A fermented lactobacillus and its application in preparations for improving hyperlipidemia

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a fermented lactobacillus and its application in a preparation for improving hyperlipidemia. The strain is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration Committee, and the deposit number is CGMCC No. 25738. The cholesterol removal rate of the strain is as high as 55.2%, and it can significantly reduce the levels of triglycerides, cholesterol and low-density lipoprotein in the body's serum, and promote the secretion of short-chain fatty acids in the intestine, significantly improve the pathological condition of mouse liver, thereby effectively improving hyperlipidemia; and it has no side effects and high safety.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a fermented lactobacillus and application thereof in a preparation for improving hyperlipidemia. Background Art

[0002] Hyperlipidemia is a disease caused by lipid metabolism disorder in the body. This disorder includes abnormal increase of serum cholesterol (TC), triglyceride (TG), low-density lipoprotein (LDL-C) and abnormal decrease of high-density lipoprotein (HDL-C). If it is not controlled and treated in time, it will cause more serious diseases. At present, the prevalence of dyslipidemia in adults in my country is 18.6%, and it is estimated that there are 160 million people with dyslipidemia in the country. The prevalence of different types of dyslipidemia is 2.9% for hypercholesterolemia, 11.9% for hypertriglyceridemia, and 7.4% for low high-density lipoproteinemia. Another 3.9% of people have marginally elevated blood cholesterol. In recent years, the incidence of hyperlipidemia has increased year by year, and the patient population is getting younger and younger.

[0003] At present, it can be improved through lifestyle such as diet therapy; if blood lipids are still abnormal after improvement, some lipid-lowering drugs should be appropriately added according to the presence and amount of coronary heart disease and diseases and risk factors equivalent to coronary heart disease. However, many drugs that can lower blood lipids on the market now have serious side effects. Even in healthy people, these drugs often cause abdominal pain, allergic reactions, emotional imbalance, hair loss, vision changes, headaches, sore throats and muscle degeneration.

[0004] Studies have found that people who regularly drink yogurt generally have lower blood lipid levels, and correlation analysis shows that there is a correlation between drinking yogurt and low blood lipid levels, revealing the possibility that probiotics have the ability to lower the body's blood lipid levels; in addition, the metabolites of probiotics, short-chain fatty acids, have also been reported to have a regulatory effect on blood lipids; and the intake of probiotics is usually not accompanied by side effects, providing a higher level of safety for the body.

[0005] Therefore, it is of great significance to discover a probiotic that can improve hyperlipidemia. Summary of the invention

[0006] In view of the above problems, one of the purposes of the present invention is to provide a fermented Lactobacillus (Lactobacillusfermentum), which can significantly reduce the levels of triglycerides, cholesterol and low-density lipoprotein in serum, and can significantly promote the secretion of short-chain fatty acids in the intestine, and significantly improve the liver pathological condition of mice, thereby effectively improving hyperlipidemia.

[0007] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0008] The present invention provides a Lactobacillus fermentum, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration with a deposit number of CGMCC No.25738.

[0009] Another aspect of the present invention provides a composition comprising one or more combinations of the following substances: (a) the fermented Lactobacillus; (b) a lysate of the fermented Lactobacillus; (c) a culture of the fermented Lactobacillus; (d) a fermented broth of the fermented Lactobacillus.

[0010] In another aspect, the present invention provides a preparation, which comprises the above-mentioned Lactobacillus fermentum or the above-mentioned composition, and a carrier, wherein the carrier is a pharmaceutically acceptable carrier.

[0011] In another aspect, the present invention provides a use of the above-mentioned Lactobacillus fermentum or the above-mentioned composition in the preparation of a preparation for improving hyperlipidemia.

[0012] The preservation information of Lactobacillus fermentum in the present invention is as follows: preservation institution: General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC); preservation address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; preservation date: September 16, 2022; preservation number: CGMCC No.25738; classification name: Lactobacillus fermentum.

[0013] The beneficial effects of the present invention include: the cholesterol removal rate of the fermented lactobacillus provided by the present invention is as high as 55.2%, and it can significantly reduce the levels of triglycerides, cholesterol and low-density lipoprotein in body serum, and promote the secretion of short-chain fatty acids in the intestine, and significantly improve the pathological condition of mouse liver, thereby effectively improving hyperlipidemia; and it has no side effects and is highly safe. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the colony morphology of Lactobacillus fermentum TY-S11;

[0015] Figure 2 This is the Gram stain result of Lactobacillus fermentum TY-S11;

[0016] Figure 3 Cholesterol-OD 550 nm Value standard curve;

[0017] Figure 4 is the cholesterol removal rate of 74 bacterial strains;

[0018] Figure 5 The graphs are the food intake curves of mice in each group;

[0019] Figure 6 The water drinking curve of mice in each group;

[0020] Figure 7 The weight curve of mice in each group;

[0021] Figure 8 is the level of triglyceride in the serum of mice in each group;

[0022] Fig. 9 is the total cholesterol level in the serum of mice in each group;

[0023] Fig.10 is the level of low-density lipoprotein in the serum of mice in each group;

[0024] Fig.11 is the triglyceride level in the liver of mice in each group;

[0025] Fig.12 is the cholesterol level in the liver of mice in each group;

[0026] Fig.13 Oil red staining images of livers of mice in each group (200×);

[0027] Fig.14 is the propionic acid level in the feces of mice in each group;

[0028] Fig.15 is the acetic acid level in the feces of mice in each group;

[0029] Fig.16 is the butyrate level in the feces of mice in each group;

[0030] In the above figures, the experimental data are expressed as mean ± standard error (mean ± SEM). "*", "**", "***", and "****" indicate that there is a statistical difference between the two groups, indicating p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively. DETAILED DESCRIPTION

[0031] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0032] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0033] The embodiment of the present invention provides a Lactobacillus fermentum (Lactobacillus fermentum) (hereinafter also referred to as Lactobacillus fermentum TY-S11), which is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration with a deposit number of CGMCC No.25738.

[0034] It should be noted that the fermented lactobacillus in the present invention is derived from the feces of the long-lived elderly in Jiangjin, Chongqing. The Gram staining result shows that the lactobacillus is rod-shaped and is determined to be a Gram-positive bacterium (G + ); and amplifying the 16S rDNA sequence by PCR, and determining that the 16S rDNA sequence comprises the sequence shown in SEQ ID NO.1.

[0035] Another embodiment of the present invention further provides a composition, which includes one or more combinations of the following substances: (a) the fermented Lactobacillus; (b) the lysate of the fermented Lactobacillus; (c) the culture of the fermented Lactobacillus; (d) the fermented broth of the fermented Lactobacillus.

[0036] It should be noted that in the above-mentioned composition, fermented lactobacillus TY-S11 can be prepared into a composition that can be used for medicine. In addition, when fermented lactobacillus TY-S11 is prepared into a composition, the bacteria can be directly introduced into the composition in the form of live bacteria to play a role, or the bacteria can be inactivated by existing technical means and then introduced into the composition in the form of inactivated bacteria to play a role; the lysate of the bacteria can also be introduced into the composition to play a role; the products such as proteins, peptides, secretions or metabolites obtained by culturing the bacteria can also be introduced into the composition to play a role; the fermented liquid after the bacteria is fermented can also be introduced into the composition to play a role. In the specific use process, different forms of the bacteria can be selected according to specific needs to be prepared into a composition to play a role.

[0037] In some specific embodiments, the composition further comprises one or more combinations of probiotics, prebiotics, dietary fiber and Chinese patent medicine.

[0038] It should be noted that the above-mentioned fermented Lactobacillus TY-S11 and its different forms can also be used in combination with one or more of probiotics, dietary fiber and pharmaceutically active compounds; for example, fermented Lactobacillus TY-S11 can be used in combination with Bacillus subtilis, Bifidobacterium or lactic acid bacteria so that the composition has the efficacy of fermented Lactobacillus TY-S11 and other probiotics; for another example, fermented Lactobacillus TY-S11 can be used in combination with prebiotics, which can provide an energy source for fermented Lactobacillus TY-S11, thereby enhancing the effect of fermented Lactobacillus TY-S11; for another example, fermented Lactobacillus TY-S11 can be used in combination with dietary fiber, which can assist fermented Lactobacillus TY-S11 in colonization, thereby improving the effect of fermented Lactobacillus TY-S11; for another example, fermented Lactobacillus TY-S11 can also be used in combination with Chinese patent medicine to form a composition, while exerting the effects of fermented Lactobacillus TY-S11 and Chinese patent medicine.

[0039] Still another embodiment of the present invention provides a preparation, which includes the above-mentioned Lactobacillus fermentum TY-S11 or the above-mentioned composition, and a carrier, wherein the carrier is a pharmaceutically acceptable carrier.

[0040] It should be noted that the composition comprising fermented lactobacillus TY-S11 and its different forms can be prepared into medicine by adding pharmaceutical carriers. Pharmaceutically acceptable carriers are known in the art and may be selected according to dosage forms. For example, diluents (such as starch, dextrin, sucrose or mannose, etc.), absorbents (calcium sulfate, calcium hydrogen phosphate or light magnesium oxide, etc.), binders (polyvidone, syrup or hypromellose, etc.), wetting agents (water, etc.) or disintegrants (dry starch, sodium hydroxymethyl starch or cross-linked polyvinylpyrrolidone, etc.) are mainly used in the preparation of tablets; for example, bulking agents, suspending agents, emulsifiers or coloring agents are mainly used in the preparation of liquids.

[0041] In some specific embodiments, the above-mentioned preparation can be a tablet, a pill, a capsule, a powder, a gel, a granule or a liquid. It should be noted that the above-mentioned solid dosage forms such as tablets, pills, granules or capsules can be in the form of probiotic tablets, probiotic sugar pills, probiotic powders or probiotic capsules.

[0042] Still another embodiment of the present invention provides a use of the above-mentioned fermented lactobacillus or the above-mentioned composition in the preparation of a preparation for improving hyperlipidemia.

[0043] In some specific embodiments, the application includes: application of the fermented Lactobacillus TY-S11 or the composition in the preparation of a preparation for reducing the triglyceride level and / or the total cholesterol level and / or the low-density lipoprotein level in serum.

[0044] It should be noted that, generally hyperlipidemia includes high cholesterol, and the total cholesterol level in the body increases, that is, when the total cholesterol (total cholesterol refers to the sum of cholesterol contained in all lipoproteins in the blood, the total cholesterol level of the crowd mainly depends on genetic factors and lifestyle, and the recommended cholesterol value for adults should not be too high, and the ideal value is <5.5.17mmol / L) level in the body is greater than 5.17mmol / L, it belongs to hyperlipidemia, and reducing the cholesterol level in serum is one of the effective ways to treat hyperlipidemia. The fermented lactobacillus TY-S11 of the present invention can significantly reduce the total cholesterol level in the body's serum. In some specific embodiments, the serum total cholesterol level of the high-fat and high-cholesterol model mice using the fermented lactobacillus TY-S11 of the present invention is reduced by about 39.1% compared with the serum total cholesterol level of the high-fat and high-cholesterol model mice not using the fermented lactobacillus TY-S11, indicating that the fermented lactobacillus TY-S11 of the present invention has a significant effect on reducing total cholesterol in serum.

[0045] It should also be noted that triglycerides are risk factors for cardiovascular diseases, and serum triglyceride levels are affected by age, gender, and diet. Increased serum triglycerides can be seen in the intake of large amounts of triglycerides and secondary to certain diseases such as diabetes, atherosclerosis, etc. The fermented lactobacillus TY-S11 of the present invention can significantly reduce the level of triglycerides in the body's serum. In some specific embodiments, the serum triglyceride level of high-fat and high-cholesterol model mice using the fermented lactobacillus TY-S11 of the present invention is reduced by about 19.3% compared to the serum triglyceride level of high-fat and high-cholesterol model mice not using the fermented lactobacillus TY-S11, indicating that the fermented lactobacillus TY-S11 of the present invention has a significant effect in reducing serum triglycerides.

[0046] It should also be noted that low-density lipoprotein is a lipoprotein particle that carries cholesterol into peripheral tissue cells and can be oxidized into oxidized low-density lipoprotein; when low-density lipoprotein, especially oxidatively modified low-density lipoprotein, is excessive, the cholesterol it carries accumulates on the arterial wall, which can easily cause arteriosclerosis. The fermented lactobacillus TY-S11 of the present invention can significantly reduce the level of low-density lipoprotein in the body's serum. In some specific embodiments, the low-density lipoprotein level of high-fat and high-cholesterol model mice using the fermented lactobacillus TY-S11 of the present invention is reduced by about 37.9% compared with the low-density lipoprotein level of high-fat and high-cholesterol model mice not using fermented lactobacillus TY-S11, indicating that the fermented lactobacillus TY-S11 of the present invention has a significant effect in reducing low-density lipoprotein.

[0047] In some specific embodiments, the above application includes one or more of the following combined applications: (a) application of the above fermented Lactobacillus TY-S11 or the above composition in the preparation of a preparation for reducing triglyceride levels and / or cholesterol levels in the liver; (b) application of the above fermented Lactobacillus TY-S11 or the above composition in the preparation of a preparation for promoting the secretion of short-chain fatty acids in the intestine

[0048] It should be noted that lipids can be divided into two categories: fats and lipids. Fats include triglycerides, and lipids include cholesterol. Triglycerides are easily accumulated in fat, and too high levels may even lead to the risk of fatty liver. The liver is the center of lipid metabolism, and 70%-80% of cholesterol in the human body is synthesized by the liver, so it is of great significance to detect lipid levels in the liver. The fermented lactobacillus TY-S11 of the present invention can significantly reduce the levels of triglycerides and cholesterol in the liver of the body. In some specific embodiments, the triglyceride level in the liver of high-fat and high-cholesterol model mice using the fermented Lactobacillus TY-S11 of the present invention is reduced by about 19.4% compared with the triglyceride level in the liver of high-fat and high-cholesterol model mice not using the fermented Lactobacillus TY-S11, indicating that the fermented Lactobacillus TY-S11 of the present invention has a significant effect on lowering triglycerides in the liver; in addition, the cholesterol level in the liver of high-fat and high-cholesterol model mice using the fermented Lactobacillus TY-S11 of the present invention is reduced by about 52.2% compared with the cholesterol level in the liver of high-fat and high-cholesterol model mice not using the fermented Lactobacillus TY-S11, indicating that the fermented Lactobacillus TY-S11 of the present invention has a significant effect on lowering cholesterol in the liver.

[0049] It should also be noted that short-chain fatty acids are the final metabolites produced by intestinal bacterial fermentation of carbohydrates that cannot be digested by the human body, including acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid and valeric acid, etc., of which more than 90% of short-chain fatty acids are acetic acid, propionic acid and butyric acid. Short-chain fatty acids can affect the synthesis of lipid substances, improve lipid metabolism abnormalities caused by a high-fat diet, and at the same time increase the excretion of bile acid and reduce the total cholesterol level in the blood. The fermented Lactobacillus TY-S11 of the present invention can significantly promote the secretion of short-chain fatty acids in the intestine and increase the level of short-chain fatty acids in the intestine; in some specific embodiments, the levels of acetate, propionate and butyrate in the liver of high-fat and high-cholesterol model mice using the fermented Lactobacillus TY-S11 of the present invention are lowered by about 28.5% (acetic acid), about 68.2% (propionic acid) and about 78.2% (butyric acid) respectively compared with the levels of acetate, propionate and butyrate in the liver of high-fat and high-cholesterol model mice not using the fermented Lactobacillus TY-S11, indicating that the fermented Lactobacillus TY-S11 of the present invention has a significant effect on promoting the secretion of short-chain fatty acids in the intestine of the body.

[0050] It should also be noted that the fermented Lactobacillus TY-S11 in the present invention can simultaneously reduce the levels of liver triglycerides and cholesterol in the body and promote the secretion of short-chain fatty acids in the intestine, thereby simultaneously reducing the levels of serum triglycerides, total cholesterol and low-density lipoprotein in the body, thereby synergistically achieving the purpose of improving hyperlipidemia.

[0051] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0052] In the following examples, MRS liquid culture medium was provided by Beijing Luqiao Technology Co., Ltd.

[0053] In the following examples, the fermented Lactobacillus used in the present invention is also called TY-S11 or fermented Lactobacillus TY-S11.

[0054] Example 1 Isolation, purification and identification of TY-S11

[0055] (1) Experimental Materials

[0056] Collect stool samples from centenarians in Jiangjin, Chongqing: Collect stool without urine contamination, use the spoon of a stool sampler to collect 4-5 spoons (about 20 grams) of stool in a stool sampler filled with 20 mL of 30% glycerol, and tighten the lid.

[0057] (2) Isolation and purification of TY-S11

[0058] Pipette 1 mL of sample into 9 mL of sterile saline to obtain 10 -1 diluent, then pipette 1mL 10 -1 dilute in 9 mL of sterile saline to obtain 10 -2 Dilution, follow this procedure to obtain 10 -3 , 10 -4 , 10 -5 and 10 -6 Dilution. Take 200 μL of samples with different dilutions (10 -3 , 10 -4 , 10 -5 and 10 -6 ), spread them on MRS solid culture medium respectively, and culture them anaerobically at 37℃ for 24h. Then observe the morphology of colonies on the plates, select single colonies with different morphologies and separate the strains by plate streak method, then pick another single colony from the streaked plate for further streak purification, repeat this streak operation until the purified strains are obtained, and observe the morphology by Gram staining.

[0059] The colony morphology of the strains Figure 1As shown, after the strain was purified, a single colony was formed in the solid culture medium. The colonies had a consistent morphology, were hemispherical, white and translucent, with a smooth and moist surface and flat edges.

[0060] Gram staining results Figure 2 As shown, purple cells were observed under a microscope after Gram staining ( Figure 2 The original image is purple, and the shape is short rod-shaped, which is determined to be Gram-positive bacteria (G + ).

[0061] (3) PCR amplification of 16S rDNA sequence

[0062] PCR amplification was performed using a 25 μL reaction system: 1 μL template, 1 μL upstream primer (SEQ ID NO.2 (agagtttgatcctggctcag)) (10 μM), 1 μL downstream primer (SEQ ID NO.3 (tacgacttaaccccaatcgc)) (10 μM), 12.5 μL 2×Taq PCR Master Mix, and the mixture was made up to 25 μL with sterile ultrapure water. PCR amplification conditions: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, for a total of 35 cycles; 72°C end extension for 10 min. After sequence amplification, Sangon Biotech (Shanghai) Co., Ltd. was commissioned to sequence the qualified PCR amplification products, and the measured sequence was shown in SEQ ID No. 1. After obtaining the sequence, BLAST (http: / / www.ncbi.nlm.nih.gov / BLAST) was used to search and perform similarity comparison and homology analysis in GenBank, and the results of 16SrDNA homology analysis showed that TY-S11 was fermented Lactobacillus.

[0063] Example 2 Effect of TY-S11 on cholesterol degradation

[0064] (1) Cultivation and treatment of strains

[0065] The strains preserved in glycerol at -80°C were inoculated into 5 mL of MRS liquid culture medium at a 2% inoculation rate, and then cultured anaerobically at 37°C for 24 h to activate the strains for 3 generations.

[0066] (2) Preparation of reagents

[0067] Weigh 0.5 g of cholesterol powder, dissolve it in anhydrous ethanol by heating and adjust the volume to 50 mL to obtain a 10.0 mg / mL cholesterol solution; sterilize the above solution with a 0.45 μm microporous filter membrane, add it to sterile MRS liquid culture medium at 1% (v:v) to obtain a 0.1 mg / mL cholesterol culture medium, which is prepared and used immediately.

[0068] Weigh 50 mg of o-phthalaldehyde and dilute to 50 mL with anhydrous ethanol to obtain a 1 mg / mL o-phthalaldehyde working solution, which was refrigerated at 4°C for later use.

[0069] Mix glacial acetic acid and concentrated sulfuric acid in a ratio of 1:1 (v:v) to obtain a mixed acid and store it at room temperature.

[0070] (3) Drawing of standard curve

[0071] Take out 5 test tubes and number them 1-5, add 0, 0.1mL, 0.2mL, 0.3mL, 0.4mL and 0.5mL of cholesterol culture medium in sequence, and add glacial acetic acid to make the 5 test tubes full of 0.5mL; add 0.2mL of o-phthalaldehyde working solution to each test tube, shake and mix, let stand for 10min, then add 4.0mL of mixed acid, mix evenly, let stand at room temperature for 10min, place the reaction solution in a 96-well plate, and use the cholesterol concentration as the horizontal axis, OD 550 nm The standard curve is drawn with the value as the vertical axis, such as Figure 3 shown.

[0072] (4) Determination of cholesterol removal rate

[0073] The activated bacterial suspension was added to 5 mL of cholesterol culture medium at an inoculum volume of 3% (v:v); the culture medium just inoculated with bacteria was centrifuged at 4°C and 9000 r / min for 10 min, 0.5 mL of the supernatant was taken, 0.2 mL of o-phthalaldehyde working solution was added, and the mixture was allowed to stand for 10 min after being fully shaken, 4.0 mL of mixed acid solution was added, and the mixture was allowed to stand at room temperature for 10 min. The reaction solution was placed in a 96-well plate, and its OD was measured. 550 nm The OD value of the inoculated bacteria and the cholesterol medium cultured at 37℃ for 24h were also measured according to the above steps. 550 nm The cholesterol content in the fermentation broth was determined according to the fitting equation of the cholesterol standard curve, and the cholesterol removal rate was calculated according to the following formula:

[0074]

[0075] Among them, A is the cholesterol content in the supernatant after culturing at 37°C for 24 hours; B is the cholesterol content in the supernatant before inoculation of the bacteria.

[0076] The cholesterol removal rates of 74 lactic acid bacteria were calculated according to the above calculation method. The results are as follows: Figure 4 As shown, TY-S11 has the highest cholesterol removal rate (55.2%), indicating that it has high cholesterol degradation ability and has the potential to alleviate hyperlipidemia.

[0077] Example 3 Effect of TY-S11 on improving hyperlipidemia

[0078] (1) Cultivation and treatment of strains

[0079] The strains were frozen in glycerol at -80°C and inoculated into 5 mL of MRS liquid medium at a 2% inoculum, and then cultured anaerobically at 37°C for 24 h to activate the strains for three generations; the activated bacterial solution was centrifuged at 10,000 r / min at 4°C for 10 min, the supernatant was discarded, and the bacteria were collected; the bacteria were washed with physiological saline, centrifuged again, and repeated twice to obtain bacterial mud, which was resuspended with 30% (m / v) sucrose solution, frozen at 80°C for use in animal experiments; before use, the solution was centrifuged at 10,000 r / min at 4°C for 10 min, the supernatant was discarded, and the solution was graded diluted with physiological saline, and the number of viable bacteria was counted by pouring method to calculate the colony forming unit (CFU); according to the counting results, the concentration of the bacterial solution was adjusted to 10 with physiological saline 9 CFU / mL, and obtain the bacterial suspension for oral administration.

[0080] (2) Experimental mouse grouping and intervention

[0081] Ten SPF wild-type male C57BL / 6 mice and ten SPF male ApoE - / - Twenty mice, all 8 weeks old, were housed in a standardized laboratory at room temperature of 25±2°C, relative humidity of 50±5%, and 12h light / 12h dark. The experiment began after one week of adaptive feeding. After the adaptation period, C57BL / 6 mice served as the blank group, and ApoE - / - The mice were randomly divided into a model group and a TY-S11 group, with 10 mice in each group.

[0082] The experimental period was 42 days, during which the mice in the blank group consumed ordinary feed, and the mice in the model group and TY-S11 group consumed high-fat and high-cholesterol feed. The specific formula is shown in Table 1. In addition, all groups of mice were gavaged daily. The mice in the blank group and the model group were gavaged with normal saline (200 μL), and the mice in the TY-S11 group were gavaged with the above-mentioned bacterial suspension (200 μL). The gavage time was kept consistent every day.

[0083] Table 1 High-fat and high-cholesterol feed formula

[0084]

[0085]

[0086] (3) Monitoring of mouse growth performance during the experiment

[0087] The mice were recorded for 42 days during the experimental period, with their weight recorded weekly and their food intake and water intake recorded daily (their food intake, water intake and weight changes can reflect their health status to a certain extent).

[0088] The statistical chart of the changes in food intake, water intake and body weight of mice during the experiment is as follows: Figure 5 , Figure 6 and Figure 7 As shown, during the entire experimental period, the food intake and water intake of the mice in the model group and TY-S11 group were not significantly reduced compared with the normal group; in terms of body weight, the mice in the model group and TY-GS11 group gained weight slightly compared with the normal group. The above results indicate that the high-fat and high-cholesterol feed did not affect the normal eating of mice, and Lactobacillus paracasei TY-G05 had no toxic side effects.

[0089] (4) Mouse sample collection and processing

[0090] The experimental period lasted for 42 days, after which the mice were sacrificed; the mice were fasted but not watered for 16 hours the day before being sacrificed, and their feces were collected in centrifuge tubes, immediately frozen in liquid nitrogen and stored in a -80°C refrigerator; the eyeballs were removed to collect blood, the blood was allowed to stand at 4°C for 1 hour, centrifuged at 3000r / min for 15 minutes, and the upper serum was carefully collected; the mice were dissected to separate the liver tissue, which was immediately frozen in liquid nitrogen and stored in a -80°C refrigerator.

[0091] (5) Determination of serum lipid levels in mice

[0092] The refrigerated serum in step (4) was taken out and blood lipids were detected using an automatic biochemical analyzer (blood lipids mainly include total cholesterol, triglycerides and low-density lipoprotein cholesterol, which is one of the core indicators for measuring the severity of hyperlipidemia).

[0093] Serum triglyceride level test results Figure 8 As shown, the serum triglyceride level of mice in the blank group was 0.71mmol / L, and that of the model group was 1.19mmol / L. The serum triglyceride level of the model group was significantly higher than that of the blank group (p<0.0001), while the serum triglyceride level of mice in the TY-S11 group was 0.96mmol / L, which was significantly lower than that of the model group (reduced by about 19.3%) (p<0.01).

[0094] The results of serum total cholesterol level test are as follows Fig. 9 As shown, the serum total cholesterol level of mice in the blank group was 2.55mmol / L, and that in the model group was 27.76mmol / L. The serum total cholesterol level in the model group was significantly higher than that in the blank group (p<0.0001), while the serum total cholesterol level in the TY-S11 group was 16.91mmol / L, which was significantly lower than that in the model group (reduced by about 39.1%) (p<0.05).

[0095] The results of serum low-density lipoprotein level test are as follows Fig.10 As shown, the serum low-density lipoprotein level of mice in the blank group was 0.24mmol / L, and that of the model group was 15.45mmol / L. The serum low-density lipoprotein level of the model group was significantly higher than that of the blank group (p<0.0001), while the serum low-density lipoprotein level of mice in the TY-S11 group was 9.59mmol / L, which was significantly lower than that of the model group (reduced by about 37.9%) (p<0.0001).

[0096] The above results indicate that Lactobacillus fermentum TY-S11 has the effect of regulating blood lipids.

[0097] (6) Determination of lipid levels in mouse liver

[0098] The liver refrigerated in the above (4) was taken out, 0.5 g was cut and accurately weighed, 5 mL of a mixture of methanol and chloroform (volume ratio 2:1) was added, and the liver tissue was fully ground using a tissue homogenizer (60 Hz, homogenization time 10 s / time, interval 30 s, 5 times in a row, at 4°C) to homogenize the liver tissue; after complete grinding, the ground mixture was transferred to a graduated test tube, and the grinder was rinsed with 4.5 mL of a mixture of methanol and chloroform (volume ratio 2:1), and the washing solution was transferred to a graduated test tube together, the homogenate mixture collected twice before and after was fixed to 10 mL, placed in a water bath at 45°C for 1 hour, and then centrifuged at 8000g, 10 min, 4°C to collect the supernatant, and the liver cholesterol level and liver triglyceride level were detected using an automatic biochemical analyzer.

[0099] The results of liver cholesterol test are as follows Fig.11 As shown, the liver triglyceride level of mice in the blank group was 5.22 μmol / g, and that of the model group was 7.10 μmol / g. The liver triglyceride level of the model group was significantly increased compared with the blank group (p < 0.01), while the liver triglyceride level of mice in the TY-S11 group was 5.72 μmol / g, which was significantly lower than that of the model group (decreased by about 19.4%) (p < 0.05).

[0100] The results of liver triglyceride level test are as follows Fig.12 As shown, the liver cholesterol level of mice in the blank group was 2.40 μmol / g, and that of the model group was 7.70 μmol / g. The liver cholesterol level of the model group was significantly increased compared with that of the blank group (p < 0.0001), while the liver cholesterol level of mice in the TY-S11 group was 3.68 μmol / g, which was significantly lower than that of the model group (reduced by about 52.2%) (p < 0.01).

[0101] The above results indicate that Lactobacillus fermentum TY-S11 has the effect of regulating liver lipid levels.

[0102] (7) Oil Red O fat staining of mouse liver

[0103] Take out the frozen liver sections from the -80℃ refrigerator and dry them at room temperature for 10 minutes; stain the sections with Oil Red O working solution at room temperature for 45 minutes; wash them with 60% isopropanol 5 times and then ddH2O 3 times, and stain them with hematoxylin for 1 minute; rinse them slowly with tap water for 3 minutes until the running water is colorless; air-dry the sections and seal them; observe the pathological changes of mouse liver under a microscope. It should be noted that Oil Red O fat staining is a common method used to show fat in tissues. Oil Red O is a fat-soluble dye that is highly soluble in fat and can specifically color neutral fats such as triglycerides in tissues.

[0104] Test results such as Fig.13 As shown, the liver cells of the blank group mice were arranged normally without obvious abnormalities; the liver cells of the model group mice were swollen and lipid deposited, while the liver cell swelling and lipid deposition of the TY-G05 group mice were improved.

[0105] The above results indicate that Lactobacillus fermentum TY-S11 has the effect of improving liver pathological conditions.

[0106] (8) Detection of short-chain fatty acids in mouse feces by gas chromatography

[0107] Take 50 mg of the mouse feces sample in (4) above, add 500 μL of saturated NaCl solution, shake until there are no obvious lumps (tissue disruptor, 60 Hz, homogenization time 10 s / time, interval 30 s, continuous 5 times, at 4 ° C), add 40 μL of 10% sulfuric acid to acidify, shake and mix, then add 1000 μL of ether to extract, shake and mix, centrifuge at 12,000 rpm, 15 min, 4 ° C, take the supernatant and add it to an EP tube containing 0.25 g of anhydrous sodium sulfate, let it stand for 15 min, centrifuge under the same conditions, take the supernatant and add it to a gas phase vial, analyze it on the machine, and the gas chromatography detection conditions are shown in Table 2 below.

[0108] Table 2 Gas chromatography detection conditions

[0109]

[0110] The contents of short-chain fatty acids (acetic acid, propionic acid and butyric acid) in mouse feces were detected by gas chromatography, and the concentrations were calculated by the external standard method.

[0111] The calculation results of acetic acid level are as follows Fig.14As shown, the fecal acetic acid level of mice in the blank group was 385.86 μg / g, and that of the model group was 129.32 μg / g, which was significantly lower in the model group than in the blank group (p < 0.0001), while the fecal acetic acid level of mice in the TY-S11 group was 166.14 μg / g, which was higher than that in the model group (increased by about 28.5%).

[0112] The calculation results of propionate level are as follows Fig.15 As shown, the fecal propionic acid level of mice in the blank group was 157.07 μg / g, and that of the model group was 58.48 μg / g, which was significantly lower in the model group than in the blank group (p < 0.0001). However, the fecal propionic acid level of mice in the TY-S11 group was 98.38 μg / g, which was significantly higher than that in the model group (increased by about 68.2%) (p < 0.001).

[0113] The calculation results of butyrate level are as follows Fig.16 As shown, the fecal butyric acid level of mice in the blank group was 140.70 μg / g, and that of the model group was 55.08 μg / g, which was significantly lower in the model group than in the blank group (p < 0.0001). However, the fecal butyric acid level of mice in the TY-S11 group was 98.16 μg / g, which was significantly higher than that in the model group (increased by about 78.2%) (p < 0.01).

[0114] The above results indicate that fermented Lactobacillus TY-S11 has the effect of promoting the secretion of short-chain fatty acids in the intestine.

[0115] In summary, the fermented Lactobacillus TY-S11 in the present invention can simultaneously reduce the levels of liver triglycerides and cholesterol in the body and promote the secretion of short-chain fatty acids in the intestine, thereby simultaneously reducing the levels of serum triglycerides, total cholesterol and low-density lipoprotein in the body, thereby synergistically achieving the purpose of improving hyperlipidemia.

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. A Lactobacillus fermentum, characterized in that: It is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration with the deposit number CGMCC No.25738.

2. A composition, characterized in that The invention comprises the fermented lactobacillus according to claim 1.

3. The composition according to claim 2, characterized in that It also includes one or more of probiotics, prebiotics, dietary fiber and Chinese patent medicine.

4. A preparation, characterized in that The invention comprises the fermented lactobacillus according to claim 1 or the composition according to claim 2, and a carrier; wherein the carrier is a pharmaceutically acceptable carrier.

5. The preparation according to claim 4, characterized in that The preparations are tablets, pills, capsules, powders, gels, granules or liquids.

6. Use of the fermented lactobacillus according to claim 1 or the composition according to claim 2 in the preparation of a preparation for improving hyperlipidemia.

7. The use according to claim 6, characterized in that: The application includes: application of the fermented lactobacillus described in claim 1 or the composition described in claim 2 in the preparation of a preparation for reducing the triglyceride level and / or the total cholesterol level and / or the low-density lipoprotein level in serum.

8. The use according to claim 6 or 7, characterized in that: The applications include one or more of the following: (a) application of the fermented lactobacillus according to claim 1 or the composition according to claim 2 in the preparation of a preparation for lowering triglyceride levels and / or cholesterol levels in the liver; (b) application of the fermented lactobacillus according to claim 1 or the composition according to claim 2 in the preparation of a preparation for promoting the secretion of short-chain fatty acids in the intestine, wherein the short-chain fatty acids are one or more of acetic acid, propionic acid or butyric acid.

Images