Construction method and application of Toxoplasma gondii TGME49_299780 gene knockout strain

Abstract

The invention discloses a Toxoplasma gondii gene knockout strain, wherein the strain lacks a Toxoplasma gondii dense granule family protein gene (TGME49_299780 gene) as shown in nucleotide sequence SEQ ID No. 1, and also discloses a method for constructing the strain, belonging to the field of biology and genetic engineering. The gene knockout strain ME49Δ299780 constructed by the invention has the advantages of low toxicity, less reproduction in animals, etc., can improve the immunity of animals to Toxoplasma gondii, and has the potential to become an anti-Toxoplasma genetic engineering vaccine.

Description

Technical Field

[0001] The present invention relates to a Toxoplasma gondii gene knockout strain, in particular to a Toxoplasma gondii TGME49_299780 gene knockout strain. It has been identified that the protein encoded by the gene belongs to the Toxoplasma dense granule family protein. The present invention also relates to a construction method of the knockout strain and a use thereof, and belongs to the field of biology and genetic engineering. Background Art

[0002] Toxoplasma gondii (T. gondii) is an intracellular obligate parasite with a complex life cycle. Its intermediate hosts are very broad but its final hosts are single. It is a classic model organism for studying apicomplexan protozoa. Toxoplasma gondii infection can be transmitted among multiple species, including humans. Epidemiological surveys of toxoplasmosis show that toxoplasmosis is widely distributed globally. In infected people with normal immune function, obvious clinical symptoms are generally not shown. The main endangered groups are immunocompromised people or pregnant women. The main clinical symptoms of pregnant patients are miscarriage and stillbirth, which seriously damages the economic development of animal husbandry and causes serious public health and safety issues. Therefore, strengthening the prevention and control of toxoplasmosis is of great significance to human health and the development of animal husbandry.

[0003] At present, drug treatment has limitations in the prevention and control of toxoplasmosis. Inhibitors of the folic acid metabolic pathway, such as pyrimethamine and sulfadiazine, are effective against Toxoplasma tachyzoites, but most individuals infected with Toxoplasma show chronic infection without clinical symptoms. A large number of Toxoplasma exist in the host in the form of bradyzoites, and drugs cannot achieve effective therapeutic effects. Therefore, it is of great value to construct a Toxoplasma vaccine with good immunogenicity and immune protection. In recent years, CRISPR / Cas9 technology has been widely used in Toxoplasma gene editing, providing strong support for the development of Toxoplasma vaccines.

[0004] GRAs are important secretory proteins of Toxoplasma gondii. When the vesicle is formed, GRAs are continuously released into the vesicle space and vesicle membrane in a form similar to exocytosis to exert their functions. A few GRAs also target the host cell nucleus to exert their functions. Current studies have found that GRAs are an important component of the vesicle, and are essential for modifying the vesicle, promoting the maturation of the vesicle and further developing into tissue cysts. They also play an important role in Toxoplasma obtaining energy to complete its parasitic life and evading attacks from the host immune system. Summary of the invention

[0005] The purpose of the present invention is to provide a Toxoplasma TGME49_299780 gene knockout strain and a construction method thereof. The present invention identifies that the protein encoded by the TGME49_299780 gene belongs to the Toxoplasma dense granule family protein. The constructed strain has the advantages of low toxicity, low reproduction in animals, etc., and can provide animals with better immunity against Toxoplasma infection than wild-type strains, and has the potential to prepare anti-Toxoplasma genetic engineering vaccines.

[0006] To achieve the above objectives, the applicant first used the Toxoplasma RHΔku80 strain as the starting strain and constructed a Toxoplasma protein localization strain (referred to as the 299780-3×HA strain). Through indirect immunofluorescence experiments, it was found that the 299780 protein could co-localize with the known Toxoplasma dense granule protein GRA7, thereby proving that the 299780 protein belongs to the Toxoplasma dense granule family.

[0007] Next, the applicant used CRISPR / Cas9 technology to knock out the genes of the starting strain ME49. The method for constructing the knockout strain included constructing the pSAG1-Cas9-TgU6-sg299780 plasmid, preparing the α-299780-5UTR::DHFR::α-299780-3UTR homologous template, co-transferring to the starting strain ME49, and performing pyrimethamine screening, PCR identification, and other steps, and finally obtaining the Toxoplasma gene knockout strain ME49Δ299780. The specific construction method is as follows:

[0008] (1) Using the pSAG1-Cas9-TgU6-sgUPRT plasmid as a template, the target site of the TGME49_299780 gene was designed, primers were designed according to the target site for site-directed mutagenesis, and the sgUPRT in the above template plasmid was replaced with a gRNA specific to the TGME49_299780 gene target site to construct the pSAG1-Cas9-TgU6-sg299780 plasmid;

[0009] (2) Using the genome of the starting strain as a template, primers were designed to amplify the upstream and downstream homologous arms of the TGME49_299780 gene, respectively, and a homologous recombination template containing the upstream and downstream homologous arms of the TGME49_299780 gene was constructed;

[0010] (3) The pSAG1-Cas9-TgU6-sg299780 plasmid constructed in step (1) and the homologous recombination template constructed in step (2) were co-electroporated into the starting strain, and the Toxoplasma gondii TGME49_299780 gene-deficient strain was obtained through drug screening and PCR identification.

[0011] The sequence of the TGME49_299780 gene targeting site is shown in SEQ ID NO: 2, and the primer sequences designed according to the targeting site are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0012] Among them, the primer sequences of the upstream and downstream homology arms of the TGME49_299780 gene are:

[0013] U5α-299780-F: as shown in SEQ ID NO: 5;

[0014] U5α-299780-R: as shown in SEQ ID NO: 6;

[0015] U3α-299780-F: as shown in SEQ ID NO: 7;

[0016] U3α-299780-R: as shown in SEQ ID NO:8.

[0017] Wherein, the vector plasmid of the homologous recombination template is pUC19, and the template also contains a DHFR* drug screening tag.

[0018] Next, the following experiments were carried out using the constructed gene knockout strain ME49Δ299780:

[0019] (1) The virulence test of the knockout strain ME49Δ299780 was conducted: the wild-type strain ME49 was used as the control and 1×10 2 The tachyzoites / mouse were inoculated into female ICR mice of 6 weeks old, with 10 mice in each group, and the survival of mice was recorded within 30 days. The results showed that the survival rate of mice infected with ME49Δ299780 knockout strain was 100% within 30 days, while 60% of mice inoculated with wild-type ME49 died within 30 days, indicating that the virulence of ME49Δ299780 knockout strain was much lower than that of the parasite strain.

[0020] (2) Test of the load of insects in mice infected with ME49Δ299780 strain: 1×10 4 The ME49Δ299780 knockout strain or ME49 wild-type strain tachyzoites were inoculated for 7 days, and the ascites of the mice were collected for quantitative qPCR to analyze the load of worms in the ascites. The results showed that the load of worms in the ascites of mice inoculated with the ME49Δ299780 knockout strain was significantly lower than that in the control group of mice inoculated with the wild-type ME49, indicating that the reproductive capacity of Toxoplasma gondii ME49Δ299780 in mice was reduced.

[0021] (3) The immune protection of ME49Δ299780 strain on mice: 1×10 2Ten 6-week-old ICR female mice were inoculated with 1×10 ME49Δ299780 strain tachyzoites / mouse. After day 30, immunized mice and blank ICR mice were inoculated with 1×10 4 The ME49 or RH wild-type strains were used to observe and record the death of mice, and the mortality rate of mice within 30 days was calculated. The results showed that the ME49Δ299780 strain had good protection against wild-type strain infection in mice and had the potential to become a genetic engineering vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the PCR identification result of 299780-3×HA library. 1.3: RHΔku80 wild type, 2.4: 299780-3×HA library.

[0023] Figure 2 This is the indirect immunofluorescence result of the 299780-3×HA library.

[0024] Figure 3 This is the map of p299780-5UTR::DHFR::299780-3UTR plasmid

[0025] Figure 4 The results of PCR identification of the monoclonal strain of ME49Δ299780 are shown in Figure 1.3.5: wild type ME49, and 2.4.6: mutant strain ME49Δ299780.

[0026] Figure 5 These are the results of the toxicity test of the ME49Δ299780 strain on mice.

[0027] Figure 6 It is the amount of worms in the ascites of mice infected with ME49Δ299780 worm strain.

[0028] Figure 7 The results of the immune protection test of ME49Δ299780 strain on mice. RH tachyzoites (A) and ME49 tachyzoites (B) were injected intraperitoneally 30 days after immunization with ME49Δ299780. DETAILED DESCRIPTION

[0029] The present invention is described in detail below with reference to specific embodiments.

[0030] Example 1: Identification of TGME49_299780 protein

[0031] (1) Starting strain RHΔku80

[0032] RHΔku80 is a type I strain of the genus Toxoplasma of the family Toxoplasma in the order Coccidia. The nucleotide sequence of the target site is shown in SEQ ID NO: 1.

[0033] (2) Construction of pSAG1-Cas9-TgU6-sg299780C plasmid

[0034] ① Use the gRNA online design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design the target site of the target gene, and design the gRNA primer according to the designed target sequence (GGATCCCCCTCGCGTACACT):

[0035] Upstream primer gRNA-299780C-F: 5'-AGTGTACGCGAGGGGGATCCGTTTTAGAGCTAGAAATAGC-3'

[0036] Downstream primer gRNA-R: 5'-AACTTGACATCCCCATTTAC-3'

[0037] ② Prepare the following reaction system in a sterilized PCR tube, where template DNA: pSAG1-Cas9-TgU6-sgUPRT plasmid:

[0038]

[0039] ③PCR reaction conditions are as follows:

[0040]

[0041] ④After the PCR is completed, add 1 μL DpnI directly to the PCR reaction system and digest at 37°C in the PCR instrument for 40 minutes.

[0042] ⑤ Take a new sterilized PCR tube, prepare the following reaction system, and react at 25℃ for 15 minutes in a PCR instrument;

[0043]

[0044] ⑥ Take all the reaction products and transform them into DH5α (100 μL) competent cells, apply LB / Amp plates, and invert and culture at 37°C overnight; pick a single colony and place it in 5 ml LB / Amp liquid culture medium, and shake and culture at 37°C / 180rpm for 10-12 hours until the bacterial solution becomes turbid; take 500 μL of the bacterial solution for sequencing analysis, and the sequencing primer is the M13 reverse primer. If the sequencing results show that the target sequence has been completely replaced, the plasmid is successfully constructed, and the pSAG1-Cas9-TgU6-sg299780C plasmid is extracted using Omega's Endo-free Plasmid Mini Kit II, and the concentration is determined and set aside.

[0045] (3) Preparation of 3×HA-DHFR homologous fragment:

[0046] ① Design upstream and downstream primers with 50bp homology arms according to the intended target site, and use high-fidelity enzyme (Phanta) to amplify the 3×HA-DHFR fragment from the DHFR-containing plasmid pSL24m-Linker-smFP-DHFR-LoxP-T7 (purchased from http: / / www.addgene.org). The upstream and downstream primers are:

[0047] 299780-3×HA-F:

[0048] AGTCGAATCCAGAACAACTGAAGGCAGGCATTCTATTTGTAGTTTTGCATCGCTACCCTACGATGTGCCGGATT

[0049] 299780-3×HA-R:

[0050] GTAACCCAAATTCTCGAGGCAGAACTCGCCAGCACTTGCCGGTTCTTACGCACCGCTTTTCAACAGGAAAAAGC

[0051] The PCR system is as follows:

[0052]

[0053]

[0054] The temperature system is as follows:

[0055]

[0056] ② Recover the target fragment and use NanoDrop2000 to measure the concentration of the recovered product for later use;

[0057] (4) Obtaining the Toxoplasma gondii protein localization strain 299780-3×HA:

[0058] ① Collect the fresh Toxoplasma tachyzoites RHΔku80 described in step (1), filter through a sterile 3 μm pore size filter membrane to remove host cell debris, and centrifuge at 1500 rpm for 5 min; discard the supernatant, and resuspend the parasite precipitate in Cytomix (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4 / KH2PO4, 25 mM HEPES, 2 mM EGTA, 5 mM MgCl2, pH = 7.6) until the parasite weight is 1×10 7 Tachyzoites / ml.

[0059] ② Take about 250-300 μL of the insect suspension into an electroporation cup, add the pSAG1-Cas9-TgU6-sg299780C plasmid in step (2) and the 3×HA-DHFR homologous fragment in step (3), where the DNA molar ratio of the plasmid to the homologous fragment is 5:1, the total amount of transfected DNA is 10 μg, and the total volume is 350 μL.

[0060] ③Use a pipette to mix the DNA and RHΔku80 worm bodies evenly in a 4mm electroporation cup and remove bubbles; place the electroporation cup in a Bio-Rad electroporator and set the settings to 1550V, 25μF, 50Ω, 4mm for two consecutive electric shocks.

[0061] ④ Immediately add 1 ml of insect culture medium (DMEM+2% FBS+double antibody) to the electroporation cup and rinse gently, then transfer the liquid to fresh host cells for culture (T25). At the same time, set up a DNA-free transfection control group and conduct culture observation at the same time.

[0062] ⑤ After 60-80% of the transfected parasites have escaped from the HFF host cells, the cells are lysed to release the parasites from the host cells; 500-2000 μL of the parasite suspension is added to fresh host cells (T25), and 1 μM pyrimethamine is added to the culture medium for screening;

[0063] ⑥ After 3 days of pyrimethamine action, parasite proliferation can be seen in the host cells. When 50% of the parasites escape from the host cells, the cells are lysed to release the parasites. 500-1000 μL of the parasites are transferred to fresh host cells for drug screening.

[0064] ⑦ After 3-5 generations of drug screening, the precipitate was collected by centrifugation to extract genomic DNA (the genomic extraction method was carried out according to the instructions of the genomic DNA extraction kit), and the fragment insertion efficiency was detected using the primers in (Table 1). The presence of bands in both PCR1 and 2 indicated that the homologous arms were successfully integrated into the Toxoplasma genome. The results showed that the 3×HA-DHFR fragment was successfully inserted and the insertion site was correct. The 299780-3×HA drug screening library was successfully constructed ( Figure 1 ).

[0065] Table 1. PCR identification primers for 299780-3×HA drug screening library

[0066]

[0067] (5) Indirect immunofluorescence assay to identify the localization of 299780 protein:

[0068] ① Add a certain amount of 299780-3×HA Toxoplasma gondii tachyzoites to the slide (with grown HFF cells) and grow overnight.

[0069] ②Take out the slide, add PBS and wash three times to clean the worms on the cell surface.

[0070] ③Add 4% paraformaldehyde to fix the cells on the slide, 200 μL / well, and let stand at room temperature for 20 minutes.

[0071] ④ Wash with PBS three times, add 0.1% Triton X-100 to permeabilize the cells, 200 μL / well, and incubate at 37°C for 20 min.

[0072] (3) Wash three times with PBS, add 10% FBS for blocking, 200 μL / well, and incubate at 37°C for 20 min.

[0073] (4) Wash three times with PBS, add different primary antibody sera (mouse HA antibody, rabbit ALD antibody) at certain concentrations, use 1% FBS as the primary antibody diluent, 50 μL / well, and incubate at 37°C for 20 min.

[0074] (5) Wash 5 times with PBS, add different fluorescent secondary antibodies and Hoechst dye for staining cell nuclei at a dilution of 1:1000, use 1% FBS as the secondary antibody diluent, prepare in the dark, 200 μL / well, and incubate at 37°C in the dark for 18 min.

[0075] (6) Wash with PBS five times, remove the slide, drain the water droplets, and place it upside down on a slide with an anti-fluorescence quencher. It can be stored away from light for one week.

[0076] (7) Under a fluorescence microscope, different colors of fluorescence can be observed according to the different wavelengths of fluorescence, thereby observing the protein corresponding to the primary antibody.

[0077] from Figure 2 The experimental results show that the HA tag of RHΔku80 strain does not emit light, while the HA tag of 299780-3×HA strain emits light, indicating that the luminescence of the HA tag is specific and can specifically indicate the location of the 299780 protein. Toxoplasma gondii dense granule protein GRA7 belongs to the Toxoplasma gondii dense granule protein family. The members of this family have similar protein localization, that is, localization in the dense granules of Toxoplasma gondii and the vesicle membrane of Toxoplasma gondii.

[0078] The luminescent position of the HA tag stained with the 299780-3×HA strain can be co-localized with the position of GRA7, indicating that the 299780 protein belongs to the Toxoplasma dense granule family protein.

[0079] Example 2: Construction of Toxoplasma gondii ME49Δ299780 strain

[0080] (1) Starting strain ME49

[0081] ME49 is a type II strain of the genus Toxoplasma of the family Toxoplasma in the order Coccidia, having the TGM49_299780 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0082] (2) Construction of pSAG1-Cas9-TgU6-sg299780 plasmid

[0083] ① Use the gRNA online design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design the target gene targeting site, and design the gRNA primer according to the designed target sequence (TTTCGCACCGCTCCATTATC, SEQ ID NO: 2):

[0084] Upstream primer gRNA-299780-F: 5'-GATAATGGAGCGGTGCGAAAGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 3)

[0085] Downstream primer gRNA-R: 5'-AACTTGACATCCCCATTTAC-3' (SEQ ID NO: 4)

[0086] ② The operation method refers to steps ②-⑥ of (2) in Example 1 to obtain the pSAG1-Cas9-TgU6-sg299780 plasmid for use.

[0087] (3) Preparation of α-299780-5UTR::DHFR::α-299780-3UTR homologous template

[0088] ① According to the Gene ID of the gene to be knocked out, determine the locus of the gene on ToxoDB, and determine the 5' homology arm (α-299780 -5UTR) and 3' homology arm (α-299780 -3UTR) through the genomic sequence where it is located;

[0089] ② Design the 5' homology arm, 3' homology arm, DHFR drug screening tag, and seamless ligation amplification primers of the pUC19 vector according to the method described in the instructions of the multi-fragment seamless ligation kit;

[0090] ③ According to the designed primers (Table 2), the 5' homology arm and 3' homology arm fragments were amplified from the Toxoplasma ME49 genomic DNA using a high-fidelity enzyme (Phanta), and the DHFR fragment was amplified from the plasmid with DHFR (purchased from http: / / www.addgene.org). The pUC19 vector (purchased from http: / / www.addgene.org) was linearized using the designed specific primers, and the above-mentioned target fragments were recovered respectively, and the concentration of the recovered products was determined using NanoDrop2000;

[0091] Table 2. Primers used to construct p299780-5UTR::DHFR::299780-3UTR plasmid

[0092]

[0093] ④ Prepare the following reaction system according to the concentration of the recovered product:

[0094]

[0095] After thorough mixing, react at 37°C for 30 min and place on ice for 5 min;

[0096] ⑤ All 10 μL of the ligation product was transformed into DH5α (100 μL) competent cells, coated with LB / Amp plates, and inverted and cultured at 37°C overnight; a single colony was picked and placed in a sterile PV glass bottle containing 5 ml of LB / Amp liquid culture medium, and cultured at 37°C / 180 rpm for 10 hours until the bacterial solution became turbid; sequencing analysis was performed using M13 forward and reverse primers respectively. If the sequencing results were correct, it was considered that the p299780-5UTR::DHFR::299780-3UTR plasmid was successfully constructed, and the correctly identified bacterial solution was then used for plasmid extraction and stored at -20°C. The map of the correct plasmid is shown in the figure below. Figure 3 shown.

[0097] ⑥Use high-fidelity enzyme to perform PCR amplification on the target fragment α-299780-5UTR::DHFR::α-299780-3UTR. The amplification template is p299780-5UTR::DHFR::299780-3UTR plasmid. The amplification primers are U5α-299780-F upstream primer and U3α-299780-R downstream primer. The target fragment is excised and recovered, and the concentration is determined for later use.

[0098] (4) Obtaining the Toxoplasma gondii gene knockout strain ME49Δ299780

[0099] ① Referring to Example 1, steps ①-⑥ in (4), the pSAG1-Cas9-TgU6-sg299780 plasmid in step (2) and the α-299780-5UTR::DHFR::α-299780-3UTR homologous template in step (3) are electroporated into the Toxoplasma gondii ME49 strain, and the library is screened for drugs using pyrimethamine.

[0100] ② After 3-5 generations of drug screening, the worms were placed in a 96-well plate containing host cells for monoclonal screening (connecting 2 96-well plates), and 2 (calculated amount) tachyzoites were inoculated in each well; the remaining worms were used for genomic DNA extraction (the genome extraction method was carried out according to the operating instructions of the genomic DNA extraction kit), and the primers (Table 3) were used to detect the homologous arm integration efficiency and gene knockout efficiency. The presence of PCR1 bands indicated that the 5' homologous arm of 299780 was integrated into the Toxoplasma genome, and the presence of PCR2 bands indicated that the 3' homologous arm of 299780 was integrated into the Toxoplasma genome. The PCR3 band detected whether the knockout gene 299780 was still in the genome. If the control group ME49 had PCR3 bands, but the transfection experimental group had no PCR3 bands, it meant that 299780 was successfully knocked out.

[0101] Table 3. PCR primers for identification of ME49Δ299780 monoclonal strain

[0102]

[0103] ③ After 12 days of culture in the 96-well plate, observe whether there is a single clone. Use a sterile pipette tip to scrape the host cells containing the single clone from the well, add them to the 24-well plate containing the host cells, and continue to culture. When 70% of the host cells in the 24-well plate are lysed, 150 μL of the worms in the well can be transferred to a new 24-well plate for culture, and the rest is used for DNA extraction to identify the clone;

[0104] ④ Use PCR1, PCR2 and PCR3 to detect the selected monoclonal insect strain. If PCR1 and PCR2 have specific bands but PCR3 has no target band, it means that the monoclonal insect strain is the gene knockout strain ME49Δ299780; continue to expand the insect strain determined to be ME49Δ299780 to T25 culture flask; perform PCR1, PCR2 and PCR3 on the gene knockout strain in the T25 culture flask again. The PCR reaction system is as follows. If it is still a knockout phenotype, it can be frozen after expansion.

[0105] Prepare the following reaction system in a sterilized PCR tube:

[0106]

[0107] The PCR reaction conditions are as follows:

[0108]

[0109] ⑤PCR product identification: After amplification, take 10 μL of PCR product, add 1 μL of 10× nucleic acid loading buffer, mix well, apply sample, 1.0% agarose gel, 1×TAE buffer, 120V, electrophoresis for 20 minutes, observe with gel imaging system, and the PCR identification result is as follows: Figure 4 As shown, it indicates that the monoclonal insect strain of ME49Δ299780 was successfully constructed.

[0110] Example 3 Use of Toxoplasma gondii ME49Δ299780 strain

[0111] (1) Diluted injection of knockout strain ME49Δ299780

[0112] ① Diluted injection formula

[0113]

[0114] ② Preparation method of diluted injection solution:

[0115] The mixture was mixed with a magnetic stirrer for 10 min and sterilized by filtration using a 0.22 μm filter.

[0116] (2) Virulence experiment of ME49Δ299780 knockout strain on mice

[0117] ① Use HFF cells to culture Toxoplasma gondii tachyzoites in vitro until 30-50% of the parasites escape from the cells; discard the culture medium in the original culture bottle, wash away the escaped parasites and residual culture medium with PBS, and add fresh diluent without FBS.

[0118] ② Scrape the cells with a disposable cell scraper, and repeatedly blow the suspension 8-10 times with a 5ml syringe to rupture the intraparasitic vesicles and allow the parasites to escape. Filter and purify the parasites with a sterile 3μm pore size filter membrane; use a cell counting plate to count and dilute the parasite suspension.

[0119] ③ According to 100 worms / mouse, 6-week-old female ICR mice were intraperitoneally inoculated, with 10 mice in each group. The survival of the mice was recorded every day. The results were statistically analyzed after 30 days. Figure 5 From the experimental results, it can be seen that no mice inoculated with the ME49Δ299780 knockout strain died within 30 days, with a survival rate of 100%, while 60% of the mice inoculated with the wild-type ME49 died within 30 days, indicating that the virulence of the ME49Δ299780 knockout strain is much lower than that of the parasite-producing strain.

[0120] (3) Experiment on the load of ME49Δ299780 knockout worms in mouse ascites

[0121] Different groups of 6-week-old female ICR mice were inoculated with 1×10 4 The knockout strains were inoculated intraperitoneally, with 5 mice in each group, and the control group was inoculated with an equal dose of wild-type ME49 worms. Seven days after infection, the mice were euthanized and injected intraperitoneally with 5 ml of normal saline. The mixture was mixed and the ascites of the mice was collected. 1 / 20 of the mixed ascites was taken to extract genomic gDNA. The genomic extraction method was carried out according to the operating instructions of the genomic DNA extraction kit.

[0122] 5 ml of saline was injected into blank ICR mice, and then removed to form a negative control solution. 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 Each Toxoplasma gondii tachyzoite ME49 was mixed with 2 ml of negative control solution, and 100 μL of the mixed solution was taken to extract genomic gDNA. The genomic extraction method was carried out according to the instructions of the genomic DNA extraction kit. The load qPCR was performed, and the primers used for qPCR are shown in Table 4.

[0123] Table 4. qPCR primers for ME49Δ299780 insect load

[0124]

[0125] Prepare the following reaction system in a 96-well Hard-shell-PCR-Plates plate:

[0126]

[0127]

[0128] The PCR reaction conditions are as follows:

[0129]

[0130] qPCR results Figure 6 As shown, the amount of worms in the ascites of mice inoculated with the ME49Δ299780 knockout strain was significantly lower than that in the control group of mice inoculated with the wild-type ME49, indicating that Toxoplasma gondii ME49Δ299780 has no obvious reproduction in the mice and can be effectively eliminated by the host.

[0131] (4) Experiment on the immune protection of ME49Δ299780 knockout strain in mice

[0132] 1×10 2The ICR mice were inoculated with 1×10 tachyzoites per mouse, with 5 mice in each group. 30 days later, the immunized mice and the unimmunized control ICR mice (5 mice in each group) were inoculated with 1×10 4 ME49 wild-type strain or RH wild-type strain.

[0133] Observe and record the death of mice, and count the mortality of mice after 30 days. Figure 7 All mice in the RH control group died within 30 days after infection, and only 20% of mice in the ME49 control group survived within 30 days. Mice immunized with ME49Δ299780 were re-infected with high-dose RH or ME49 wild-type strains, and all survived after 30 days. This shows that the ME49Δ299780 strain has good protection against the toxicity of wild-type strains in mice and has the potential to become a genetic engineering vaccine.

Claims

1. Use of a Toxoplasma gondii gene knockout strain in the preparation of a Toxoplasma gondii vaccine, characterized in that: The parasite strain is a Toxoplasma gondii ME49 strain in which the nucleotide sequence of the Toxoplasma dense granule family protein gene TGME49_299780 gene shown in SEQ ID No.1 has been knocked out. The parasite strain can be cultured normally in vitro, the parasite body can grow and replicate normally, but the virulence in vivo is weakened and animals can be induced to produce immune protection against Toxoplasma RH or ME49.

2. The use according to claim 1, characterized in that The method for constructing the Toxoplasma gondii gene knockout strain comprises the following steps: (1) Using pSAG1-Cas9-TgU6-sg UPRT The target site of TGME49_299780 gene was designed based on the plasmid, and primers were designed for site-directed mutagenesis according to the target site. UPRT Replace with gRNA specific to the TGME49_299780 gene target, and construct the pSAG1-Cas9-TgU6-sg299780 plasmid; (2) Using the genome of the worm strain as a template, primers were designed to amplify the upstream and downstream homologous arms of the TGME49_299780 gene, respectively, and a homologous recombination template containing the upstream and downstream homologous arms of the TGME49_299780 gene was constructed; (3) The pSAG1-Cas9-TgU6-sg299780 plasmid constructed in step (1) and the homologous recombination template constructed in step (2) were co-electroporated into the starting strain, and the Toxoplasma gondii TGME49_299780 gene knockout strain was obtained through drug screening and PCR identification. The sequence of the TGME49_299780 gene targeting site is shown in SEQ ID NO: 2; The primer sequences of the upstream and downstream homology arms of the TGME49_299780 gene are: U5α-299780-F: as shown in SEQ ID NO: 5; U5α-299780-R: as shown in SEQ ID NO: 6; U3α-299780-F: as shown in SEQ ID NO: 7; U3α-299780-R: as shown in SEQ ID NO:

8.

3. The use according to claim 2, characterized in that: The primer sequences of the TGME49_299780 gene targeting site are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

4. The use according to claim 2, characterized in that: The vector plasmid of the homologous recombination template is pUC19.

5. The use according to claim 2, characterized in that: The homologous recombination template contains DHFR* Drug screening label.

Images