Preparation method and application of Siamese Bacillus 0728-11 and immobilized strain preparation thereof

Abstract

The present invention belongs to the field of microorganisms, and discloses a preparation method and application of Siamese Bacillus 0728-11 and its immobilized bacterial agent preparation. The Siamese Bacillus 0728-11 is separated and purified from the seawater of Fangchenggang to obtain the original strain. It is identified by the China General Microbiological Culture Collection Management Center and is classified and named as Siamese Bacillus, with a collection number of CGMCC No.25116. The present invention obtains a large number of bacterial cells after culturing Siamese Bacillus 0728-11. The bacterial cells are then fixed by sodium alginate and microporous starch to form an immobilized algae-inhibiting preparation. The immobilized algae-inhibiting bacterial strain preparation of the present invention can allow the bacterial cells to exist in the water body, and will not decrease with the flow of the water body, effectively improve the algae-inhibiting effect, and has a large application value.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to a preparation method and application of siam bacillus 0728-11 and an immobilized strain preparation thereof. Background Art

[0002] Human activities have increased the eutrophication of water bodies in local sea areas, allowing algae to grow rapidly, making red tide outbreaks increasingly frequent. In my country's offshore waters, red tides are also increasing, posing huge challenges to the ecological security of coastal areas and the sustainable development of coastal economies. Therefore, it is necessary to study new, efficient and environmentally friendly red tide control methods.

[0003] The microbial-based algae inhibition treatment method is safe, environmentally friendly, and can effectively control red tides. At present, there are many studies on algae inhibition microorganisms at home and abroad. According to the method of using the strain, it can be divided into two categories: one is the direct microbial introduction method, which is an algae killing method based on pure microorganisms; the other is the microbial carrier material immobilization method, which is to immobilize the microorganisms and then put them into the algae liquid to control the growth of algae.

[0004] Strain immobilization technology is a technology that uses physical or chemical means to fix free cells in a specific area and keep them active and reusable. Immobilized microbial technology has high microbial density, less microbial loss, and easy separation of bacteria. Common immobilization methods include: adsorption, covalent bonding, embedding, etc., among which the embedding method is the most widely used.

[0005] Siamese Bacillus is a saprophytic bacterium widely distributed in various living environments, which can produce endogenous heat-resistant and stress-resistant spores. The spores are not only resistant to heat, but also have strong resistance to ultraviolet rays, electromagnetic radiation and some chemicals, and can tolerate various adverse environments. Siamese Bacillus is an important component of plant disease biocontrol microorganisms and can be used to prevent and control a variety of plant diseases. At present, it is rarely used in the control of harmful algae in eutrophic water bodies. Summary of the invention

[0006] The purpose of the present invention is to provide a preparation method and application of Siamese Bacillus 0728-11 and an immobilized strain preparation thereof. The immobilized anti-algae strain preparation of the present invention can allow the bacteria to exist in the water body and will not decrease with the flow of the water body, thereby effectively improving the anti-algae effect and having great application value.

[0007] The first object of the present invention is to provide a Siamese Bacillus 0728-11 screened out from seawater, which is classified and named as Siamese Bacillus Bacillus siamensis. The strain was deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration (Beijing, China) on June 17, 2022, with a deposit number of CGMCC No.25116.

[0008] The screening method of siam bacillus 0728-11 of the present invention comprises the following steps:

[0009] (1) Take seawater from Fangchenggang area and dilute it with sterile water: 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 0.1 mL of each gradient dilution was spread on a beef extract peptone medium plate (the medium formula was: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL), and cultured at 30-37°C for 1-2 days.

[0010] (2) Pick different colonies and streak them on beef extract peptone solid plates (medium formula: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL), and culture at 30-37°C for 1-2 days. Observe whether the isolated colonies are pure. If there are other bacteria, repeat this step until pure culture is achieved.

[0011] (3) The purified strain was inoculated into beef extract peptone liquid culture medium (the medium formula is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL) and cultured at 50-100 rpm, 30-37° C. for 1-2 days.

[0012] (4) Take 1 mL of the above bacterial solution and inoculate it into 20 mL of exponentially growing sterile spherical Phaeocystis culture medium. Culture it for 2 days at 20±1°C, 12 h light, 12 h dark, and 2400 lux light intensity. Beef extract peptone medium (culture medium formula: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL) was added to the algae solution as a control. Three parallel experiments were set up to detect the chlorophyll a content and determine the number of algae cells, so as to screen out strains with anti-algae activity.

[0013] The second object of the present invention is to provide an immobilized strain preparation comprising siam Bacillus 0728-11.

[0014] The method for preparing the immobilized bacterial strain preparation of the present invention comprises the following steps:

[0015] The Siamese Bacillus 0728-11 is inoculated on a beef extract peptone culture plate and cultured at 30-37°C for 1-3 days; the activated solid plate strain is inoculated into a liquid culture medium and cultured at a temperature of 30-37°C, a rotation speed of 100-200rpm, and a culture period of 1-3 days; microporous starch is added to the bacterial solution to make the microporous starch concentration reach 10-25g / L, and the solution is stirred evenly and allowed to stand for 5-15min to allow the bacteria to be completely adsorbed; a sodium alginate solution with a concentration of 15-30g / L is added to the microporous starch mixed solution containing the bacterial solution, and the solution is slowly stirred evenly and allowed to stand for 20min; a sterile syringe is used to drop the bacterial mixed solution into a CaCl2 solution with a concentration of 10-30g / L, and immobilized microspheres are formed after solidification for 1-4h, and the solution is washed with purified water to obtain an immobilized strain preparation.

[0016] Furthermore, the concentration of the CaCl2 solution is 10 to 30 g / L.

[0017] Furthermore, the curing time is 1 to 4 hours.

[0018] Furthermore, the preparation method comprises the following steps:

[0019] (1) Inoculate Bacillus siame 0728-11 on a fresh beef extract peptone culture plate and culture at 30-37° C. for 1-3 days;

[0020] (2) The activated solid plate strain is inoculated into a liquid culture medium and cultured at a temperature of 30-37° C., a rotation speed of 100-200 rpm, and a culture period of 1-3 days;

[0021] (3) Add the bacterial solution to the weighed microporous starch so that the microporous starch reaches 10-25 g / L, stir evenly, and let it stand for 10 minutes to allow the bacteria to be completely adsorbed;

[0022] (4) Dissolve sodium alginate in purified water and stir until the concentration of sodium alginate reaches 15-30 g / L. Take 10 ml of sodium alginate solution, then add 10 ml of microporous starch mixture containing bacterial solution, stir slowly and evenly, and let it stand for 20 minutes.

[0023] (5) Use a sterile syringe to drop the bacterial mixture into the pre-made CaCl2 solution. The concentration of the CaCl2 solution is 10-30 g / L. After curing for 1-4 hours, immobilized microspheres are formed. Wash with purified water and set aside.

[0024] According to an embodiment of the present invention, the beef extract peptone culture medium formula in step (1) is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL.

[0025] According to an embodiment of the present invention, the liquid culture medium formula in step (2) is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL.

[0026] According to an embodiment of the present invention, the concentration of the CaCl2 solution in step (5) is 10 g / L.

[0027] According to an embodiment of the present invention, the curing time in step (5) is 2 hours.

[0028] According to an embodiment of the present invention, the immobilized strain preparation prepared in step (5) is stored at 20-40°C, preferably at 30°C.

[0029] The third object of the present invention is to provide a use of Bacillus siamese 0728-11 or an immobilized strain preparation containing the strain in controlling harmful algae.

[0030] The present invention also provides a method for treating harmful algae using the immobilized bacterial strain preparation, comprising the following steps:

[0031] (1) 0.2-1.2 g of the immobilized strain preparation was added to 20 mL of the spherical brown algae liquid. The culture conditions were a light-dark ratio of 12 h:12 h. After culturing at 20°C for 48 h, samples were taken to detect the algae inhibition effect.

[0032] (2) 1.2 g of immobilized strain preparation, 1 mL of bacterial solution and 1 mL of liquid culture medium were added to 20 mL of spherical brown algae solution respectively. Culture conditions: light-dark ratio of 12h:12h, culture at 20℃ for 24h, and sampling to detect the anti-algae effect. After 24h sampling, 10 mL of the algae solution after inhibition treatment was taken out from each group, and then 10 mL of untreated spherical brown algae solution in the logarithmic phase was added to simulate the flow of the algae solution. Culture conditions: light-dark ratio of 12h:12h, culture at 20℃, and sampling and testing every 24h.

[0033] Beneficial Effects

[0034] The siam bacillus strain of the present invention is a basic bacterium, and the raw materials are easy to obtain; and it is separated from seawater in my country's sea area. As an "algae inhibitor", it adopts natural biological materials, has strong environmental affinity, no secondary pollution during use, is easy to operate, has strong feasibility, high safety performance, good inhibition effect, and the algae inhibition rate can reach 80%; sodium alginate-microporous starch is used to fix the strain, which can maintain a certain algae inhibition efficiency for a long time and inhibit algae outbreaks. After the immobilization conditions are optimized, the immobilization time is 2h, the cross-linking agent concentration is 10g / L, and the storage temperature is 30°C to immobilize the strain. Subsequently, the immobilized strain preparation is tested for algae inhibition. When the input amount of the immobilized strain preparation in 20mL algae liquid is 1.2g, the algae inhibition efficiency can reach 78%, and the strain can be kept in a fixed water area for a period of time, and does not decrease rapidly with the flow of the water body, which is conducive to practical application, and provides a new method and direction for using biological methods to treat the algae bloom problem in water bodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a comparison chart of the algae inhibition efficiency of multiple siam Bacillus strains of the present invention.

[0036] Figure 2 This is a photo of the immobilized strain preparation prepared in the present invention.

[0037] Figure 3 This is a diagram showing the algae inhibition effect of the immobilized bacterial strain preparation of the present invention.

[0038] Figure 4 This is a graph showing the change of chlorophyll a over time. DETAILED DESCRIPTION

[0039] The above contents are further described below through specific embodiments, but it should not be understood that the above subject scope of the present invention is limited to the following embodiments. All technologies realized based on the above contents of the present invention belong to the scope of the present invention.

[0040] Example 1

[0041] 1. Screening of strains

[0042] (1) Take 10 mL of seawater sample from Fangchenggang area, dissolve it in 90 mL of sterile water after wet heat sterilization, and mix well.

[0043] Use sterile water to dilute the seawater in a gradient: 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6, 0.1 mL of each gradient dilution was spread on a beef extract peptone medium plate and cultured at 30-37°C for 1-2 days. The beef extract peptone medium formula was: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, and purified water 1000 mL.

[0044] (2) Pick different colonies, streak them on beef extract peptone solid plates, and culture them at 30-37°C for 1-2 days. Observe whether the isolated colonies are purified. If there are foreign bacteria, repeat this step until pure culture is achieved. The beef extract peptone medium formula is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL.

[0045] (3) The purified strain was inoculated into a beef extract peptone liquid culture medium and cultured at 50-100 rpm and 30-37° C. for 1-2 days. The beef extract peptone liquid culture medium has the following formula: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, and purified water: 1000 mL.

[0046] (3) 1 mL of the above bacterial solution was inoculated into 20 mL of exponentially growing sterile spherical Phaeocystis culture medium, and cultured for 2 days at 20±1°C, 12 h light, 12 h dark, and 2400 lux light intensity. Beef extract peptone medium (the beef extract peptone medium formula is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL) was added to the algae solution as a control, and 3 parallels were set up to detect the chlorophyll a content and determine the number of algae cells, so as to screen out bacteria with anti-algae activity, such as Figure 1 . Multiple strains passed the algae inhibition test, and the results showed that strains 0728-09, 0728-10, 0728-11, 0728-12, and 0728-11 had the highest algae inhibition efficiency, reaching 80%. This strain is a highly efficient algae inhibition strain and was preserved and identified.

[0047] 2. Identification of bacterial species

[0048] The strain with the highest algae inhibition effect, Bacillus siamensis 0728-11, was selected for strain identification. The cell morphology and physical and chemical test results of the strain are shown in Tables 1 to 3.

[0049] Table 1. Cell morphology results of strains

[0050] Experimental Project result Experimental Project result Experimental items result Experimental Project result Cell morphology Rod Gram stain Positive Bud + cyst enlargement - Catalase + Oxidase + hug

[0051] Note: + indicates insensitive; - indicates sensitive.

[0052] Table 2. Physicochemical tests of strains

[0053]

[0054] Note: + indicates insensitive; - indicates sensitive.

[0055] The sequencing was performed by the Institute of Microbiology, Chinese Academy of Sciences, and the result of the 16S rRNA gene sequence of the strain is shown in SEQ ID NO: 1. Based on the cell morphology, physical and chemical experimental results, rRNA gene sequence and other experimental data of the strain, the identification result of the strain was: Bacillus siamensis.

[0056] The 16S rDNA sequence of the siam bacillus 0728-11 is as follows (SEQ ID NO: 1):

[0057] tcgggtgtta caaactctcg tggtgtgacg ggcggtgtgt acaaggcccg ggaacgtattcaccgcggca tgctgatccg cgattactag cgattccagc ttcacgcagt cgagttgcag actgcgatccgaactgagaa cagatttgtg ggattggctt aacctcgcgg tttcgctgcc ctttgttctg cccattgtagcacgtgtgta gcccaggtca taaggggcat gatgatttga cgtcatcccc accttcctcc ggtttgtcaccggcagtcac cttagagtgc ccaactgaat gctggcaact aagatcaagg gttgcgctcg ttgcgggacttaacccaaca tctcacgaca cgagctgacg acaaccatgc accacctgtc actctgcccc cgaaggggacgtcctatctc taggattgtc agaggatgtc aagacctggt aaggttcttc gcgttgcttc gaattaaaccacatgctcca ccgcttgtgc gggcccccgt caattccttt gagtttcagt cttgcgaccg tactccccaggcggagtgct taatgcgtta gctgcagcac taaggggcgg aaacccccta acacttagca ctcatcgtttacggcgtgga ctaccagggt atctaatcct gttcgctccc cacgctttcg ctcctcagcg tcagttacagaccagagagt cgccttcgcc actggtgttc ctccacatct ctacgcattt caccgctaca cgtggaattccactctcctc ttctgcactc aagttcccca gtttccaatg accctccccg gttgagccgg gggctttcacatcagactta agaaaccgcc tgcgagccct ttacgcccaa taattccgga caacgcttgc cacctacgtattaccgcggc tgctggcacgtagttagccg tggctttctg gttaggtacc gtcaaggtgc cgccctatttgaacggcact tgttcttccc taacaacaga gctttacgat ccgaaaacct tcatcactca cgcggcgttgctccgtcaga ctttcgtcca ttgcggaaga ttccctactg ctgcctcccg taggagtctg ggccgtgtctcagtcccagt gtggccgatc accctctcag gtcggctacg catcgtcgcc ttggtgagcc gttacctcaccaactagcta atgcgccgcg ggtccatctg taagtggtag ccgaagccac cttttatgtc tgaaccatgcggttcaaaca accatccggt attagccccg gtttccccgga gttatcccag tcttacaggc aggttacccacgtgttactc acccgtccgc cgctaacatc agggagcaag ctcccatc.

[0058] Example 2

[0059] Immobilization of Bacillus siamese 0728-11

[0060] 1. Preparation of Bacillus siamese 0728-11 bacterial solution

[0061] (1) Inoculate Bacillus siameensis 0728-11 on a fresh beef extract peptone culture plate (the medium formula is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL) and culture at 30-37° C. for 1-3 days.

[0062] (2) The activated solid plate strain was inoculated into a liquid culture medium (the culture medium formula was: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL) and cultured at a temperature of 30-37°C, a rotation speed of 100-200 rpm, and a culture period of 1-3 days.

[0063] 2. Preparation of immobilized strain preparations

[0064] (1) Add the bacterial solution to the weighed microporous starch so that the microporous starch reaches 20 g / L, stir evenly, and let it stand for 10 minutes to allow the bacteria to be completely adsorbed.

[0065] (2) Dissolve sodium alginate in purified water and stir until the concentration of sodium alginate reaches 40 g / L. Take 10 mL of sodium alginate solution and then add 10 mL of microporous starch mixture containing bacterial liquid. Stir slowly and evenly and let stand for 20 min.

[0066] (3) Weigh CaCl2 and add purified water to prepare a 20 g / L solution. Use a sterile syringe to drop the bacterial mixture into the pre-prepared CaCl2 solution to form immobilized microspheres. After curing for 1-4 h, wash the prepared microspheres with purified water and set aside. The prepared immobilized strain preparation is spherical, white, and has certain elasticity and mechanical strength. Figure 2 shown.

[0067] Example 3

[0068] Optimization of strain immobilization conditions

[0069] In order to optimize the preservation of the activity of the strain after immobilization, the immobilization conditions were optimized: the bacterial solution was added to the weighed microporous starch to make the microporous starch reach 20g / L, stirred evenly, and left to stand for 10min to allow the bacteria to be completely adsorbed. Sodium alginate was dissolved in purified water and stirred to dissolve, so that the sodium alginate concentration reached 40g / L. 10mL of sodium alginate solution was taken, and then 10mL of microporous starch mixed solution containing bacterial solution was added, slowly stirred evenly, and left to stand for 20min. The solution was dripped into 10g / L, 20g / L and 30g / L CaCl2 solutions at room temperature by syringe, and the curing time was 1h, 2h and 4h to form immobilized microspheres. The prepared microspheres were washed twice with purified water and stored at 4℃, room temperature or 30℃ for 12h.

[0070] The above carriers were placed in 1% sodium pyrophosphate solution for 1 hour to dissolve. Then the immobilized preparation solution was diluted 10 8 times, and spread on solid culture medium (culture medium formula: beef extract: 3.0g, peptone: 10.0g, NaCl: 5.0g, agar: 15g, purified water 1000mL), cultured at 30℃ for 24h, and the number of colonies was detected to detect the survival of the immobilized preparation strain. The experimental results are shown in Table 3.

[0071] Table 3 Orthogonal results of optimization of immobilized strain conditions

[0072]

[0073]

[0074] The range analysis showed that the immobilization time was better than the cross-linking agent concentration, and the cross-linking agent concentration was better than the storage temperature. When the immobilization time was 1h, the strain was not firmly immobilized and the inclusion amount was small; after long-term immobilization, the activity of the strain began to decline. And the activity of the strain decreased with the increase of the cross-linking agent concentration. Within the experimental temperature range, the higher the storage temperature, the more conducive it is to the proliferation and activation of the included strain. Therefore, the optimal conditions are an immobilization time of 2h, a cross-linking agent concentration of 10g / L, and a storage temperature of 30℃.

[0075] Example 4

[0076] Immobilization of Bacillus siamese 0728-11

[0077] 1. Preparation of Bacillus siamese 0728-11 bacterial solution

[0078] (1) Inoculate Bacillus siameensis 0728-11 on a fresh beef extract peptone culture plate (the medium formula is: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL) and culture at 30-37° C. for 1-3 days.

[0079] (2) The activated solid plate strain was inoculated into a liquid culture medium (the culture medium formula was: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL) and cultured at a temperature of 30-37°C, a rotation speed of 100-200 rpm, and a culture period of 1-3 days.

[0080] 2. Preparation of immobilized strain preparations

[0081] (1) Add the bacterial solution to the weighed microporous starch so that the microporous starch reaches 20 g / L, stir evenly, and let it stand for 10 minutes to allow the bacteria to be completely adsorbed.

[0082] (2) Dissolve sodium alginate in purified water and stir until the concentration of sodium alginate reaches 40 g / L. Take 10 mL of sodium alginate solution and then add 10 mL of microporous starch mixture containing bacterial liquid. Stir slowly and evenly and let stand for 20 min.

[0083] (3) Weigh CaCl2 and add purified water to prepare a 10 g / L solution. Use a sterile syringe to drop the bacterial mixture into the pre-prepared CaCl2 solution to form immobilized microspheres. After curing for 2 h, the prepared microspheres are washed with purified water and stored at 30°C. The prepared immobilized strain preparation is spherical, white, and has certain elasticity and mechanical strength.

[0084] Example 5

[0085] Application of immobilized preparations

[0086] 1. Add the bacterial solution to the weighed microporous starch to make the microporous starch reach 20g / L, stir evenly, and let it stand for 10 minutes to allow the bacteria to be completely adsorbed. Dissolve sodium alginate in purified water and stir to dissolve it to make the sodium alginate concentration reach 40g / L. Take 10mL of sodium alginate solution, then add 10mL of microporous starch mixed solution containing bacterial solution, slowly stir evenly, and let it stand for 20 minutes. Syringe drips into 10g / L CaCl2 solution at room temperature, the calcification time is 2h, to form an immobilized strain preparation, wash twice with purified water, and store at 30℃ for 12h respectively.

[0087] 0.2, 0.4, 0.8, and 1.2 g of immobilized strain preparation were added to 20 mL of spherical brown cystis algae liquid. The culture conditions were: light-dark ratio 12h:12h, culture at 20℃ for 48h, and sampling was performed to detect the algae inhibition effect. Figure 3 The experimental results show that as the amount of immobilized strain preparation increases, the algae inhibition effect becomes more obvious. When the input amount reaches 0.8g, the algae inhibition efficiency of the immobilized strain preparation is greater than 50%. When the input amount reaches 1.2g, the algae inhibition efficiency can reach 78%.

[0088] 2. Simulated flow test of bacterial liquid and immobilized preparation:

[0089] The Siamese Bacillus 0728-11 was inoculated on a fresh beef extract peptone culture plate (the culture medium formula was: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, agar: 15 g, purified water 1000 mL), and cultured at 30-37° C. for 1-3 days. The activated solid plate strain was inoculated into a liquid culture medium (the culture medium formula was: beef extract: 3.0 g, peptone: 10.0 g, NaCl: 5.0 g, purified water 1000 mL) and cultured at a temperature of 30-37° C. and a rotation speed of 100-200 rpm for 1-3 days to obtain a bacterial solution.

[0090] Add the bacterial solution to the weighed microporous starch to make the microporous starch reach 20g / L, stir evenly, and let it stand for 10 minutes to allow the bacteria to be completely adsorbed. Dissolve sodium alginate in purified water and stir to dissolve it to make the sodium alginate concentration reach 40g / L. Take 10mL of sodium alginate solution, then add 10mL of microporous starch mixed solution containing bacterial solution, slowly stir evenly, and let it stand for 20 minutes. Syringe drips into 10g / L CaCl2 solution at room temperature, the calcification time is 2h, and the immobilized strain preparation is formed. Wash it with purified water twice and store it at 30℃ for 12h respectively.

[0091] 1.2g of immobilized strain preparation, 1mL of bacterial solution and 1mL of liquid culture medium were added to 20mL of spherical brown algae solution respectively. Culture conditions: light-dark ratio of 12h:12h, culture at 20℃ for 24h, and sampling to detect the anti-algae effect. After 24h sampling, each group took out 10mL of the algae solution after inhibition treatment, and then added 10mL of untreated spherical brown algae solution in the logarithmic phase to simulate the flow of the algae solution. Culture conditions: light-dark ratio of 12h:12h, culture at 20℃, sampling and detection at intervals of 24h, the results are shown in Figure 4 .

[0092] The experimental results show that compared with the control group, the chlorophyll a content of the immobilized strain preparation and the bacterial liquid was significantly reduced after 24 hours of treatment of the algae liquid, and the algae inhibition effect was obvious. Through simulated flow, the new algae liquid was added, and the chlorophyll a content of the immobilized strain preparation and the bacterial liquid began to increase, indicating that the number of algae cells increased. However, the rate of increase of algae cells in the immobilized preparation was lower than that of the bacterial liquid. After 72 hours, the algae cell content in the immobilized preparation group was about 60% of that in the bacterial liquid group. This shows that after the immobilized strain, the algae inhibition substances are secreted sustainably, and the algae inhibition effect does not decrease rapidly with the flow of the water body, and it has better stability and sustainability than the bacterial liquid.

Claims

1. A method for inhibiting Phaeocystis sphericalensis, characterized in that: An immobilized strain preparation is used to inhibit spherical brown algae. The preparation method of the immobilized strain preparation includes: inoculating Siamese Bacillus 0728-11 on a beef extract peptone culture plate, and culturing at 30-37°C for 1-3 days; inoculating the activated solid plate strain into a liquid culture medium, culturing at a temperature of 30-37°C, a rotation speed of 100-200rpm, and culturing for 1-3d; adding microporous starch to the bacterial solution to make the microporous starch concentration reach 10-25g / L, stirring evenly, and letting it stand for 5-15min to allow the bacteria to be completely adsorbed; adding sodium alginate solution to the microporous starch mixed solution containing the bacterial solution, slowly stirring evenly, and letting it stand for 10-30min; dripping the bacterial mixed solution into a CaCl2 solution with a sterile syringe, forming immobilized microspheres after solidification, and washing with purified water to obtain an immobilized strain preparation; the Siamese Bacillus 0728-11 is classified and named as Siamese Bacillus siamensis, the strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 17, 2022, with the deposit number CGMCC No. 25116.

2. The method for inhibiting Phaeocystis sphericalensis according to claim 1, characterized in that: The beef extract peptone culture medium formula is: beef extract: 3.0g, peptone: 10.0g, NaCl: 5.0g, agar: 15g, purified water 1000mL; the liquid culture medium formula is: beef extract: 3.0g, peptone: 10.0g, NaCl: 5.0g, purified water 1000mL.

3. The method for inhibiting Phaeocystis sphericalensis according to claim 1, characterized in that: The concentration of the sodium alginate solution is 15-30 g / L, and the volume ratio of the sodium alginate solution to the microporous starch mixed solution containing the bacterial solution is 1:

1.

4. The method for inhibiting Phaeocystis sphericalensis according to claim 1, characterized in that: The concentration of the CaCl2 solution is 10-30 g / L.

5. The method for inhibiting Phaeocystis sphericalensis according to claim 1, characterized in that: The curing time is 1~4h.

6. The method for inhibiting Phaeocystis sphericalensis according to claim 1, characterized in that: The prepared immobilized strain preparation was stored at 20-40°C.

7. The method for inhibiting Phaeocystis sphericalensis according to claim 1, characterized in that: The method of using an immobilized strain preparation to inhibit Phaeocystis sphericalensis comprises the following steps: adding 0.2-1.2 g of the immobilized strain preparation to an algae solution, culturing under the conditions of a light-dark ratio of 12h:12h, a culturing temperature of 20°C, and a culturing time of at least 48h.

Images