A fluorescent nanocomposite for detecting single base mutation of Helicobacter pylori resistance gene and its application

Abstract

The present invention discloses a fluorescent nanocomposite for detecting single-base mutation of Helicobacter pylori resistance gene and its application. The fluorescent nanocomposite is based on PS microspheres, CdSe fluorescent quantum dots are loaded on the surface of PS microspheres, and Hairpin hairpin chains 5'-NH2-GGAACAGAGCAAGTCCGTCTTAAGCTCTGTTCC-BHQ2-3' are modified on the surface of CdSe fluorescent quantum dots. The present invention also uses the fluorescent nanocomposite to establish a method for detecting single-base mutation of Helicobacter pylori resistance gene based on signal amplification.

Description

Technical Field

[0001] The invention belongs to the technical field of analysis and detection, and specifically relates to a fluorescent nanocomposite for detecting single-base mutation of Helicobacter pylori resistance gene and application thereof. Background Art

[0002] In the 21st century, more than 50% of the world's population is infected with Helicobacter pylori, and one person dies of gastric cancer every 3 minutes on average. Helicobacter pylori is a Gram-negative bacterium. It is a spiral, micro-anaerobic bacterium that has very demanding growth conditions. It is 3μm long and 0.5μm in diameter. It is the only known microorganism that can survive in the stomach. In 1983, Helicobacter pylori was successfully isolated from the gastric mucosal biopsy tissue of patients with chronic active gastritis for the first time. On October 27, 2017, Helicobacter pylori was listed as a "class 1 carcinogen" by the World Health Organization's International Agency for Research on Cancer. Helicobacter pylori is mainly transmitted through the digestive tract, so the only source of infection for Helicobacter pylori is humans. Helicobacter pylori is involved in various gastric diseases, such as gastric ulcers, chronic atrophic gastritis, duodenal ulcers, gastric cancer, etc. For a long time, Helicobacter pylori infection has been treated with the triple method, which refers to a combination of an antacid and two antibiotics. In the triple therapy, common antacids include proton pump inhibitors and bismuth potassium citrate, and common antibiotics include clarithromycin, ornidazole, moxifloxacin, levofloxacin, etc. However, due to the widespread use of antibiotics, the incidence of antibiotic-resistant strains has been increasing rapidly. With the continuous emergence of drug-resistant Helicobacter pylori bacteria around the world, the drug treatment effect of Helicobacter pylori is not optimistic, and the cause of this resistance is usually related to point mutations in the 23SrRNA gene associated with resistance.

[0003] Gene point mutations, also known as single-base mutations, are prone to cause false negative test results when Helicobacter pylori undergoes single-base mutations, making routine testing more difficult. Currently, several invasive and non-invasive testing methods are commonly used in clinical practice to detect Helicobacter pylori. Invasive tests are often performed using endoscopic techniques, while non-invasive tests include urea breath tests, antigen tests, rapid urease tests, and microbial culture. However, these methods are difficult to achieve good detection results for drug-resistant mutants of Helicobacter pylori, and the testing costs of both methods are relatively expensive.

[0004] At present, electrochemical, fluorescent or immunolabeling methods have been used for quantitative detection of H. pylori nucleic acid, and good results have been achieved. However, the inventors have found that clinical testing of H. pylori faces many difficulties. First, the existing technology is not able to distinguish Helicobacter pylori mutants. Drug-resistant H. pylori is often a point gene mutation. The proportion of mutant bases in the nucleic acid chain is very small, and the proportion of mutants also changes with the course of the disease and treatment. Therefore, this requires a highly specific and stable test method; second, the Helicobacter pylori nucleic acid in the clinical samples has been highly diluted, and only highly sensitive detection methods can detect infection through nucleic acid analysis; third, there are many types of Helicobacter pylori mutants, and they are still being produced. Methods for specific genotypes are not enough to meet the actual application needs. Only methods with high scalability and strong universality have practical application value. Summary of the invention

[0005] In order to solve the deficiencies of the prior art, the object of the present invention is to provide a fluorescent nanocomposite for detecting single-base mutations of Helicobacter pylori resistance genes and its application.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] The present invention first provides a fluorescent nanocomposite for detecting single-base mutations of Helicobacter pylori resistance genes. The fluorescent nanocomposite takes PS microspheres as the core, and CdSe fluorescent quantum dots modified with Hairpin nucleic acid probes are loaded on the surface of the PS microspheres; the end of the Hairpin nucleic acid probe is modified with a quenching group, which can autonomously anneal to form a hairpin structure to quench the fluorescence of the CdSe fluorescent quantum dots; the Hairpin nucleic acid probe can recognize the sequence of single-base mutants of Helicobacter pylori resistance genes and generate hybridization, thereby opening the hairpin structure and restoring the fluorescence of the CdSe fluorescent quantum dots; the sequence of the Hairpin nucleic acid probe is as follows: 5'-NH2-GGAACAGAGCAAGTCCGTCTTAAGCTCTGTTCC-BHQ2-3'.

[0008] The present invention also provides a method for preparing the fluorescent nanocomposite, comprising the following steps:

[0009] 1) Weigh 1 mg of PS microspheres and 2 mg of CdSe fluorescent quantum dots, add them to 1 ml of ultrapure water, and stir at room temperature for 8 h;

[0010] 2) centrifugation, washing the precipitate with ultrapure water, ultrasonically dispersing, and centrifugation;

[0011] 3) Repeat step 2) until the supernatant after centrifugation is colorless under ultraviolet light;

[0012] 4) The final precipitate product was stored in 1 ml of ultrapure water, to which a Hairpin nucleic acid probe with a final concentration of 1 uM was added, and then 5 mg of EDC and 5 mg of DMAP were added, and the reaction was carried out at room temperature for 1 hour to complete the preparation of the fluorescent nanocomposite.

[0013] The present invention also provides the use of the fluorescent nanocomposite in detecting single base mutation of Helicobacter pylori resistance gene.

[0014] Since the nucleic acid sequence content of the single-base mutant of the Helicobacter pylori resistance gene in the real sample is low, it is necessary to construct a sensor with a lower detection limit to complete the detection, which also puts high requirements and difficulties on traditional sensors. Therefore, the initial signal can be increased by nucleic acid amplification technology such as rolling circle amplification (RCA). Based on this, the present invention further provides a quantum dot fluorescence sensor and method for detecting the single-base mutation of the Helicobacter pylori resistance gene based on signal amplification, by amplifying the single-base mutation sequence of the Helicobacter pylori resistance gene, and performing signal amplification, thereby amplifying the extremely low initial signal into a larger signal, thereby facilitating the subsequent reading and recording of the detection signal.

[0015] Furthermore, the above-mentioned biosensor for detecting single-base mutations of Helicobacter pylori resistance genes based on rolling circle amplification includes the above-mentioned fluorescent nanocomplex.

[0016] Furthermore, the above-mentioned method for detecting single base mutations in Helicobacter pylori resistance genes based on rolling circle amplification technology comprises the following steps:

[0017] 1) Mix the template strand and the target sequence to be detected, heat at 95°C for 10 minutes in a constant temperature heater, then cool naturally to 30°C to form a ring structure, then add T4 ligase with a final concentration of 2U / ml, and incubate at 16°C for 1 hour; then add phi29 polymerase with a final concentration of 1U / ml to the ligation product, incubate at 30°C for 2 hours, after the incubation, add 1uM of placeholder strand to the amplification product, incubate at room temperature for 1 hour to form a double strand; add 1U / ml of NB.Bbcvl endonuclease to the double-stranded amplification product, incubate at 37°C for 1 hour, and then heat at 80°C for 20 minutes to obtain the signal amplification product of the target sequence to be detected; wherein the placeholder strand sequence is: 5'-GCCCTCAGCATGCAT-3';

[0018] 2) Take 90 μL of the fluorescent nanocomposite solution and scan the fluorescence spectrum, then add 10 μL of the signal amplification product and scan the fluorescence spectrum.

[0019] Based on the above, the present invention targets the single-base mutation gene of Helicobacter pylori resistance bacteria, and constructs a biosensor and method based on signal amplification for detecting the single-base mutation of Helicobacter pylori resistance gene. The present invention selects a class of quantum dots with stable luminescence as fluorescent materials, and connects several quenching groups to the quantum dots to form an initial fluorescence quenching hairpin structure, and concentrates on PS microspheres through electrostatic adsorption. After adding the resistance bacteria mutant gene of Helicobacter pylori to be detected, the quenching hairpin will complementarily pair with the sequence base to open the fluorescence quenching hairpin structure, so that the fluorescence performance of the quantum dots is restored, and a significant fluorescence signal contrast can be formed under a confocal microscope, thereby realizing the visualization and ultra-sensitive detection of Helicobacter pylori resistance bacteria, and also showing the large application prospect of the quantum dot sensor in the fluorescence detection of bacterial biomarkers. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Schematic diagram of the principle of the sensor of the present invention to recognize single-base mutation sequences.

[0021] Figure 2 :(a) TEM image of CdSe quantum dots; (b) DLS image of CdSe quantum dots; (c) XDS surface scan image of CdSe quantum dots; (d) Infrared spectrum of CdSe quantum dots.

[0022] Figure 3a and Figure 3b :(a) UV absorption and fluorescence diagram of CdSe quantum dots; (b) Fluorescence lifetime diagram of CdSe quantum dots.

[0023] Figure 3c and Figure 3d :(c) Time stability diagram of CdSe quantum dots; (d) Nucleic acid modification diagram of CdSe quantum dots.

[0024] Figure 4 :(a) is a sample loading table and result characterization diagram of the RCA reaction gel electrophoresis characterization; (b) is a sample loading table and result characterization diagram of the gel electrophoresis characterization of the hairpin chain opened by the enzyme cleavage product of the embodiment of the present invention; (c) is a TEM image of the RCA product; (d) is to verify that the enzyme cleavage product successfully opens the quenched hairpin chain; (e) is to Figure 4 (d) Quantification of Hairpin chain bands in lanes 8 and 9.

[0025] Figure 5 : Semi-quantitative visual detection diagram of the target sequence by the quantum dot sensor of an embodiment of the present invention.

[0026] Figure 6 : Visual detection diagram of single-base recognition of different target sequences by the quantum dot sensor of an embodiment of the present invention.

[0027] Figure 7 : The extended design diagram of the present invention, i.e. the dot matrix detection design diagram. DETAILED DESCRIPTION

[0028] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] The detection principle of the present invention is as follows Figure 1 shown.

[0030] A typical embodiment of the present invention provides a fluorescent nanocomposite that can detect single-base mutations in Helicobacter pylori resistance genes, that is, CdSe fluorescent quantum dots are adsorbed on PS microspheres through electrostatic action, and then several Hairpin hairpin chains with quenching groups are connected to the CdSe fluorescent quantum dots. The Hairpin hairpin chains can form a hairpin structure through annealing, so that the CdSe fluorescent quantum dots maintain an initial fluorescence quenching state. After the single-base mutation gene sequence of the Helicobacter pylori mutant to be detected is added, the Hairpin hairpin chain will complementarily pair with the single-base mutation gene sequence, thereby opening the hairpin structure, so that the fluorescence performance of the CdSe fluorescent quantum dots is restored, and a significant fluorescence signal contrast can be formed under a confocal microscope, thereby realizing visualization and ultra-sensitive detection of Helicobacter pylori mutants.

[0031] In order to solve the problem that it is difficult to effectively detect single-base mutations in the drug-resistant gene of Helicobacter pylori, the present invention, in some embodiments, uses rolling circle amplification (RCA) technology to amplify the signal. First, a template chain and a target chain are hybridized to form a ring structure, and then the ring structure is connected into a complete ring structure by a ligase. Thereafter, the ring is amplified by RCA under the catalysis of a polymerase to extend into a DNA chain repeating the target sequence, and then the fluorescent nanocomplex constructed above that can detect single-base mutations in the drug-resistant gene of Helicobacter pylori is used for identification, thereby completing the detection of single-base mutations in the drug-resistant gene of Helicobacter pylori.

[0032] Since the amplification product of RCA is a series of DNA chains, it will be unfavorable for it to combine with the fluorescent nanocomplex that can detect single-base mutations in Helicobacter pylori resistance genes. In order to solve the problem of the binding efficiency of RCA products and fluorescent nanocomplexes, the present invention, in one or more embodiments, combines with a placeholder chain (Occupy chain) after RCA amplification. The role of this Occupy chain is to form a double-stranded combination with the RCA product, providing an enzyme double-stranded recognition site for the endonuclease, and then under the action of the endonuclease, the long string of amplification products is sheared into several repeated DNA chains, thereby more efficiently hybridizing with CdSe fluorescent quantum dots to generate a stronger fluorescent signal.

[0033] Then, the excellent fluorescence properties of CdSe fluorescent quantum dots are utilized to connect the Hairpin hairpin chains. After the product to be detected is added, the fluorescence of the CdSe fluorescent quantum dots can be restored due to the complementary hybridization of the Hairpin hairpin chains and the product. The fluorescence recovery is characterized by instruments such as an ultraviolet dark box and a fluorescence meter. At the same time, in order to visualize and characterize the fluorescence recovery from a more microscopic perspective, the present invention also modifies the CdSe fluorescent quantum dots onto PS microspheres through electrostatic adsorption, and then performs fluorescence imaging through a confocal microscope, thereby enabling visualization detection of Helicobacter pylori mutants.

[0034] In one or more embodiments, the sequence of the Occupy chain consists of 15 to 20 bases. Studies have shown that a sequence of 15 to 20 bases can be better recognized by endonucleases and undergo enzyme cleavage reactions.

[0035] The amplification process of the RCA reaction of the present invention is as follows: using 100nM template chain and the target chain to be detected to heat at 95°C for 10min in a constant temperature heater, then naturally cooling to 30°C to form a ring structure, then adding T4 ligase with a final concentration of 2U / ml, incubating at 16°C for 1h; then adding phi29 polymerase with a final concentration of 1U / ml to the ligation product, and incubating at 30°C for 2h. After the incubation is completed, 1uM of the placeholder chain is added to the amplification product and incubated at room temperature to form a double chain; 1U / ml of NB.BbcvL endonuclease is added to the double-stranded amplification product, incubated at 37°C for 1h, and then heated at 80°C for 20min.

[0036] In one or more embodiments, the CdSe fluorescent quantum dots are negatively charged fluorescent nanoparticles with a particle size of 1-5 nm, which serve as fluorescent donors.

[0037] In some embodiments, the PS microspheres are positively charged microspheres with a size of 1 um.

[0038] In some embodiments, a plurality of CdSe fluorescent quantum dots are adsorbed on the PS microspheres, and a plurality of Hairpin hairpin chains are connected to the CdSe quantum dots. The fluorescent emission region of the CdSe fluorescent quantum dots and the ultraviolet absorption region of the quenching group of the Hairpin hairpin chain have a large overlap, and the distance between the CdSe fluorescent quantum dots and the quenching group is very close, which meets the necessary conditions for the formation of the FRET phenomenon.

[0039] The nucleotide sequences involved in the following examples are as follows (5'→3'):

[0040] Target-A:TCCACGGGGTCTTTCCGTCTTGCCGC

[0041] Template-A:

[0042] AAGACCCCGTGGAACAGAGCAAGTCCGTCTTGCCCTCAGCATGCATGCGGCAAGACGG

[0043] A

[0044] Target-B: TCCACGGGGTCTCTCCGTCTTGCCGC

[0045] Template-B:

[0046] GAGACCCCGTGGAACAGAGCAAGTCCGTCTTGCCCTCAGCATGCATGCGGCAAGACGG

[0047] A

[0048] Target-C:TCCACGGGGTCTTCCCGTCTTGCCGC

[0049] Template-C:

[0050] AAGACCCCGTGGAACAGAGCAAGTCCGTCTTGCCCTCAGCATGCATGCGGCAAGACGG

[0051] G

[0052] Occupy chain: GCCCTCAGCATGCAT Hairpin chain: NH2-GGAACAGAGCAAGTCCGTCTTAAGCTCTGTTCC-BHQ2

[0053] Some of the reagents involved in the following examples are as follows: 1×T4 buffer: 50 mM Tris-HCl (Ph=7.4), 10 mM MgCl2, 1 mM ATP, 10 mM DTT.

[0054] 1×Phi29buffer: 10mM Tris-HCl (Ph = 7.4), 10mMgCl2, 10mM (NH4)2SO4, 4mM DTT.

[0055] 1×rCutSmart buffer: 50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / ml Recombinant Albumin.

[0056] Example 1

[0057] The steps for preparing CdSe fluorescent quantum dots are as follows:

[0058] 1) Preparation of selenium precursor (NaBH2Se2) solution: Add 30 mg of selenium powder and 57 mg of NaBH4 into a 100 ml beaker, then add 15 ml of secondary water, heat and stir at 80°C until the selenium powder is completely dissolved, and the solution gradually changes from clear to brown-red;

[0059] 2) Add 460 mg of cadmium chloride to a 100 ml double-necked bottle containing 30 ml of secondary water, then add 260 ul of mercaptopropionic acid, then slowly add NaOH (5 M) solution to adjust the pH to 8-8.5, pass nitrogen for 20 min, add all the selenium precursor solution prepared in step 1) to the reaction system, heat and stir at 120 ° C for 1 h (nitrogen protection is always passed during the stirring process), and then centrifuge and wash with ethanol for 3 times at a centrifugal speed of 10000 rpm, each time washing for 10 min, and the precipitate at the bottom of the centrifuge is used for freeze-drying (freezing temperature is -40 ° C, air pressure is 100 Pa), that is, the preparation of CdSe fluorescent quantum dots is completed, and stored at -4 ° C.

[0060] The steps for preparing the fluorescent nanocomposite are as follows:

[0061] 1) Weigh 1 mg of PS microspheres and 2 mg of CdSe fluorescent quantum dots, add them to 1 ml of ultrapure water, and stir at room temperature for 8 h;

[0062] 2) centrifugation, washing the precipitate with ultrapure water, ultrasonically dispersing, and centrifugation;

[0063] 3) Repeat step 2) until the supernatant after centrifugation is colorless under ultraviolet light;

[0064] 4) The final precipitate product was stored in 1 ml of ultrapure water, to which a Hairpin hairpin chain with a final concentration of 1 uM was added, followed by 5 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) and 5 mg of 4-dimethylaminopyridine (DMAP), and the reaction was carried out at room temperature for 1 hour to complete the preparation of the fluorescent nanocomposite.

[0065] Figure 2 (a) Figure 2 (b) are the TEM and DLS images of CdSe fluorescent quantum dots, respectively. It can be seen that the distribution of CdSe fluorescent quantum dots is relatively uniform, and the particle size is about 3-5nm. Figure 2 (c) is the XPS surface scan of CdSe fluorescent quantum dots, from which we can see the uniform distribution of Cd and Se elements, thus indicating the successful synthesis of CdSe fluorescent quantum dots. Figure 2 (d) is the infrared spectrum of CdSe fluorescent quantum dots, from 1569cm -1 The peaks appearing at confirm the asymmetric stretching of the C=O bond of the -COOH group. The results of these peaks strongly confirm the existence of carboxyl groups, thereby confirming the capping of CdSe fluorescent quantum dots by 3-MPA.

[0066] Figure 3(a) is the ultraviolet absorption and fluorescence diagram of CdSe fluorescent quantum dots. The ultraviolet absorption of CdSe fluorescent quantum dots is 200-400nm. After the fluorescence excitation of CdSe fluorescent quantum dots at 365nm, the fluorescence emission interval appears in 400-800nm, the maximum emission peak is around 600nm, and the Toxtos shift is nearly 200nm. The above shows that CdSe fluorescent quantum dots have relatively wide ultraviolet absorption performance and a large Toxtos shift. The half-peak width of fluorescence emission is nearly 200nm. Figure 3(b) is the fluorescence lifetime diagram of CdSe fluorescent quantum dots. The decay curve of CdSe fluorescent quantum dots is at the microsecond (us) level. The decay curve is then fitted and the fluorescence lifetime of CdSe fluorescent quantum dots is calculated by the fluorescence lifetime formula to be 143±39ns, indicating that CdSe has a long fluorescence lifetime. Figure 3(c) is the time stability diagram of CdSe fluorescent quantum dots. It can be seen that CdSe fluorescent quantum dots have relatively excellent time stability. Figure 3(d) is a UV image of CdSe fluorescent quantum dots modified with nucleic acid (i.e. fluorescent nanocomplex), where the characteristic peak of DNA appears around 260nm. The above verification can strongly prove that the Hairpin hairpin chain is successfully modified on CdSe fluorescent quantum dots. The above figure can show that CdSe fluorescent quantum dots are a kind of fluorescent nanomaterial with excellent fluorescent properties.

[0067] Example 2

[0068] Amplify the signal of the substance to be detected, the steps are as follows:

[0069] 100nM template chain A was mixed with 100nM target chain A, heated at 95°C for 10min in a constant temperature heater, then naturally cooled to 30°C to form a ring structure, and then T4 ligase with a final concentration of 2U / ml and 20ul of 1x T4 buffer were added, and incubated at 16°C for 1h; then phi29 polymerase with a final concentration of 1U / ml and 20ul of 1x Phi29 buffer were added to the ligation product, and incubated at 30°C for 2h; after the incubation, a placeholder chain with a final concentration of 1uM was added to the amplification product and incubated at room temperature for 1h to form a double-stranded chain; NB.BbcvL endonuclease with a final concentration of 1U / ml and 10ul of 1XrCutSmart were added to the double-stranded amplification product, incubated at 37°C for 1h, and then heated at 80°C for 20min to complete the signal amplification of the substance to be detected.

[0070] Use gel electrophoresis to characterize the effects of RCA amplification and enzyme cleavage, such as Figure 4 As shown. Figure 4 In (a), lanes 1-2 represent template chain A and target chain A, respectively, and single bands at corresponding positions can be observed in the lanes; lane 3 is a ring structure formed by hybridization of template chain A and target chain A, and an obvious band with low mobility appears, indicating that a stable ring structure is formed; lane 4 is the RCA amplification product of the ring structure formed by hybridization of template chain A and target chain A without the addition of Phi29 polymerase, and it can be seen that no band appears at a higher position in this lane; lane 5 is the RCA amplification product of the ring structure formed by hybridization of template chain A and target chain A with the addition of Phi29 polymerase. In lane 5, Phi29 polymerase is added, and a band can be seen at a higher position in this lane, indicating that RCA amplification is successful. Figure 4 (b) and (c) are the AFM and TEM images of the RCA product, respectively. It can be seen that both images show obvious spherical particles with a size of about 30-40 nm, which further illustrates the generation of RCA products. Figure 4(d) To verify that the enzyme cleavage product successfully opens the quenched hairpin chain, lanes 1-2 represent template chain A and target chain A, respectively. Single bands can be observed in lanes 1-2 respectively; in lane 3, there is a ring structure formed by the hybridization of template chain A and target chain A, and an obvious band with a low mobility appears, indicating that a stable ring structure has been formed; lane 4 represents the amplified product; lane 5 represents the amplified product combined with the Occupy chain to form a DNA double helix recognized by the Nb.Bbcvl enzyme. It can be seen that the band at the position of the Occupy chain has basically disappeared, indicating that the Occupy chain has successfully combined; lane 7 represents the continued addition of Nb.Bbcvl enzyme to the DNA double helix, and lane 8 is the addition of the Hairpin hairpin chain on the basis of enzyme cleavage. It can be seen that compared with the pure Hairpin hairpin chain control group in lane 9, the Hairpin hairpin chain in lane 8 has disappeared by nearly half, indicating that the enzyme cleavage product has successfully opened the Hairpin hairpin chain. Figure 4 e is right Figure 4 (d) Quantitative analysis of the Hairpin chain bands in lanes 8 and 9. These results confirm that the RCA amplification and enzyme digestion provided in this example have good effects.

[0071] Example 3

[0072] Visual detection of target sequence by CdSe sensor, the steps are as follows:

[0073] 1) Signal amplification of the substance to be detected: 100nM of the template chain was mixed with the target chain, heated at 95°C for 10min in a constant temperature heater, and then naturally cooled to 30°C to form a ring structure, and then T4 ligase with a final concentration of 2U / ml and 20ul of 1x T4 buffer were added, and incubated at 16°C for 1h; then phi29 polymerase with a final concentration of 1U / ml and 20ul of 1x Phi29 buffer were added to the ligation product, and incubated at 30°C for 2h; after the incubation, a placeholder chain with a final concentration of 1uM was added to the amplification product and incubated at room temperature for 1h to form a double-stranded chain; NB.BbcvL endonuclease with a final concentration of 1U / ml and 10ul of 1XrCutSmart were added to the double-stranded amplification product, incubated at 37°C for 1h, and then heated at 80°C for 20min, thus completing the signal amplification of the substance to be detected and obtaining the target molecule sample.

[0074] 2) Target molecule detection: Take 90 μL of the fluorescent nanocomposite solution prepared in Example 1, scan the fluorescence spectrum (excitation wavelength is 365 nm, slit width is 5-5, voltage is 600 V), then add 10 μL of target molecule sample, scan the fluorescence spectrum again, and obtain the target molecule concentration dependence curve after scanning the signal. The signal readout of the real sample can be analyzed by this concentration curve.

[0075] 3) Visual detection: 90 μL of the fluorescent nanocomposite solution prepared in Example 1 was added to a confocal dish, and then 10 μL of the target molecule sample was added. The laser confocal scanning microscope was used to perform fluorescence excitation using the 405 nm channel, and then the 561 nm channel was used to receive the fluorescence signal. The mutant was specifically detected by analyzing the overall fluorescence intensity of the fluorescent nanocomposite. At the same time, it can also be rapidly detected by naked eyes under 365 nm ultraviolet light.

[0076] 4) Microarray detection: Through further optimization and improvement of detection efficiency, the detection carrier can be replaced with a glass slide, which can be used as a glass chip. Then, several rows of parallel fluorescent nanocomposite solutions are dropped on the glass chip in the form of a dot matrix at equal intervals. Then, signal amplification products of different single-base mutants are added to these areas, and then multiple different single-base mutants are detected simultaneously under ultraviolet light.

[0077] Figure 5 For the semi-quantitative visual detection of the target sequence by CdSe sensor, Target-A chain and Templae-A chain are used here for the purpose of semi-quantitative analysis of the detection. Figure 5 (a) It can be seen that when the concentration of the target chain (Target-A) is set to 10nM, 30nM, 50nM, and 100nM, after the RCA amplification and enzyme cleavage steps, under the confocal microscope, it can be clearly seen that the fluorescence intensity of the CdSe sensor with these concentrations of target sequences is gradually restored. The fluorescence intensity is quantitatively analyzed by the software. Figure 5 (b) It can be seen that as the target concentration increases, the fluorescence intensity of the CdSe sensor is gradually restored, indicating the excellent detection performance of the CdSe sensor.

[0078] Figure 6 This is a visualization of the single base recognition of the target sequence by the CdSe sensor. The targets here are Target-A, B, and C chains. These three target chains are respectively combined with the same template Templae-A to distinguish single bases. Figure 6 (a) It can be seen that after adding the signal amplification products of Target-A+Templae-A, Target-B+Templae-A, and Target-C+Templae-A to the fluorescent nanocomposite solution, the fluorescence of the fluorescent nanocomposite was greatly restored only in the Target-A+Templae-A group, i.e., when the bases were fully complementary, while the fluorescence was almost not restored in the other two groups, i.e., when the single base was not paired. At the same time, the confocal fluorescence images were subjected to fluorescence quantitative analysis. Figure 6(b) It can be seen that the CdSe sensor constructed in the present invention has excellent single-base discrimination ability.

[0079] Figure 7 This is a schematic diagram of the detection of different mutant genotypes. It is an extended application design of the CdSe sensor. It uses a dot matrix format and can detect different genotypes at the same time. It can be seen that on the glass chip, blue represents no fluorescence signal, red represents fluorescence signal, and Figure 7 It can be seen that only under the condition of single base complete complementary pairing can the fluorescent nanocomplex have a readout of fluorescent signal. This chip design will provide a feasible reference for the simultaneous detection of multiple different mutant genotypes.

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent substitution, improvement, etc. made within the spirit and principle of the present invention shall be included in the present invention, and any modification, equivalent substitution, improvement, etc. made shall be included in the protection scope of the present invention.

Claims

1. A method for detecting single base mutations in Helicobacter pylori resistance genes based on signal amplification, characterized in that: The method is used for non-disease diagnosis and treatment purposes, and specifically comprises the following steps: 1) Mix the template chain and the target chain to be detected, heat at 95℃ for 10min, and then cool naturally to 30℃; then add T4 ligase with a final concentration of 2U / ml, incubate at 16℃ for 1h; then add phi29 polymerase with a final concentration of 1U / ml, incubate at 30℃ for 2h; after the incubation, add 1uM of the placeholder chain and incubate at room temperature for 1h; then add NB.BbcvL endonuclease with a final concentration of 1U / ml, incubate at 37℃ for 1h, and then heat at 80℃ for 20min to complete the signal amplification of the substance to be detected and obtain the signal amplification product of the substance to be detected; Wherein, the placeholder strand sequence is: 5'-GCCCTCAGCATGCAT-3'; 2) Take 90uL of the fluorescent nanocomposite solution, add 10uL of the signal amplification product obtained in step 1), and detect the fluorescent signal; The fluorescent nanocomposite has PS microspheres as the core, CdSe fluorescent quantum dots are loaded on the surface of the PS microspheres, and Hairpin hairpin chains are modified on the surface of the CdSe fluorescent quantum dots. The sequence of the Hairpin hairpin chain is 5'-NH2-GGAACAGAGCAAGTCCGTCTTAAGCTCTGTTCC-BHQ2-3'.

2. The method according to claim 1, characterized in that: The fluorescent nanocomposite is prepared by the following steps: 1) Accurately weigh 1 mg of PS microspheres and 2 mg of CdSe fluorescent quantum dots, add them to 1 ml of ultrapure water, and stir at room temperature for 8 h; 2) Centrifugal separation, washing the precipitate with ultrapure water, ultrasonic dispersion, and centrifugal separation; 3) Repeat step 2) until the supernatant after centrifugation is colorless under ultraviolet light; 4) The final precipitate product was stored in 1 ml of ultrapure water, to which a Hairpin chain with a final concentration of 1 μM was added, and then 5 mg of EDC and 5 mg of DMAP were added, and the reaction was carried out at room temperature for 1 hour to complete the preparation of the fluorescent nanocomposite.

3. A CdSe fluorescence sensor for detecting single base mutation of Helicobacter pylori resistance gene based on signal amplification, characterized in that: The CdSe fluorescent sensor comprises the template chain, the target chain to be detected, T4 ligase, phi29 polymerase, placeholder chain, NB.BbcvL endonuclease and fluorescent nanocomplex as described in claim 1.

Images