Application of C21orf58 in the preparation of liver cancer diagnosis and / or prognosis, treatment preparations and diagnosis, prognosis, treatment preparations

Abstract

The present invention discloses an application of C21orf58 in the preparation of liver cancer diagnosis and / or prognosis, and treatment preparations, and a diagnosis, prognosis, and treatment preparation. The present invention first discovered that C21orf58 is closely related to the diagnosis, prognosis, and clinical drug resistance treatment of liver cancer, and is a key gene for the occurrence and development of tumors. Patients with low expression of the C21orf58 gene have a higher survival rate. Therefore, compared with the prior art, the new liver cancer diagnosis and treatment scheme using the C21orf58 gene as a molecular marker has strong clinical application value and potential.

Description

Technical Field

[0001] The present invention belongs to the technical field of pharmaceutical molecular biology, and specifically relates to the application of C21orf58 gene in the preparation of liver cancer diagnosis and / or prognosis, and treatment preparations, and the diagnosis, prognosis, and treatment preparations. Background Art

[0002] Primary liver cancer is one of the most common malignant tumors, and its mortality rate ranks third among all tumors, which seriously threatens human health. Liver cancer is the seventh most common cancer in the world and the third most common cause of cancer-related death.

[0003] Liver cancer has the characteristics of rapid progression, poor prognosis and short survival, with a five-year survival rate of less than 15%. Liver cancer is heterogeneous, has strong drug resistance, and has obvious differences in prognosis, but there are no effective molecular markers for prognosis assessment in clinical practice, and there are no target genes and related drugs for precision treatment. The present invention identifies the target gene C21orf58 that is closely related to the prognosis of liver cancer, and has the potential to become a target for diagnosis of subtypes of the disease, drug screening and treatment, providing a theoretical and practical basis for the effective clinical treatment of liver cancer, filling the technical gap in the targeted treatment of liver cancer both internationally and domestically. Summary of the invention

[0004] The purpose of the present invention is to provide molecular markers for the clinical effective diagnosis of liver cancer, to provide molecular targets for the clinical search for effective drugs and strategies for the treatment of liver cancer, and thus to improve the overall prognosis of liver cancer.

[0005] The present invention provides an application of a reagent for detecting C21orf58 gene in preparing a liver cancer diagnosis and / or prognosis preparation, wherein the sequence of C21orf58 gene is shown in SEQ ID NO. 1. C21orf58 chromosome 21 open reading frame 58 [Homo sapiens (human)], Homo sapiens (human), Gene ID: 54058.

[0006] Furthermore, the liver cancer diagnosis and / or prognosis preparation includes a reagent for detecting the expression level of the C21orf58 gene by PCR or in situ hybridization.

[0007] Furthermore, the reagent for PCR detection of C21orf58 gene expression level contains the following primers:

[0008] sequence:

[0009] C21orf58-F: 5'-AGACCCGCCAAGGATCATC-3'; as shown in SEQ ID NO.2;

[0010] C21orf58-R: 5′-TTCCTGACCGTTGAGTAGGGA-3′, as shown in SEQ ID NO.3.

[0011] The present invention provides a liver cancer diagnosis and / or prognosis preparation, comprising a reagent for detecting the expression amount of C21orf58 gene by PCR, wherein the C21orf58 gene sequence is shown as SEQ ID NO.1.

[0012] Furthermore, the liver cancer diagnosis and / or prognosis preparation comprises the above-mentioned primers.

[0013] The present invention provides an application of a reagent for inhibiting the expression of C21orf58 gene in the preparation of a preparation for treating liver cancer. The C21orf58 gene sequence is shown in SEQ ID NO.1.

[0014] Furthermore, the reagent for inhibiting C21orf58 gene expression is sgRNA.

[0015] The sgRNA sequences are as follows:

[0016] sgRNA1-C21orf58-F: 5'-CACCGGCTGCAGGAGACGACTGTAG-3'; as SEQ

[0017] As shown in ID NO.4;

[0018] sgRNA1-C21orf58-R: 5'-AAACCTACAGTCGTCTCCTGCAGCC-3'; as SEQ ID

[0019] Shown in NO.5;

[0020] or:

[0021] sgRNA2-C21orf58-F: 5'-CACCGAGGATGATCCTTGGCGGTC-3'; as SEQ ID

[0022] Shown in NO.6;

[0023] sgRNA2-C21orf58-R: 5'-AAACGACCCCGCCAAGGATCATCCTC-3'; as SEQ

[0024] As shown in ID NO.7.

[0025] The present invention also provides a preparation for treating liver cancer, comprising an agent for inhibiting the expression of C21orf58 gene, wherein the C21orf58 gene sequence is shown as SEQ ID NO.1.

[0026] Furthermore, the reagent for inhibiting C21orf58 gene expression includes sgRNA.

[0027] The present invention also provides the use of an agent for inhibiting the expression of C21orf58 gene in the preparation of a preparation for enhancing the sensitivity of liver cancer to Sorafenib. The C21orf58 gene sequence is shown in SEQ ID NO.1.

[0028] The CDS sequence of the C21orf58 gene is as follows:

[0029] ATGGCCATCCTGCCCGGAGAGGCGCCTGTACCTGGCCCAGGCTGGCCTGAGCCTG

[0030] ATGCTGGGGGTGCCTCTGTGGCGTTGGGGCTCCCCGTCCCCGTGTGCAGCAGCTCTGC

[0031] ATCGGCCTTGCAGGAACAACACCTCCTGGACGAGCTCTCTCGGGCCCAGGCCTGGAG

[0032] CGGGCCAAGCAGAGGAGCCCTCGGGTCAGCCCTGCCCCCAGAGCTGCCCCCCACGGG

[0033] CATCCTACCCACTGCCTCCCCATCCCCGCTGGCCCCAGACCCGCCAAGGATCATCCTGC

[0034] CTACGGTCCCCCAGCCTCCTGCCACCATCATTCAGCAGCTCCCTCAGCAGCCACTCATA

[0035] GCACAGATTCCTCCTCCCCAGGCCTTCCCTACTCAACGGTCAGGAAGTATTAAGGAAG

[0036] ACATGGTGGAGCTGCTGCTGCTGCAGAACGCACAGGTGCACCAGTTGGTCCTGCAGA

[0037] ACTGGATGCTCAAGGCCCTGCCCCAAGCCCTGCAGGACCCGCCACATGTGCCCCCGAG

[0038] GGTCCCACGAGCTGCCAGGCCAAGGCTGCCTGCCGTGCACCACCACCACCACCACCA

[0039] CCATGCTGTGTGGCCACCTGGGGCTGCCACTGTCCTCCAGCCCGCCCCCAGCCTGTGG

[0040] ACGCCTGGCCCACCCTGA

[0041] The present invention is a tumor subtype classification, drug screening and treatment strategy targeting the molecular marker C21orf58 (chromosome 21open reading frame 58). It is clear that C21orf58 is a target molecule for improving the overall prognosis of liver cancer and effectively treating the disease; taking the C21orf58 gene as the core target and intervening in its expression is a feasible solution for effectively treating liver cancer.

[0042] Technical advantages of the present invention:

[0043] C21orf58 is closely related to the prognosis of liver cancer and is a key gene for the occurrence and development of tumors. Patients with low expression of the C21orf58 gene have a higher survival rate. At the same time, C21orf58 is closely related to the clinical drug resistance of liver cancer patients. High expression of the C21orf58 gene promotes resistance to sorafenib drug treatment. Therefore, compared with existing technologies, the new liver cancer diagnosis and treatment program using the C21orf58 gene as a molecular marker has strong clinical application value and potential.

[0044] The present invention is further described below with reference to the accompanying drawings and specific embodiments, but is not intended to limit the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 A The mRNA expression level of C21orf58 in clinically paired HCC tissues and adjacent paracancerous tissues;

[0046] Figure 1 B The protein expression level of C21orf58 in clinically paired HCC tissues and adjacent paracancerous tissues;

[0047] Figure 1 C Immunohistochemical staining of C21orf58 protein in liver cancer tissue and adjacent tissue, scale bar is 100 μm;

[0048] Figure 1 D Statistical analysis of the expression of C21orf58 in liver cancer tissues and adjacent tissues, P<0.001. (***P<0.001, **P<0.01, *P<0.05, data are statistically significant);

[0049] Figure 2 Overall survival (OS) and disease-free survival (DFS) rates of HCC patients with high and low C21orf58 expression;

[0050] Figure 3 A Stable overexpression and knockdown of C21orf58 expression in liver cancer cell lines;

[0051] Figure 3 BD Cell viability detection of liver cancer cell lines with overexpression / knockdown of C21orf58 and control group (results are mean ± standard deviation (n = 3), ***P < 0.001, **P < 0.01, *P < 0.05, data are statistically significant); HepG2 is a human hepatoblastoma cell line, and Huh-7 is a human liver cancer cell line, both purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences; MHCC97-H cell line is a monoclonal MHCC97-H cell from the laboratory of Professor Tang Zhaoyou of Zhongshan Hospital (affiliated to Fudan University);

[0052] Figure 4 Subcutaneous tumor formation in HepG2 nude mice. A. Tumors formed after subcutaneous injection of overexpressed HepG2 cells (C21orf58) and control cells (Vector) in nude mice, B is the weight statistics of the formed tumors; C. Tumors formed after subcutaneous injection of knockdown MHCC97-H cells (sg1 and sg2) and control cells (Ctrl in nude mice, D is the weight statistics of the formed tumors, P<0.05, P<0.001. (***P<0.001, **P<0.01, *P<0.05, the data are statistically significant).

[0053] Figure 5 Detection of drug resistance to sorafenib in liver cancer cell lines overexpressing / knockdown of C21orf58 and the control group. Figure 5 A(CCK8) and Figure 5 The results of BC (crystal violet) experiments showed that overexpression of C21orf58 promoted the resistance of liver cancer cells HepG2 to Sorafenib; reducing the expression of C21orf58 promoted the sensitivity of liver cancer cells Huh7 to Sorafenib. DETAILED DESCRIPTION

[0054] Example 1: qPCR, Western Blot and IHC detection of C21orf58 expression in liver cancer tumor tissues and normal tissues.

[0055] All liver cancer samples were obtained from the Second Xiangya Hospital of Central South University. The collection of samples was approved by the patients, and the use of samples was approved by the unit's ethics committee. Fresh liver cancer samples and paired normal liver tissues obtained from surgical operations were quickly placed in liquid nitrogen and then stored in an ultra-low temperature refrigerator at -80°C. Under low temperature conditions, liver cancer and normal tissues were pounded into powder in a mortar, added with 1 mL of RZ lysis solution and dissolved on ice, transferred to a 1.5 mL centrifuge tube, added with 200 μL of chloroform and repeatedly inverted to mix, placed on ice for 8 min, and centrifuged at 14000 rpm at 4°C for 18 min. Take 400 μL of supernatant, transfer to a new 1.5 mL centrifuge tube, add 400 μL of isopropanol, mix, place on ice for 10 min, and centrifuge at 14000 rpm at 4°C for 18 min. After discarding the solution, wash twice with 75% ethanol, centrifuge at 4°C, discard the solution, place at room temperature until the alcohol is completely evaporated, add an appropriate amount of RNase-free water to dissolve, and then reverse transcribe into cDNA for gene transcription level detection.

[0056] The obtained cDNA was diluted 25 times and Realtime PCR was performed using 2×SYBR Mix (Takara). The reaction system was: 5μl (2×SYBR Mix), 2μl primers (forward and reverse primers mixed, concentration of 2μM), 3μl diluted cDNA, and three replicate wells were set for each cDNA sample. Then a realtime PCR instrument (Thermo scientific) was used for amplification detection. GAPDH was used as the experimental internal reference, and the target gene (Ct value) was subtracted from the internal reference (Ct value) to obtain ΔCt, and then ΔCt (liver cancer tissue) was subtracted from ΔCt (normal tissue) to obtain ΔΔCt. If 2 -ΔΔCt If greater than 1, the target gene in the experimental group is upregulated; if 2 -ΔΔCt If it is less than 1, the target gene in the experimental group is downregulated; if it is 2 -ΔΔCt If it is equal to 1, there is no change in the target gene in the experimental group.

[0057] The C21orf58 primer sequences used in the qPCR process are:

[0058] C21orf58-F: 5'-AGACCCGCCAAGGATCATC-3';

[0059] C21orf58-R: 5'-TTCCTGACCGTTGAGTAGGGA-3'.

[0060] Under low temperature conditions, liver cancer and normal tissues were pounded into powder with a mortar, and 1 mL of RIPA lysis buffer (0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 50 mM Tris (PH 7.4), Protein Inhibitor Cocktail (Sigma), phosphatase inhibitors (Satancruz)) was added. The lysis buffer solution was dissolved on ice and transferred to a 1.5 mL centrifuge tube. The mixture was rotated on a shaker at 4°C overnight, and then centrifuged at 10,000 × g at 4°C for 10 min. The supernatant was transferred to a new 1.5 mL centrifuge tube, which was the supernatant protein stock solution. The supernatant protein solution was taken and the protein concentration was determined by Bradford (Sigma) quantitative method. After all protein samples were adjusted to the same concentration using the lysis buffer, the protein loading buffer was added and denatured at 100°C for 5-10 min. Add equal amounts of protein to the SDS-PAGE electrophoresis gel well for electrophoresis, 80V voltage for 20min to concentrate the protein; 120V voltage until the end of the run to separate proteins of different molecular weights. After electrophoresis, transfer the protein to the PVDF (Millipore) membrane by wet transfer on ice. Blocking solution (TBST (150mM NaCl, 25mM Tris (PH 7.5), 0.05% Tween20) containing 5% BSA) at room temperature for 1h, remove the blocking solution and add the diluted primary antibody solution (2% BSA + TBST solution containing antibodies), incubate with antibodies overnight in the cold storage. On the second day, recover the primary antibody, wash three times with TBST, 8min each time, add the secondary antibody (coupled with horseradish peroxidase, dilution ratio 1:1000) solution, and incubate at room temperature for 1h. After the incubation, wash three times with TBST, 8min each time, rinse once with TBS (3min), and add the substrate (Chemiluminescene) for color exposure.

[0061] The paraffin-embedded tissue was sliced ​​to a thickness of 5 μm, attached to a glass slide, and dried at 37°C. The slices were placed in a 70°C oven for 40 minutes, and after the paraffin melted, they were quickly transferred to xylene and dewaxed twice, each for 15 minutes. Then, the xylene was removed in anhydrous ethanol twice, each for 10 minutes; placed in 95% ethanol for 15 minutes, and then placed in 80% ethanol, 75% ethanol, and 50% ethanol for 10 minutes each. Washed three times in PBS (0.01M / L) buffer (2mmol / L NaH2PO4, 150mmol / L NaCl, 8mmol / LNa2HPO4, PH 7.4), each for 6 minutes, and then repaired in a 98°C sodium citrate (0.01M, PH 6.0) solution for 35 minutes, and then placed in a methanol (containing 0.3% H2O2) solution for 25-30 minutes. Then, the slides were blocked with blocking solution (0.01M / L PBS (containing 2% BSA, 3% Triton X-100)) for 1 hour at room temperature, and the primary antibody was incubated at 4°C overnight. The next day, the slides were washed with PBS (0.01M / L) 3 times, 8 minutes each time. Then, the slides were incubated with secondary antibody (1:500) at room temperature for 1 hour, and washed with PBS (0.01M / L) 3 times, 8 minutes each time. After rinsing with 0.05mol / LTris·HCl (PH7.6), DAB (containing 0.03% H2O2) was used for color development, hematoxylin was used for staining, and the slides were washed with water for 20 minutes for anti-blueing. Finally, the slides were sealed and placed in 75%, 80%, and 95% ethanol for 8 minutes each, and in anhydrous ethanol twice, 8 minutes each time. After ethanol dehydration, xylene was used twice (10 minutes each time), and neutral resin was added to seal the slides.

[0062] Experimental results:

[0063] Realtime-PCR experiments were performed to detect the transcription of C21orf58 mRNA in 25 pairs of tissues. The results showed that the C21orf58 mRNA in 25 pairs of cancer tissues was higher than that in adjacent tissues ( Figure 1 A); Consistent with mRNA transcription, the expression of C21orf58 protein in liver cancer tissues was significantly higher than that in adjacent tissues ( Figure 1 B); Immunohistochemical staining also obtained consistent results, and the staining of C21orf58 protein in liver cancer tissue was stronger than that in adjacent tissues ( Figure 1 C); The results of statistical analysis showed that the expression of C21orf58 protein in liver cancer tissue was significantly higher than that in adjacent tissues ( Figure 1 D). (***P<0.001, **P<0.01, *P<0.05, the data are statistically significant).

[0064] Example 2: Prognostic analysis of C21orf58.

[0065] Among liver cancer patients, patients with high C21orf58 expression had a poor prognosis, with shorter overall survival and disease-free survival than those with low C21orf58 expression ( Figure 2 ).

[0066] Experimental results:

[0067] The data from the GEPIA database were analyzed, and the overall survival (OS) and disease free survival (DFS) of 182 liver cancer patients were analyzed. Kaplan-Meier curves were drawn and it was found that the overall survival time (P=0.012) and disease free survival time (P=0.0015) of patients with high C21orf58 expression (n=182) were significantly shorter than those of patients with low C21orf58 expression (n=182), indicating that high C21orf58 expression is associated with poor prognosis of liver cancer, suggesting that C21orf58 may play the role of a proto-oncogene in the occurrence and development of liver cancer.

[0068] Example 3: C21orf58 promotes the clonogenicity and growth of liver cancer cells in vitro.

[0069] The constructed lentiviral core vector and packaging plasmid were transferred into HEK-293T cells (cells grown in 10 cm culture dishes) by calcium phosphate transfection. The core vector (i.e., the C21orf58 overexpression / knockdown plasmid mentioned later) and packaging plasmid (Addgene) totaled 16 μg, and the ratio was: core plasmid: PAX2 (packaging plasmid, Addgene): pMD2.G (packaging plasmid, Addgene) = 4:3:1. The virus supernatant was collected 24h and 48h after transfection, and the cell debris in the virus solution was filtered with a 0.45 μm filter membrane (Millipore), and the virus solution was collected in a 50 ml centrifuge tube (Beckman). 5 ml of sterile sucrose solution (m / v 20%) was slowly added to the bottom of the centrifuge tube, and centrifuged at 20000 rpm at 4°C for 150 minutes, and the supernatant was discarded. 2 ml of serum-free DMEM was used to dissolve the virus precipitate at 4°C for 8-12h, and the virus was stored at low temperature after aliquoting for later use.

[0070] Taking the infection of six-well plate cells as an example, the concentrated virus solution and serum-free culture medium (DMEM) are mixed in a ratio of 1:1, and 1.5 ml of the virus mixture is added to each well. After 8-12 hours of infection, the virus solution is replaced with fresh culture medium containing 10% FBS. The gene interference virus core plasmid is pLKO.1-puro. After 3 days of cell culture, puromycin (4μg / ml) is added to screen the cells with the transferred gene. After screening, the cell clones are picked and expanded for culture, and then Western Blot is performed to identify and select positive clones. The gene overexpression virus core plasmid is pHAGE-fullEF1a-MCS-IZsGreen. Because the plasmid itself expresses green fluorescent protein (GFP), only the cells need to be expanded for culture. When the cell number is expanded to 2×10 6 When the cells were isolated, the cells with green fluorescence were selected by flow cytometry. The obtained cells were then expanded and cultured, and the gene expression efficiency was further identified by Western Blot.

[0071] The cultured cells were discarded from the culture medium, washed twice with cold PBS buffer, and an appropriate amount of lysis buffer (RIPA: 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 50mM Tris (PH 7.4), Protein Inhibitor Cocktail (Sigma), phosphatase inhibitors (Satancruz)) was added, and the cells were placed on ice for lysis for 16 minutes, and then the cells were scraped and placed in a centrifuge tube, centrifuged at 14000rpm and 4℃ for 18 minutes, and the supernatant protein solution was taken. The protein concentration was determined by Bradford (Sigma) quantitative method. After all protein samples were adjusted to the same concentration with lysis buffer, protein loading buffer was added, and denatured at 100℃ for 5-10 minutes. Equal amounts of protein were added to the SDS-PAGE electrophoresis gel wells for electrophoresis, 80V voltage for 20 minutes to concentrate the protein; 120V voltage was continued until the end of the gel run to separate proteins of different molecular weights. After electrophoresis, the protein was transferred to a PVDF (Millipore) membrane using a wet transfer method on ice. The blocking solution (TBST (150mMNaCl, 25mM Tris (PH7.5), 0.05% Tween20) containing 5% BSA was blocked at room temperature for 1 hour. After removing the blocking solution, the diluted primary antibody solution (2% BSA + TBST solution containing antibodies) was added and incubated with the antibody overnight in the cold storage. On the second day, the primary antibody was recovered, washed three times with TBST, each time for 8 minutes, and the secondary antibody (coupled with horseradish peroxidase, dilution ratio 1:1000) solution was added and incubated at room temperature for 1 hour. After the incubation, the TBST was washed three times, each time for 8 minutes, and TBS was rinsed once (3 minutes), and the substrate (Chemiluminescene) was added for color exposure.

[0072] MTT analysis is used to detect cell growth in vitro. After digesting the cells with trypsin, calculate the cell concentration, adjust the cell number, and add 200 μl of cell solution (containing 1000 cells) to a 96-well plate for culture. The next day, add 20 μl of 5 mg / ml MTT solution to each well. After 5 hours, remove the culture medium, add DMSO (200 μl) to each well to dissolve the precipitate, and measure the liquid absorbance (490 nm) with a spectrophotometer. Repeat the above steps every day or every two days, change the culture medium every three days, set up 3 replicates for each cell each time, and the calculated results are the average ± standard error of the results of three independent experiments.

[0073] After trypsin digestion of cells, calculate the cell concentration, adjust the cell number, and add 200 μl of cell solution (containing 2000-5000 cells) to a 96-well plate for culture. Set up 3 replicate wells for each group. After 36-48 hours of culture, add 20 μl of CCK8 solution to each well, continue to culture for 4 hours, and then perform 450nm detection to obtain the OD value.

[0074] Non-drug detection: After trypsin digestion of cells, calculate the cell concentration, adjust the cell number, add 2 ml of cell solution (containing 2000 cells) to a 6-well plate, and culture the cells in a cell culture incubator at 37°C and 5% CO2, with 3 replicates per group of cells. Replace the culture medium every two days, culture for about a week, discard the culture, wash twice with PBS solution, stain with 0.05% crystal violet solution for 10 minutes, wash with water to remove the floating color, dry and take pictures.

[0075] a. Overexpression virus core plasmid: pHAGE-full-EF1a-MCS-IZsGreen (purchased from Hunan Jiahe Biotechnology Co., Ltd.), size 8246 bp;

[0076] Restriction sites: BamHI: 5'-C^GATCC-3' / XbaI: 5'-T^CTAGA-3';

[0077] The C21orf58 gene fragment was double-digested and ligated with the plasmid vector, and after correct sequencing, the C21orf58 overexpression plasmid was obtained.

[0078] b. Gene interference virus core plasmid: pLKO.1-puro (purchased from Hunan Jiahe Biotechnology Co., Ltd.), size 7032bp;

[0079] Restriction sites: Age I: 5'-A^CCGGT-3' / EcoR I: 5'-G^AATTC-3'.

[0080] The sgRNA sequences are as follows:

[0081] sgRNA1-C21orf58-F: 5'-CACCGGCTGCAGGAGACGACTGTAG-3'; as SEQ

[0082] As shown in ID NO.4;

[0083] sgRNA1-C21orf58-R: 5'-AAACCTACAGTCGTCTCCTGCAGCC-3'; as SEQ ID

[0084] Shown in NO.5;

[0085] or:

[0086] sgRNA2-C21orf58-F: 5'-CACCGAGGATGATCCTTGGCGGGTC-3'; as SEQ ID

[0087] Shown in NO.6;

[0088] sgRNA2-C21orf58-R: 5'-AAACGACCCCGCCAAGGATCATCCTC-3'; as SEQ

[0089] As shown in ID NO.7.

[0090] Experimental results:

[0091] Western Blot assay was used to detect the expression of C21orf58 in stably overexpressed / knockdown C21orf58 liver cancer cell lines. Figure 3 A); Crystal violet ( Figure 3 B) and MTT( Figure 3 CD) experimental results showed that overexpression of C21orf58 promoted the in vitro growth of liver cancer cells HepG2 and MHCC97-H (P<0.01). Reducing the expression of C21orf58 inhibited the in vitro growth of liver cancer cells Huh7 and MHCC97-H (P<0.01, P<0.001).

[0092] Vector refers to the overexpression empty vector plasmid, C21orf58 refers to the C21orf58 overexpression plasmid;

[0093] Ctrl refers to the knockdown empty vector plasmid, sg1 refers to the C21orf58 knockdown sequence 1 plasmid; sg2 refers to the C21orf58 knockdown sequence 2 plasmid.

[0094] Example 4: C21orf58 promotes subcutaneous tumorigenesis of liver cancer cells.

[0095] Male nude mice aged 5 weeks were randomly divided into groups, with more than 4 mice in each group. The cells in the experimental group and the control group were counted and the number of cells in the two groups was adjusted to be the same. After the cell suspension was mixed with Mitrigel (BD) in a ratio of 1:1, 200 μl was injected subcutaneously into the posterior hind leg of the nude mouse. The cell injection volume was 1×10 6 The mice were raised normally. After the tumor was formed, the size of the tumor was observed and the tumor was removed for photographing and recording.

[0096] Experimental results:

[0097] The stable cell line HepG2-C21orf58 and control cells were inoculated subcutaneously into 5-week-old male nude mice. The tumors were removed after 6 weeks and it was found that the tumor volume formed by the overexpression cell line HepG2-C21orf58 was larger than that formed by the control cells ( Figure 4 A), and the weight was also higher than that of the control cell group (P<0.05) ( Figure 4 B); the tumor volume formed by MHCC97-H cells with stable knockdown of C21orf58 was smaller than that of the control group ( Figure 4 C), and the weight was also lower than that of the control group (P<0.001) ( Figure 4 D).

[0098] Example 5: C21orf58 promotes liver cancer cells' resistance to Sorafenib.

[0099] CCK8 detection: After trypsin digestion of cells, calculate the cell concentration, adjust the cell number, and add 200μl cell solution (containing 2000-5000 cells) to a 96-well plate for culture. The 96 wells were divided into Sorafenib and DMSO groups, with corresponding treatment concentrations set for each group and 3 replicates for each concentration. The next day, the complete culture medium containing the corresponding drug and treatment concentration was replaced in the 96 wells. After 36-48h of culture, 20μl CCK8 solution was added to each well. After continuing to culture for 4h, 450nm detection was performed to obtain the OD value and calculate the IC50 value.

[0100] Drug detection: Add 2 ml of cell solution (containing 20,000-50,000 cells) to a 6-well plate, and culture the cells in a cell culture incubator at 37°C and 5% CO2. Set up Sorafenib and DMSO groups, and replace the complete culture medium containing the corresponding concentration of drugs in the corresponding wells the next day. Replace the culture medium every two days, culture for about a week, discard the culture, wash twice with PBS solution, stain with 0.05% crystal violet solution for 10 minutes, wash with water to remove the floating color, dry and take pictures. Experimental results:

[0101] CCK8( Figure 5 A) Experiment and crystal violet ( Figure 5BC) Experimental results showed that overexpression of C21orf58 promoted the resistance of HepG2 liver cancer cells to Sorafenib; reducing the expression of C21orf58 promoted the sensitivity of Huh7 liver cancer cells to Sorafenib.

Claims

1. Use of an agent for inhibiting the expression of C21orf58 gene in the preparation of a preparation for treating liver cancer, wherein the C21orf58 gene sequence is shown in SEQ ID NO.1; The reagent for inhibiting the expression of C21orf58 gene is sgRNA; the sequence of the sgRNA is as follows: sgRNA1-C21orf58-F: 5'- CACCGGCTGCAGGAGACGACTGTAG -3'; sgRNA1-C21orf58-R: 5'- AAACCTACAGTCGTCTCCTGCAGCC -3'; or: sgRNA2-C21orf58-F: 5'- CACCGAGGATGATCCTTGGCGGGTC -3'; sgRNA2-C21orf58-R: 5'-AAACGACCCGCCAAGGATCATCCTC-3'.

2. Use of an agent for inhibiting the expression of the C21orf58 gene in the preparation of a preparation for enhancing the sensitivity of liver cancer to Sorafenib, wherein the C21orf58 gene sequence is as shown in SEQ ID NO.1; the agent for inhibiting the expression of the C21orf58 gene is sgRNA; the sgRNA sequence is as follows: sgRNA1-C21orf58-F: 5'- CACCGGCTGCAGGAGACGACTGTAG -3'; sgRNA1-C21orf58-R: 5'- AAACCTACAGTCGTCTCCTGCAGCC -3'; or: sgRNA2-C21orf58-F: 5'- CACCGAGGATGATCCTTGGCGGGTC -3'; sgRNA2-C21orf58-R: 5'-AAACGACCCGCCAAGGATCATCCTC-3'.

Images