanase will greatly increase the difficulty of subsequent product separation and extraction during fermentation production of pullulanase, further increase industrial production costs, and hinder the further promotion and application of pullulanase. Therefore, it is necessary to find a new expression host to achieve efficient secretory expression of pullulanase protein.

[0004] Vibrio natriegens is a non-pathogenic, facultative anaerobic, Gram-negative marine bacterium with a fast growth rate and a doubling time of less than 10 min in the logarithmic growth phase. In addition, although V. natriegens and E. coli are similar in core metabolism, V. natriegens has the following advantages: (1) During the logarithmic growth phase, the number of ribosomes in V. natriegens is 30-60% more than that in E. coli, and the 5.16mbp genome of V. natriegens is distributed on two chromosomes and can be replicated in parallel. These two mechanisms enable V. natriegens cells to grow rapidly and synthesize proteins at a high rate; (2) V. natriegens has a higher specific substrate consumption rate Qs, which is at least twice as high as that of E. coli (1.9 g·g-1·h-1) under aerobic and anaerobic conditions, which means that the amount of carbon that can be accumulated in the product is very high; (3) Compared with E. coli, V. natriegens has significantly lower catalase activity, less intense stress response, and stronger tolerance to environmental and pressure fluctuations. The above advantages make V. natriegens have the potential to become the next generation of the main expression host for protein expression. Summary of the invention

[0005] Objective of the invention: The first objective of the present invention is to provide a recombinant Vibrio natriuresis that can efficiently express pullulanase.

[0006] The second object of the present invention is to provide a method for constructing the recombinant Vibrio natriuresis.

[0007] The third object of the present invention is to provide a method for producing pullulanase by fermentation using the recombinant Vibrio natriuresis.

[0008] Technical solution: The present invention provides a recombinant Vibrio natrii, wherein the recombinant Vibrio natrii is obtained by introducing a recombinant plasmid OmpA-PulA into a host Vibrio natrii, wherein the recombinant plasmid OmpA-PulA is constructed by connecting a pullulanase encoding gene and an OmpA signal peptide encoding gene with an expression vector;

[0009] Preferably, the gene encoding the pullulanase is shown as SEQ ID NO.1, and the gene encoding the OmpA signal peptide is shown as SEQ ID NO.2.

[0010] The present invention also provides a method for constructing the recombinant Vibrio natriuresis, comprising the following steps:

[0011] (1) connecting the pullulanase encoding gene and the OmpA signal peptide encoding gene by chemical synthesis;

[0012] (2) Homologously recombining the ligated fragments from step (1) with the expression vector to obtain the recombinant plasmid OmpA-PulA.

[0013] (3) The recombinant plasmid OmpA-PulA obtained in step (2) is transformed into Vibrio natriuresis by electroporation.

[0014] Preferably, the expression vector is pET24a(+).

[0015] Preferably, the pullulanase encoding gene sequence is shown as SEQ ID NO.1, the OmpA signal peptide encoding gene sequence is shown as SEQ ID NO.2, the connecting fragment gene sequence is shown as SEQ ID NO.3, and the corresponding amino acid sequence is shown as SEQ ID NO.4.

[0016] The present invention also provides the application of the recombinant Vibrio natriuresis or the construction method of the recombinant Vibrio natriuresis in producing pullulanase.

[0017] The present invention also provides a method for producing pullulanase by fermentation using the recombinant Vibrio natriuresis, comprising the following steps:

[0018] (1) Pick the recombinant Vibrio natrium colony and transfer it to BHIv2 liquid culture medium for 6-8 hours at 25-30°C until the bacterial solution concentration reaches OD 600 =6;

[0019] (2) transferring the bacterial solution of step (1) into fresh TBv2 liquid culture medium at a 5% inoculum volume at 25-30° C. and culturing for 1-2 hours;

[0020] (3) adding isopropylthio-D-galactoside to the TBv2 liquid culture medium at 25-30° C. for 34-38 hours to obtain a fermentation broth containing pullulanase.

[0021] Preferably, the components of the TBv2 liquid culture medium are glycerol, trypsin, yeast powder, K2HPO4·3H2O, KH2PO4, NaCl, KCl, MgCl2·6H2O, kanamycin, and glycine.

[0022] Preferably, the BHIv2 liquid culture medium comprises BHI Broth, NaCl, KCl, MgCl2·6H2O, and kanamycin.

[0023] Preferably, the concentration of isopropylthio-D-galactoside added is 0.05 to 2.0 mmol·L -1 .

[0024] Preferably, the final concentration of glycine is 10 to 40 g·L -1 .

[0025] The OmpA signal peptide was derived from Escherichia coli, and SPalg521 was derived from Vibrio natriuresis.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The Escherichia coli-derived signal peptide is used to establish the V. natriegens expression system (pET24a / OmpA-PulA), and the secretory expression of pullulanase in the strain V. natriegens is realized for the first time; (2) Through the optimization of culture medium components and culture conditions, the extracellular enzyme activity of the recombinant Escherichia coli-derived signal peptide V. natriegens (pET24a / OmpA-PulA) reaches 83.3 U·mL -1 , about the recombinant self-signal peptide Escherichia coli BL21 (DE3) (pET24a / OmpA-PulA) pullulanase activity 7.3U·mL -1 The pullulanase activity of V. natriegens (pET24a / SPalg521-PulA) is 7.8 U·mL. -1 (3) The method is simple and can significantly reduce the cost of the fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The recombinant plasmid maps are shown in Figure 1. A: pET24a / OmpA-PulA; B: pET24a / SPalg521-PulA.

[0028] Figure 2 The SDS-PAGE electrophoresis diagram of the fermentation supernatant and broken cell supernatant of recombinant V. natriegens (pET24a / OmpA-PulA). M: protein molecular weight standard; 1: fermentation supernatant of V. natriegens (pET24a / OmpA-PulA); 2: broken cell supernatant of V. natriegens (pET24a / OmpA-PulA); 3: fermentation supernatant of V. natriegens (pET24a / SPalg521-PulA); 4: broken cell supernatant of V. natriegens (pET24a / SPalg521-PulA). DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0030] The E. coli BL21 (DE3) involved in the examples was purchased from Beijing Solebow Technology Co., Ltd., V. natriegens Vmax was purchased from Synthetic Genomics, and the pET24a (+) vector was purchased from Novagen. 5×PS buffer (Mg 2+ plus) was purchased from Bao Biotechnology (Dalian) Co., Ltd.

[0031] SOB medium: yeast powder 5.0 g·L -1 , Tryptone 10.0 g·L -1 、NaCl 5.0g·L -1 .

[0032] LB solid medium: yeast powder 5.0 g L -1 , Tryptone 10.0 g·L -1 、NaCl 10.0g·L -1 , agar powder 15g / L, kanamycin 50μg·mL -1

[0033] LB liquid medium: yeast powder 5.0 g L -1 , Tryptone 10.0 g·L -1 、NaCl 10.0g·L -1 , kanamycin 50 μg·mL -1 .

[0034] TB medium: glycerol 5.0 g·L -1 , Tryptone 12.0 g·L -1 , Yeast powder 24.0g·L -1 、K2HPO4·3H2O16.4g·L -1 、KH2PO4 2.3g·L -1 , kanamycin 50 μg·mL -1 .

[0035] BHIv2 liquid medium: BHI Broth 38.5 g·L -1 、NaCl 11.9g·L -1 、KCl 0.33g·L -1 、MgCl2·6H2O4.7g·L -1 , kanamycin 200 μg·mL-1.

[0036] LBv2 solid medium: yeast powder 5.0g·L-1, tryptone 10.0g·L -1 、NaCl 10.0g·L-1 , agar powder 15g / L, NaCl 11.9g·L -1 、KCl 0.33g·L -1 、MgCl2·6H2O 4.7g·L -1 , Kanamycin 100 μg·mL -1 .

[0037] TBv2 medium: glycerol 5.0 g·L -1 , Tryptone 12.0 g·L -1 , Yeast powder 24.0g·L -1 、K2HPO4·3H2O16.4g·L -1 、KH2PO4 2.3g·L -1 、NaCl 11.9g·L -1 、KCl 0.33g·L -1 、MgCl2·6H2O 4.7g·L -1 , kanamycin 200 μg·mL -1 .

[0038] Method for determination of pullulanase activity: 1 mL of 1.0% pullulan solution and 0.9 mL of 0.1 mol·L -1 pH 4.5 acetate buffer was placed in a test tube and preheated in a 60℃ water bath for 10 min. 0.1 mL of enzyme solution was added, mixed and reacted at 60℃ for 10 min, 3 mL of DNS was added to terminate the reaction, followed by boiling water bath for 7 min, and then cooled in ice water. The reaction system was made up to 15 mL with deionized water and the absorbance was detected at 540 nm. In the same conditions, the inactivated enzyme solution was used as a blank control.

[0039] Enzyme activity (U) is defined as: under the above analytical conditions, the amount of enzyme that catalyzes the reduction power equivalent to 1 μmol of glucose per minute is defined as one activity unit (1U).

[0040] Example 1 Construction of recombinant Vibrio natriegens (pET24a / OmpA-PulA)

[0041] The specific construction steps are as follows:

[0042] (1) Construction of pET24a / OmpA-PulA plasmid

[0043] The pullulanase PulA gene with an OmpA signal peptide was synthesized by chemical synthesis (the gene sequence is shown in SEQ ID NO.1), the pullulanase encoding gene is shown in SEQ ID NO.1, the OmpA signal peptide encoding gene is shown in SEQ ID NO.2, the connecting fragment of the two is shown in SEQ ID NO.3, and the corresponding amino acid sequence is shown in SEQ ID NO.4.

[0044] The target fragment SEQ ID NO.3 was connected between the Nco I and Hind III restriction sites of the vector pET24a to obtain a ligation product. The ligation product was transformed into the cloning host E. coli JM109 to obtain a transformation product. The transformation product was coated on an LB solid plate (containing 50 μg mL -1 Kanamycin) and cultured at 37°C for 10 h. Pick a single clone and inoculate it into LB liquid medium (containing 50 μg mL -1 Kanamycin) culture, at 37°C, 200 r·min -1 After 12 h of shaking culture, the bacteria were collected, the plasmid was extracted, and the target fragment of the plasmid was sequenced. The recombinant plasmid with the sequencing result of SEQ ID NO.3 was named pET24a / OmpA-PulA( Figure 1 ).

[0045] (2) Preparation of competent cells of V. natriegens

[0046] A single colony of V. natriegens was picked and inoculated into 10 mL of BHIv2 medium and incubated at 30°C and 200 r / min. -1 0.6 mL of the seed culture was inoculated into 60 mL of BHIv2 medium and incubated at 37°C and 200 r / min. -1 Grow under the conditions until OD 600 The culture was transferred to a centrifuge tube and incubated on ice for 15 min. -1 The supernatant was discarded and the V. natriegens cell pellet was resuspended in 10 mL of electroporation buffer (680 mmol / L -1 Sucrose, 7mmol·L -1 K2HPO4, pH 7.0). At 4°C, 6700 r·min -1 Centrifuge for 15 min under the same conditions, discard the supernatant to collect the cells, and repeat the washing twice. Gently suspend the V. natriegens cells in the electroporation buffer until the OD 600When the volume reaches 16, the electroporation buffer containing the cells is dispensed into freezing tubes, 100 μL per tube, and stored at -80°C for later use.

[0047] (3) The recombinant plasmid pET24a / OmpA-PulA was transformed into the strain V. natriegens by electroporation

[0048] Take out the V. natriegens competent cells from -80℃ and thaw on ice. Mix 10μL pET24a / OmpA-PulA plasmid with 100μL competent cells and place on ice for 3min. Transfer the competent cell-pET24a / OmpA-PulA plasmid mixture to a 1mm electroporation cup and electroporate at 0.7kV, 25μF, 200Ω. Then add 500μL recovery medium (BHIv2 medium plus 680mmol·L -1 Sucrose) was transferred to a 1.5 mL centrifuge tube and incubated at 37 °C, 100 r·min -1 Incubate for 1 to 2 hours under the same conditions. Spread the bacterial solution on 100 μg mL -1 Positive transformants were screened on kanamycin-resistant LBv2 plates at 37°C overnight.

[0049] (4) Fermentation of the recombinant strain V. natriegens (pET24a / OmpA-PulA)

[0050] The V. natriegens (pET24a / OmpA-PulA) colonies grown on LBv2 plates were picked and transferred to medium containing 200 μg mL -1 5 mL BHIv2 liquid medium containing kanamycin, 30°C, 200 r·min -1 The culture was shaken for 6-8 hours, and then 2.5 mL of the bacterial solution was transferred to 50 mL of fresh TBv2 liquid medium and cultured at 30 °C for 2 hours. 0.3 mmol·L -1 Isopropylthio-D-galactoside (IPTG) was used to induce the culture at 30°C for 36 h to obtain the fermentation broth. The fermentation broth was centrifuged to obtain the supernatant and the lower layer of V. natriegens (pET24a / OmpA-PulA) cells. The cells were treated with 20 mmol·L -1 PBS buffer (pH 6.0) was used to suspend the 600 =5, 25% power ultrasonic crushing in ice bath, working for 5s and resting for 5s, the total working time is 10min. 10000r·min -1 The cells were centrifuged for 5 min to obtain the supernatant.

[0051] The obtained 1 mL fermentation supernatant and 1 mL cell disruption supernatant were used as enzyme samples for pullulanase activity determination and SDS-PAGE analysis. Figure 2 As shown in Figure 2, the pullulanase activity test result showed that the PulA enzyme activity in the fermentation broth supernatant was 20.5 U·mL -1 , indicating that the use of the signal peptide OmpA derived from Escherichia coli can achieve efficient secretory expression of pullulanase PulA in Vibrio natriuresis.

[0052] Example 2 Optimization of fermentation conditions of recombinant strain V. natriegens (pET24a / OmpA-PulA)

[0053] (1) Optimal fermentation temperature of the recombinant strain of the present invention

[0054] According to the fermentation process of step (4) of Example 1, the recombinant strain V. natriegens (pET24a / OmpA-PulA) was fermented at 20°C, 25°C, 30°C and 37°C to study the effects of different temperature conditions on the growth of the recombinant strain and the secretion expression level of pullulanase.

[0055] When the induction temperature was 25℃, the growth of Vibrio natrii strain was the best. As the temperature increased or decreased, the growth of Vibrio natrii strain was affected. When the induction temperature was 30℃, the extracellular enzyme activity of PulA reached the highest level, which was 34.1U·mL -1 , the extracellular secretion ratio is 25.7%. Since the optimal bacterial growth temperature is different from the optimal secretion temperature of pullulanase, 30°C is selected as the fermentation condition, at which bacterial growth and enzyme secretion reach a balance. Therefore, the optimal induction temperature of the recombinant strain V. natriegens (pET24a / OmpA-PulA) of the present invention is 30°C.

[0056] Table 1 Effect of temperature on pullulanase activity

[0057] Temperature(℃) 20 25 30 37 Enzyme activity (U / mL) 15.4 26.7 34.1 27.1

[0058] (2) Optimal concentration of inducer IPTG for fermentation of the recombinant strain of the present invention

[0059] According to the fermentation process of step (4) of Example 1, at the optimal fermentation temperature of 30°C, the concentrations of 0.05, 0.1, 0.3, 1.0 and 2.0 mmol·L -1 The recombinant strain was induced by IPTG to investigate the effect of IPTG concentration on the growth of the recombinant strain and the secretion expression of pullulanase.

[0060] IPTG concentration had no significant effect on the growth of the recombinant strain. The IPTG concentration was between 0.05 and 2.0 mmol·L -1 , OD of recombinant Vibrio natriuresis 600 When the IPTG concentration is 0.05mmol·L -1 When the extracellular enzyme activity of PulA reached the highest level, it was 40.6 U·mL -1 The extracellular secretion ratio is 30.3%. Therefore, the optimal IPTG concentration of the recombinant strain V. natriegens (pET24a / OmpA-PulA) of the present invention is 0.05 mmol·L -1 .

[0061] Table 2 Effect of IPTG on pullulanase activity

[0062] IPTG concentration (mmol / L) 0.05 0.1 0.3 1 2 Enzyme activity (U / mL) 40.6 37.6 35.3 30.9 23.6

[0063] (3) Optimal glycine concentration for fermentation of the recombinant strain of the present invention

[0064] According to the fermentation process of step (4) of Example 1, at the optimal fermentation temperature of 30°C and the optimal IPTG concentration of 0.05 mmol·L -1 Under the same conditions, 2.5, 5, 7.5, 10, 15, 20, 25, 30, and 40 g·L were added to the TBv2 fermentation medium. -1 Glycine was used to investigate the effect of glycine concentration on the growth of the recombinant strain and the secretion and expression of pullulanase.

[0065] Glycine has an effect on the growth of V. natriegens cells. When the glycine concentration reaches 40 g·L -1 When, V.natriegens(pET24a / OmpA-PulA)OD 600 The lowest value is 3.43. When the concentration of glycine reaches 25 g·L -1 The extracellular enzyme activity of PulA was the highest, which was 83.3 U·mL -1 ; The extracellular secretion ratio was 61.2%. Therefore, the optimal glycine concentration in the culture medium was 25 g·L -1 .

[0066] Table 3 Effect of glycine concentration on pullulanase activity

[0067] Glycine concentration (g / L) 2.5 5 7.5 10 15 20 25 30 40 Enzyme activity (U / mL) 42.6 45.4 49.3 55.8 64.6 75.2 83.3 74.7 62.9

[0068] Comparative Example 1 Construction of recombinant Vibrio natriegens (pET24a / SPalg521-PulA)

[0069] The specific construction steps are as follows:

[0070] (1) Construction of pET24a / SPalg521-PulA plasmid

[0071] The pET24a / OmpA-PulA plasmid obtained in Example 1 was used as a template to amplify the region outside the original OmpA signal peptide sequence of the plasmid by PCR, and the signal peptide SPalg521 sequence derived from Vibrio natriuresis was introduced by primers.

[0072] The primers used are as follows:

[0073] Primer 1: tcaaaagcttgttagcttcttctattttacttgctgtgggcatggatggtaacacgacc (SEQID NO.5)

[0074] Primer 2: gctaacaagcttttgaagaaaatatgcttcatatgtatatctccttcttaaagttaaac (SEQID NO.6)

[0075] PCR reaction system (50 μL): 0.5 μL 10 μL 5×PS buffer (Mg 2+ plus), 4 μL dNTP, 1 μL each of upstream and downstream primers, 0.5 μL pET24a / OmpA-PulA plasmid template, 33 μL ddH2O. The PCR amplification program was: 94°C for 8 min; 98°C for 30 s, 55°C for 5 s, 72°C for 8 min 20 s, 30 cycles; 72°C for 10 min. The PCR amplification product was digested with DpnⅠ and heat-shocked to transform E. coli JM109 competent cells. The transformation mixture was heated at 37°C and 200 r·min -1 After incubation for 2 h, the samples were spread on a plate containing 50 μg mL -1 Positive transformants were screened on LB plates containing kanamycin, and positive transformants were selected for culture, plasmid extraction and sequencing, and sequencing verification was performed.

[0076] (1) Preparation of competent cells of V. natriegens

[0077] A single colony of V. natriegens was picked and inoculated into 10 mL of BHIv2 medium and incubated at 30°C and 200 r / min. -1 Take 0.6 mL of bacterial solution and inoculate it into 60 mL of BHIv2 medium. Incubate at 37°C, 200 r·min -1 Grow under the conditions until OD 600 The culture was transferred to a centrifuge tube and incubated on ice for 15 min.-1 The supernatant was discarded and the cell pellet was resuspended in 10 mL of electroporation buffer (680 mmol / L -1 Sucrose, 7mmol·L -1 K2HPO4, pH 7.0). At 4°C, 6700 r·min -1 Centrifuge for 15 min under the same conditions, discard the supernatant to collect the cells, and repeat the washing twice. Gently suspend the cells in the electroporation buffer until the OD 600 When the number of cells reaches 16, the cells are dispensed into cryovials, 100 μL per tube, and stored at -80°C until use.

[0078] (2) Transformation of recombinant plasmid pET24a / SPalg521-PulA into strain V. natriegens by electroporation

[0079] Extract the plasmid pET24a / SPalg521-PulA, take out the competent cells from -80℃, and thaw on ice. Mix 10μL pET24a / SPalg521-PulA plasmid with 100μL competent cells and place on ice for 3min. Transfer the competent cell-pET24a / SPalg521-PulA plasmid mixture to a 1mm electroporation cup and electroporate at 0.7kV, 25μF, 200Ω. Afterwards, add 500μL recovery medium (BHIv2, 680mmol·L -1 Sucrose) was transferred to a 1.5 mL centrifuge tube and incubated at 37 °C, 100 r·min -1 Incubate for 1 to 2 hours under the same conditions. Spread the bacterial solution on 100 μg mL -1 Positive transformants were screened on kanamycin-resistant LBv2 plates at 37°C overnight.

[0080] (3) Fermentation of the recombinant strain V. natriegens (pET24a / SPalg521-PulA)

[0081] A single colony of V. natriegens (pET24a / SPalg521-PulA) grown in LBv2 was picked and transferred to a medium containing 200 μg mL -1 5 mL BHIv2 liquid medium containing kanamycin, 30°C, 200 r·min -1 The culture was shaken for 6-8 hours, and then 2.5 mL of the bacterial solution was transferred to 50 mL of fresh TBv2 liquid medium and cultured at 30 °C for 2 hours. -1Isopropylthio-D-galactoside (IPTG) was used to induce the culture at 30°C for 36 h to obtain a fermentation broth, which was centrifuged to obtain the supernatant and the lower layer of V. natriegens (pET24a / SPalg521-PulA) cells. The cells were treated with 20 mmol·L -1 PBS buffer (pH 6.0) was used to suspend the cells to OD 600 =5, 25% power ultrasonic crushing in ice bath, working 5s, resting 5s, working time 10min. 10000r·min -1 The cells were centrifuged for 5 min to obtain the supernatant.

[0082] The obtained fermentation supernatant and cell disruption supernatant were used as enzyme solution samples for pullulanase activity determination and SDS-PAGE analysis. Figure 2 As shown in Figure 2, the pullulanase activity test result showed that the PulA enzyme activity in the fermentation broth supernatant was 7.8 U·mL -1 , indicating that although the signal peptide SPalg521 derived from Vibrio natriuresis itself can achieve the secretory expression of pullulanase PulA in Vibrio natriuresis, the effect is far inferior to that of the OmpA signal peptide.

[0083] Comparative Example 2 Construction of recombinant Escherichia coli

[0084] The specific construction steps are as follows:

[0085] (1) Preparation of competent Escherichia coli BL21 (DE3)

[0086] A single colony of E. coli BL21 (DE3) was selected and inoculated into 10 mL of SOB medium and incubated at 37°C and 200 r / min. -1 Take 0.5 mL of the seed culture medium and inoculate it into 50 mL of SOB medium. Incubate at 37°C and 200 r / min. -1 Grow under the conditions until OD 600 The culture was transferred to a centrifuge tube and incubated on ice for 10 min. -1 The supernatant was discarded and the Escherichia coli BL21 (DE3) cell pellet was resuspended in 10 mL Solution A (1.1 g·L -1 CaCl2). At 4℃, 3500r·min -1Centrifuge for 15 min under the same conditions, discard the supernatant to collect Escherichia coli BL21 (DE3) cells, and repeat the washing twice. Gently suspend the cells in Solution A until OD 600 When the concentration reaches 4.8, the cells are divided into freezing tubes, 100 μL per tube, and stored at -80°C for later use.

[0087] (2) Transformation of the recombinant plasmid pET24a / OmpA-PulA into the strain E. coli BL21 (DE3) by heat shock transformation

[0088] Extract plasmid pET24a / OmpA-PulA (from Example 1), take out E. coli BL21 (DE3) competent cells from -80℃ and thaw on ice. Take 10μL pET24a / OmpA-PulA plasmid and mix it with competent cells, and place it on ice for 3min. Heat shock the competent cell-pET24a / OmpA-PulA plasmid mixture in a 42℃ water bath for 90s, and quickly place it on ice for 5min. Add 1mL LB medium and incubate at 37℃, 200r·min -1 Incubate for 1.5 h. Spread the bacterial solution on 50 μg mL -1 The positive transformants were screened on kanamycin-resistant LB solid plates at 37°C overnight.

[0089] (3) Fermentation of recombinant strain E. coli BL21(DE3)(pET24a / OmpA-PulA)

[0090] A single colony of E. coli BL21 (DE3) (pET24a / OmpA-PulA) grown on an LB plate was picked and transferred to a plate containing 50 μg mL -1 5 mL LB liquid medium containing kanamycin, 37°C, 200 r·min -1 Incubate on a shaker for 6-8 hours, then transfer 2.5 mL of bacterial culture to 50 mL of fresh TB liquid medium and incubate at 37°C for 3 hours. -1 IPTG was induced and cultured at 30°C for 36 h to obtain a fermentation broth, which was centrifuged to obtain the supernatant and the lower layer of E. coli BL21 (DE3) (pET24a / OmpA-PulA) cells. The cells were treated with 20 mmol·L -1 PBS buffer (pH 6.0) was used to suspend the cells to OD 600 =5, 25% power ultrasonic crushing in ice bath, working 5s, resting 5s, working time 10min. 10000r·min -1 The cells were centrifuged for 5 min to obtain the supernatant.

[0091] The obtained fermentation supernatant and cell disruption supernatant were used as enzyme samples for pullulanase activity determination and SDS-PAGE analysis. The pullulanase activity test results showed that the enzyme activity of the fermentation supernatant of PulA was 7.3 U·mL -1 .

Claims

1. A recombinant Vibrio natriuresis, characterized in that: The recombinant Vibrio natrii is obtained by introducing a recombinant plasmid OmpA-PulA into a host Vibrio natrii. The recombinant plasmid OmpA-PulA comprises a pullulanase encoding gene and a signal peptide OmpA encoding gene connected with an expression vector, the pullulanase encoding gene is shown in SEQ ID NO.1, and the signal peptide OmpA encoding gene is shown in SEQ ID NO.

2.

2. A method for constructing the recombinant Vibrio natriuresis according to claim 1, characterized in that: The following steps are involved: (1) Using chemical synthesis, the gene encoding pullulanase and the gene encoding signal peptide OmpA are connected to obtain a connection fragment; (2) homologously recombining the ligated fragments from step (1) with the expression vector to obtain the recombinant plasmid OmpA-PulA; (3) The recombinant plasmid OmpA-PulA obtained in step (2) is transformed into Vibrio natriuresis by electroporation.

3. The construction method according to claim 2, characterized in that: The expression vector is pET24a (+), the gene sequence encoding the pullulanase is shown in SEQ ID NO.1, the gene sequence encoding the signal peptide OmpA is shown in SEQ ID NO.2, the gene sequence of the connecting fragment is shown in SEQ ID NO.3, and the amino acid sequence corresponding to the connecting fragment is shown in SEQ ID NO.

4.

4. Use of the recombinant Vibrio natriureticus according to claim 1 or the construction method of the recombinant Vibrio natriureticus according to claim 2 or 3 in the production of pullulanase.

5. A method for producing pullulanase by fermentation using the recombinant Vibrio natriuresis according to claim 1, characterized in that: The following steps are involved: (1) Pick a single colony of the recombinant Vibrio natriuresis according to claim 1 or 2, transfer it to BHIv2 liquid culture medium and culture it for 6-8 h at 25-30°C; (2) Transfer the bacterial solution obtained in step (1) to fresh TBv2 liquid culture medium at a rate of 4-8% at 25-30° C. and culture for 1-2 hours; (3) Add isopropyl thio-D-galactoside to the TBv2 liquid culture medium for induction culture at 25-30°C for 34-38 hours to obtain a fermentation broth containing pullulanase.

6. The method for producing pullulanase by fermentation according to claim 5, characterized in that: The BHIv2 liquid culture medium in step (1) comprises BHI Broth, NaCl, KCl, MgCl2·6H2O, and kanamycin.

7. The method for producing pullulanase by fermentation according to claim 5, characterized in that: The components of the TBv2 liquid culture medium in step (2) are glycerol, trypsin, yeast powder, K2HPO4·3H2O, KH2PO4, NaCl, KCl, MgCl2·6H2O, kanamycin, and glycine.

8. The method for producing pullulanase by fermentation according to claim 5, characterized in that: The concentration of isopropylthio-D-galactoside added in step (3) is 0.05~2.0mmol·L -1 .

9. The method for producing pullulanase by fermentation according to claim 7, characterized in that: The final concentration of glycine is 10-40 g·L -1 .

Images