Specific primers, probes, kits and methods for detecting millet components

Abstract

The present invention relates to a specific primer and a probe for detecting millet components, wherein the sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3. The primers and probes provided by the present invention are used to identify millet components in a sample, which has the advantages of accurate results, high sensitivity, stable and reliable results, low false positive rate, etc., can accurately separate millet components from other closely related species, has high specificity, and its PCR amplification product is only 113bp, has a small molecular weight, and has high amplification efficiency, thereby ensuring the specific identification of millet components in deep-processed foods of different matrices.

Description

Technical Field

[0001] The invention relates to the field of biological detection, and in particular to a method for detecting millet components in a sample. Background Art

[0002] With the extensive research on genetically modified products and their wide application in daily life, the safety issues brought by genetically modified products to human health and living environment have aroused widespread concern and debate. Therefore, while countries around the world are actively studying genetically modified technology, they have also conducted a lot of research on the detection and analysis methods of various genetically modified foods. However, due to the large number of genetically modified species and the large number of them, especially after many genetically modified foods have been deeply processed and stored under various conditions, the genetically modified components have been degraded in large quantities, making detection more difficult. Therefore, it is necessary to continuously update and develop various genetically modified food detection technologies based on the development of science and technology to strengthen the supervision, monitoring and management of genetically modified foods, reduce the risks that may be brought about by their commercialization, and at the same time protect public health and the right to know and the right to choose of consumers.

[0003] Specific gene detection is very important in GMO detection and food ingredient detection methods. The first step in food GMO detection is food ingredient detection. In the qualitative detection of GMOs, specific genes are used as the denominator of the mass fraction. The national standard - General Detection Method for Genetically Modified Products (GB / T 19495.4-2018) includes real-time PCR detection methods for 11 specific genes of seven major crops, including maize zSSIIb and Adh1, soybean Lectin, rapeseed CruA and PEP, rice SPS and PLD, alfalfa ACC gene, beet GluA3, and potato UGPase. However, there are no mature specific gene detection methods for important gramineous crops such as millet, and millet has a high homology with gramineous crops such as wheat, rye, oats, and millet, which makes it very difficult to identify millet components in plants and their processed products.

[0004] Therefore, there is an urgent need for a method for detecting millet components with high sensitivity, strong specificity, accurate and reliable results, and rapidity and simplicity. Summary of the invention

[0005] The method for solving the above technical problems is to provide a specific primer and probe for detecting millet components. The primer and probe are used to detect millet components, and the identification results are accurate, stable, reliable, and highly sensitive. Millet components in a large number of samples to be tested can be quickly identified in a short time with high efficiency.

[0006] Specifically, the first aspect of the present invention provides a specific primer for detecting millet components, the sequence of the specific primer is:

[0007] Upstream primer: 5′-GCTGGTCATCGAGCAGGTGG-3′ (SEQ ID NO. 1);

[0008] Downstream primer: 5′-TTCAGGACTCTTGTCTGCGAAGG-3′ (SEQ ID NO. 2).

[0009] The second aspect of the present invention also provides a probe for detecting millet components, the sequence of the probe is: 5′-AGCTGCTTGAGCCTTCTATCGAGCAGACG-3′ (SEQ ID NO. 3).

[0010] Preferably, the 3' end of the probe is labeled with a fluorescent quencher group, and the 5' end is labeled with a fluorescent reporter group.

[0011] Preferably, the fluorescence quenching group is selected from TAMRA, BHQ1, BHQ2 or MGB; the fluorescence reporter group is selected from FAM, VIC, JOE or HEX.

[0012] The third aspect of the present invention also provides a kit for detecting millet components, the kit comprising the above-mentioned specific primers and optionally the above-mentioned probes.

[0013] Preferably, the kit further comprises a reference substance.

[0014] Preferably, the controls include a negative control and a positive control.

[0015] Preferably, the negative control is sterile double distilled water.

[0016] Preferably, the kit further comprises a PCR reaction buffer, dNTPs and Taq DNA polymerase.

[0017] The fourth aspect of the present invention provides the use of the above-mentioned specific primers, the above-mentioned probe or the above-mentioned kit in detecting millet components in a sample.

[0018] Preferably, the sample is a plant or a processed plant product.

[0019] More preferably, the processed plant product is one or more of plant food, beverage, health product, and nutritional supplement.

[0020] The fifth aspect of the present invention provides the use of the above-mentioned specific primers, the above-mentioned probes or the above-mentioned kit in the preparation of a reagent for detecting millet components in a sample.

[0021] Preferably, the sample is a plant or a processed plant product.

[0022] More preferably, the processed plant product is one or more of plant food, beverage, health product, and nutritional supplement.

[0023] The sixth aspect of the present invention also provides a method for detecting millet components, comprising the following steps:

[0024] (1) extracting nucleic acid from a sample to obtain a DNA template;

[0025] (2) using the above-mentioned specific primers to perform PCR amplification on the DNA template obtained in step (1) to obtain an amplified product;

[0026] (3) determining the size of the PCR amplification product obtained in step (2); if the PCR amplification product contains a DNA fragment of 113 bp, then the sample to be tested contains millet components; otherwise, the sample to be tested does not contain millet components;

[0027] The 113 bp DNA fragment sequence is shown in SEQ ID NO. 4, specifically GCTGGTCATCGAGCAGGTGGCCAAGGAGTAAGCTGCTTGAGCCTTCTATCGAGCAGACGATCGATCGACGATCGATGCTCAACTCTGTTTCCTTCGCAGACAAGAGTCCTGAA (vicilin-like seed storage protein gene, referred to as VLSSP gene).

[0028] Preferably, the sample in step (1) is a plant or a processed plant product.

[0029] More preferably, the processed plant product is one or more of plant food, beverage, health product, and nutritional supplement.

[0030] Preferably, the PCR reaction system in step (2) of the above method comprises:

[0031]

[0032] More preferably, the PCR reaction system comprises:

[0033]

[0034] Preferably, the PCR amplification in step (2) is performed according to the following amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 40 s, and extension at 72°C for 30 s, for 40 cycles; then, extension at 72°C for 7 min, and cooling to 4°C.

[0035] The seventh aspect of the present invention also provides a method for detecting millet components, comprising the following steps:

[0036] (1) extracting nucleic acid from a sample to obtain a DNA template;

[0037] (2) using the above-mentioned specific primers and the above-mentioned probe to perform real-time fluorescence PCR amplification on the DNA template extracted in step (1);

[0038] (3) Collect fluorescence signals and obtain detection results.

[0039] Preferably, the sample in step (1) is a plant or a processed plant product.

[0040] More preferably, the processed plant product is one or more of plant food, beverage, health product, and nutritional supplement.

[0041] Preferably, the real-time fluorescence PCR reaction system of step (2) of the above method comprises:

[0042] Reaction system Dosage DNA template 30~60ng Upstream primer 10μM, 0.5~1.5μL Downstream primer 10μM, 0.5~1.5μL Probe 10μM, 0.25~1μL 2×TaqMan Universal PCR Master Mix 12.5μL Sterile ultrapure water Make up to 25 μL

[0043] More preferably, the real-time fluorescence PCR reaction system comprises:

[0044] Reaction system Dosage DNA template 50ng Upstream primer 10 μM, 1 μL Downstream primer 10 μM, 1 μL Probe 10 μM, 0.5 μL 2×TaqMan Universal PCR Master Mix 12.5μL Sterile ultrapure water Make up to 25 μL

[0045] Preferably, the real-time fluorescence PCR amplification in step (2) is performed according to the following amplification program: 95°C, 5 min; 94°C, 15 s, 48-68°C, 1 min, for 40 to 60 cycles; and then continue at 98°C, 8-12 min.

[0046] More preferably, the real-time fluorescence PCR amplification conditions are: 95°C, 5 min (1°C / s); 94°C, 15 s; 60°C, 1 min (1°C / s), for 50 cycles; 98°C, 10 min (1°C / s).

[0047] The present invention has positive and beneficial effects:

[0048] In the preliminary research on specific primers for detecting millet components, the inventors screened and analyzed multiple detection genes including vicilin-like seed storage protein (VLSSP), prolamin (PRO), subtilisin-like protease (SLP), galactokinase (GAL) and keratin mRNA gene (Setaria italica hornerin, SIH), and designed a large number of specific primers. Finally, vicilin-like seed storage protein (VLSSP) was selected as the detection gene, and primers with high species specificity were screened out. The primers provided by the present invention are used to identify millet components in samples, and the results are accurate, highly sensitive (sensitivity is 2 copies / μL, and the relative sensitivity can reach 0.05%), stable and reliable, and the false positive rate is low. The millet components can be accurately separated from other closely related species and confused products, and the specificity is high. The PCR amplification product is only 113bp, with a small molecular weight and high amplification efficiency, which ensures that the millet components in a large number of foods can be identified in a short time. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The agarose gel electrophoresis diagram of the components of Yugu No. 18 millet detected by the detection method of Example 1 and Comparative Examples 1-4 in Test Example 1;

[0050] Figure 2 The real-time fluorescence PCR amplification curve for detecting Yugu No. 18 millet in Experimental Example 2, wherein Curve 1 is Example 1 and Curve 2 is Comparative Example 1;

[0051] Figure 3 The specific experimental results of detecting millet components in Experimental Example 3, where the upper part of the baseline is Yugu No. 18 millet, and the lower part of the baseline is corn, sorghum, rye, oats, rice, wheat, soybean, potato, tomato, rapeseed, sweet potato and blank control;

[0052] Figure 4 The results of the intraspecific tolerance test of different varieties of millet in Experimental Example 4 are shown above the baseline: Jigu No. 42 Millet, Bao 008 Millet, Zhonggu No. 7 Millet, Jigu No. 22 Millet, and Yugu No. 18 Millet; and the negative control and blank control are shown below the baseline;

[0053] Figure 5The absolute sensitivity test results of millet components in Experimental Example 5 are shown in Figure 1, where curves 1-3 from left to right above the baseline are DNA dilution solutions with DNA concentrations of 200 copies / μL, 20 copies / μL, and 2 copies / μL, respectively, and ...0.2 copies / μL, negative control substances, and blank controls, respectively;

[0054] Figure 6 These are the relative sensitivity experimental results for detecting millet components in Test Example 6, where Curve 1 from left to right above the baseline is a sample containing 50% millet content, Curve 2 is a sample containing 5% millet content, Curve 3 is a sample containing 0.5% millet content, Curve 4 is a sample containing 0.05% millet content, and below the baseline are negative control and blank control. DETAILED DESCRIPTION

[0055] The technical solution of the present invention is described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0056] The main equipment used in the embodiments of the present invention includes eppendorf micropipette, AB7500 fluorescence qualitative PCR instrument, high-speed desktop centrifuge and DYY22C electrophoresis instrument, etc. The reagents or instruments used without indicating the manufacturer are all conventional reagents or instruments that can be obtained commercially. If the specific experimental steps or conditions are not indicated in the embodiments, the operations or conditions of the conventional experimental steps described in the literature in this field can be carried out.

[0057] The millet Jigu No. 42, millet Bao 008, millet Zhonggu No. 7, millet Jigu No. 22, and millet Yugu No. 18 used in the examples of the present invention are stored in the laboratory, and corn, sorghum, rye, oats, millet, rice, wheat, sugarcane, soybean, potato, tomato, rape, and sweet potato are all commercially available. Unless otherwise specified, the primers and probes of the present invention used in the following test examples 3-6 are all specific primers and probes of Example 1.

[0058] Test Example 1: Screening test of specific primers for detecting millet components

[0059] 1. Test subjects

[0060] The specific primers used in this test example include the primers of Example 1 and Comparative Examples 1-4, which are as follows:

[0061] (1) Specific Primers Example 1 uses the VLSSP gene as the target gene fragment, and the sequences of the primers are:

[0062] Upstream primer: 5′-GCTGGTCATCGAGCAGGTGG-3′ (SEQ ID No. 1);

[0063] Downstream primer: 5′-TTCAGGACTCTTGTCTGCGAAGG-3′ (SEQ ID No. 2).

[0064] The sequence of the VLSSP gene is shown in SEQ ID NO.4, specifically:

[0065] GCTGGTCATCGAGCAGGTGGCCAAGGAGTAAGCTGCTTGAGCCTTCTATCGAGCAGACGATCGATCGACGATCGATGCTCAACTCTGTTTCCTTCGCAGACAAGAGTCCTGAA, length is 113 bp.

[0066] (2) Specific Primers Example 1 uses the PRO gene as the target gene fragment, and the sequence of the primer is:

[0067] Upstream primer: 5′-ACGCCTGGTCGCGCACATG-3′ (SEQ ID No. 5);

[0068] Downstream primer: 5′-GACCTCCTGGCATTGATGGAGC-3′ (SEQ ID No. 6).

[0069] The sequence of the PRO gene is shown in SEQ ID NO.7, specifically:

[0070] ACGCCTGGTCGCGCACATGGCAGCCAAGCAGCTGCATGGCGATGCACCAGCAGTGCTGCCAGCAGCGCAGCGCCATCAGGCAAGTGGAGCCGCTCCATCGATGCCAGGAGGTCT, with a length of 114bp.

[0071] (3) Specific primer comparison example 2 uses the SLP gene as the target gene fragment, and the sequence of the primer is:

[0072] Upstream primer: 5′-CGGCTCGTCTGGTCCAGC-3′ (SEQ ID No. 8);

[0073] Downstream primer: 5′-GGTGGCTGTAGCAGACTAGCATCG-3′ (SEQ ID No. 9).

[0074] The sequence of the SLP gene is shown in SEQ ID NO.10, specifically:

[0075] CGGCTCGTCTGGTCCAGCGACCACCACGTGGTCGCCAGCCCGATCGCGGCGACATGGAACTAACCGGTGGCTGTAGCAGACTAGCATCGCTTAGCAGAAGCG, the length is 102bp.

[0076] (4) Specific primers Example 3 uses the GAL gene as the target gene fragment, and the sequence of the primer is:

[0077] Upstream primer: 5′-TTCCGGGAGCGTCGTCAGC-3′ (SEQ ID No. 11);

[0078] Downstream primer: 5′-TGCCTCGTCGAGCTGGGAG-3′ (SEQ ID No. 12).

[0079] The sequence of the GAL gene is shown in SEQ ID NO.13, specifically:

[0080] TTCCGGGAGCGTCGTCAGCGGGGAGGCGGAGCTCGTCCCGACTCTCTCCTCGCTGGAGCCGTCTACGGCGAGGGCTCCCAGCTCGACGAGGC, the length is 92bp.

[0081] (5) Specific primer comparison example 4 uses SIH gene as the target gene fragment, and the sequence of the primer is:

[0082] Upstream primer: 5′-CACCAACAATGTTGATGCTGGTTC-3′ (SEQ ID No. 14);

[0083] Downstream primer: 5′-CTAGGCTTTTCAATGTCACCTGATG-3′ (SEQ ID No. 15).

[0084] The sequence of the SIH gene is shown in SEQ ID NO.16, specifically:

[0085] CACCAACAATGTTGATGCTGGTTCTAGTACCTCCGCAGCTCGCAGCTGGAAATCATCAGGTGACATTGAAAAGCCTAG, length is 78 bp.

[0086] 2. Test methods

[0087] The above-mentioned specific primers Example 1 and Comparative Examples 1-4 were used to detect Yugu No. 18 millet, and the PCR amplification products obtained after amplification with each primer were subjected to agarose gel electrophoresis respectively. The specific method is as follows:

[0088] (1) Sample processing and DNA extraction

[0089] Processing steps of the sample to be tested: Take 30-40g of the sample to be tested, grind it with a pulverizer or grinder until the sample powder particles are about 0.2mm-0.3mm in size to obtain sample powder.

[0090] DNA extraction steps: Then take 200 mg of sample powder and place it in a 2 mL centrifuge tube, add 1.5 mL of CTAB extraction buffer and 10 μL of proteinase K solution (20 mg / mL), shake evenly, and incubate at 65 ° C for 60 min. Then centrifuge at 12000 rpm for 10 min, carefully transfer the supernatant to a new 2 mL centrifuge tube; add 750 μL of chloroform and vortex to mix, and centrifuge at 12000 rpm for 10 min. Pipette the supernatant into a 2 mL centrifuge tube, add 2 times the volume of CTAB precipitation solution and mix evenly, let it stand at room temperature for 1 hour, and centrifuge at 12000 rpm for 10 min. After discarding the supernatant, add 350 μL of 1.2 mol / L NaCl solution to the precipitate to fully dissolve the precipitate, then add 350 μL of chloroform, vortex to mix, and centrifuge at 12000 rpm for 10 min. Aspirate the supernatant into a 1.5mL centrifuge tube, add 0.8 times the volume of isopropanol, let stand overnight at -20℃, and centrifuge at 12000rpm for 10min. After discarding the supernatant, wash the precipitate with 70% ethanol solution 2 to 3 times, and centrifuge at 12000rpm for 10min. After discarding the supernatant, dry it thoroughly; add 100μL TE solution to dissolve the precipitated DNA, and use it immediately or store it at -20℃ for later use.

[0091] (2) PCR amplification

[0092] Using the DNA extracted in step (1) as a template, PCR amplification was performed using the specific primers of Example 1:

[0093] The PCR reaction system is as follows:

[0094]

[0095] The amplification reaction was carried out on a PCR instrument, and the PCR amplification procedure was as follows:

[0096] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 40 s, and extension at 72°C for 30 s for 40 cycles; then continue extension at 72°C for 7 min and cool to 4°C.

[0097] (3) The PCR amplification product in step (2) is subjected to agarose gel electrophoresis to measure the size of the PCR amplification product of the sample. The agarose gel electrophoresis method is in accordance with Appendix IVB of Part III of the 2015 edition of the Chinese Pharmacopoeia, the gel concentration is 2%, the concentration of the nucleic acid dye GelRed is 1%, and the electrophoresis buffer is TAE buffer (Tris-EDTA-acetate buffer, pH 8.3). The loading amount of the PCR reaction solution of each sample obtained in the above step (2) is 5 μL, and the loading amount of the DNA molecular weight marker (DNA Marker) is 5 μL. After the electrophoresis is completed, the results are observed on a gel imager. If the PCR amplification product contains a 113 bp DNA fragment, the sample to be tested contains millet components; otherwise, the sample to be tested does not contain millet components.

[0098] The test method of the specific primers of Comparative Examples 1-4 is the same as that of the specific primers of Example 1, the only difference being that the specific primer sequences of Comparative Examples 1-4 are different.

[0099] 3. Test results

[0100] Figure 1 The agarose gel electrophoresis diagrams of Example 1 and Comparative Examples 1-4, wherein M is a DNA Marker (50 bp), bands 1-5 are the amplification products of primers corresponding to the target gene fragments SLP, GAL, PRO, VLSSP, and SIH genes, and band 6 is a blank control. Figure 1 It can be seen that the primers corresponding to the VLSSP gene in Example 1 and the PRO gene in Comparative Example 1 amplified clear target bands with the expected lengths (113 bp and 114 bp, respectively), so the primers in Example 1 and Comparative Example 1 were selected for subsequent analysis.

[0101] Experimental Example 2: Screening of specific primer and probe combinations for detecting millet components

[0102] 1. Test methods

[0103] (1) The specific steps of processing, purification and DNA extraction of the sample to be tested are the same as those in Experimental Example 1;

[0104] (2) Real-time fluorescence PCR amplification

[0105] Using the DNA extracted in step (1) as a template, PCR amplification was performed using the specific primers of Example 1 and the probe shown in SEQ ID No. 3, and the specific primers of Comparative Example 1 and the probe shown in SEQ ID No. 17:

[0106] 5′-FAM-AGCTGCTTGAGCCTTCTATCGAGCAGACG-TAMRA-3′ (SEQ ID No. 3);

[0107] 5'-FAM-CAGCCAAGCAGCTGCATGGCGATGC-TAMRA-3' (SEQ ID No. 17).

[0108] The PCR reaction system comprises:

[0109] Reaction system Dosage DNA template 50ng Upstream primer 10 μM, 1 μL Downstream primer 10 μM, 1 μL Probe 10 μM, 0.5 μL 2×TaqMan Universal PCR Master Mix 12.5μL Sterile ultrapure water Make up to 25 μL

[0110] The amplification reaction was carried out on a real-time fluorescence PCR instrument, and the PCR amplification procedure was as follows:

[0111] 95°C, 5 min (1°C / s); 94°C, 15 s; 60°C, 1 min (1°C / s); 50 cycles in total; 98°C, 10 min (1°C / s).

[0112] (3) Result determination: If the Ct value of the sample to be tested is ≤35 and a specific amplification curve appears, it indicates that it contains millet components. If the Ct value of the sample to be tested is ≥40, it indicates that it does not contain millet components. If the Ct value is between 35 and 40, real-time fluorescence PCR amplification is performed again. If the Ct value after re-amplification is ≥40, it indicates that it does not contain millet components. If the Ct value after re-amplification is <40, it indicates that it contains millet components.

[0113] 2. Test results

[0114] like Figure 2 As shown, the amplification efficiency of the primers and probes in Example 1 is significantly higher than that in Comparative Example 1. Therefore, the method for detecting millet specificity using the primers and probes in Example 1 of the present invention has the advantages of high efficiency and short time.

[0115] Test Example 3: Specificity Investigation Experiment

[0116] 1. Test methods

[0117] In order to ensure the reliability of the molecular identification results, this experiment collected Yugu No. 18 millet, corn, sorghum, rye, oats, millet, rice, wheat, sugarcane, soybean, potato, tomato, rapeseed, and sweet potato as samples to be tested, and the above samples to be tested were tested separately according to the detection method in Experimental Example 2.

[0118] 2. Test results

[0119] from Figure 3It can be seen that only the millet sample can show an amplification curve, the blank control (sterile double distilled water) has no amplification curve, and other Gramineae and other common crops such as corn, sorghum, rye, oats, millet, rice, wheat, soybeans, potatoes, tomatoes, rapeseed, sweet potatoes, etc. have no fluorescence curves. The above results fully illustrate that the detection method using the primers and probes selected by the present invention has good specificity for millet components.

[0120] Test Example 4: Intraspecific tolerance test of different varieties of millet

[0121] 1. Test methods

[0122] To ensure the reliability of the molecular identification results, Jigu No. 42 millet, Bao 008 millet, Zhonggu No. 7 millet, Jigu No. 22 millet, and Yugu No. 18 millet were used as test samples, and rice and wheat were used as negative controls. The above-mentioned samples were tested separately according to the detection method of Experimental Example 2.

[0123] 2. Test results

[0124] from Figure 4 It can be seen that when the detection method of the present invention is used to detect common varieties of millet, such as Jigu No. 42 millet, Bao 008 millet, Zhonggu No. 7 millet, Jigu No. 22 millet, and Yugu No. 18 millet, millet can be successfully detected, while negative control rice, wheat and blank control have no amplification. The above test results show that the method of the present invention is not only specific, but also meets the requirements of inter-species tolerance, that is, it can effectively detect common varieties of millet.

[0125] Test Example 5: Absolute sensitivity test

[0126] 1. Test methods

[0127] The millet sample genomic DNA was prepared by the method of step (1) "treatment, purification and DNA extraction of the test sample" in Yugu No. 18 millet reference test example 2, and its initial copy number was 200 copies / μL. The millet sample genomic DNA was diluted 10 times in three gradients to obtain DNA with copy numbers of 20 copies / μL, 2 copies / μL and 0.2 copies / μL, respectively. The original solution and the millet sample genomic DNA with different dilution gradients were used as positive standards for the sensitivity experiment, and sterile double distilled water was used as a blank control. The positive standard and the blank control were tested according to the detection method in test example 2, and each dilution gradient was repeated twice to verify the absolute sensitivity of the detection method.

[0128] 2. Test results

[0129] like Figure 5As shown, the blank control has no amplification signal. After the stock solution (200 copies / μL) and its dilution 10 times (20 copies / μL) and 100 times (2 copies / μL), all concentration gradients can show obvious amplification curves, but the DNA content of 0.2 copies / μL did not amplify the corresponding band. The above test results show that the detection method of the present invention can be used to detect millet-specific gene components with good accuracy and sensitivity, and can accurately detect millet strain-specific gene components with a content as low as 2 copies / μL.

[0130] Test Example 6: Relative Sensitivity Test

[0131] 1. Test methods

[0132] According to the "treatment of the sample to be tested" in step (1) of Experimental Example 2, the positive control powder (Yugu No. 18 millet sample) and the negative control powder (wheat sample) were prepared using Yugu No. 18 millet sample and wheat sample respectively. The positive control powder and the negative control powder were mixed in different mass proportions to obtain a series of mixed samples, so that the mass percentages of the millet components in the mixed samples were 0.05%, 0.5%, 5% and 50%, respectively. DNA extraction and detection were performed according to the detection method of Experimental Example 2.

[0133] 2. Test results

[0134] like Figure 6 As shown, above the baseline are the amplification curves of positive samples of different concentrations, and below the baseline are the content limits, negative and blank controls where the relative sensitivity is not reached. When the percentage of millet components in the sample is not less than 0.05%, typical amplification curves appear in both replicates of the sample. The above experiments show that the method of the present invention has good sensitivity and reproducibility for accurately detecting millet components with a relative content as low as 0.05%.

[0135] Although specific embodiments of the present invention have been described, it will be appreciated by those skilled in the art that various changes and modifications may be made to the present invention without departing from the scope or spirit of the present invention. Therefore, the present invention is intended to cover all such changes and modifications that fall within the scope of the appended claims and their equivalents.

Claims

1. A specific primer for detecting millet components, characterized in that: The upstream primer sequence of the specific primer is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.

2.

2. A kit for detecting millet ingredients, characterized in that: The kit comprises a probe and the specific primer according to claim 1, and the sequence of the probe is shown as SEQ ID NO.

3.

3. The kit according to claim 2, characterized in that The 3' end of the probe is labeled with a fluorescent quenching group, and the 5' end is labeled with a fluorescent reporter group.

4. The kit according to claim 3, characterized in that The fluorescence quenching group is selected from TAMRA, BHQ1, BHQ2 or MGB; the fluorescence reporter group is selected from FAM, VIC, JOE or HEX.

5. The kit according to claim 2, characterized in that The kit also includes a PCR reaction buffer, dNTPs and Taq DNA polymerase.

6. Use of the specific primers described in claim 1 or the kit described in any one of claims 2 to 5 in detecting millet components in a sample.

7. Use of the specific primer according to claim 1 or the kit according to any one of claims 2 to 5 in preparing a reagent for detecting millet components in a sample.

8. A method for detecting millet ingredients, characterized in that: The steps include: (1) Extract nucleic acid from the sample to obtain a DNA template; (2) using the specific primers described in claim 1 to perform PCR amplification on the DNA template obtained in step (1) to obtain an amplified product; (3) Determine the size of the PCR amplification product obtained in step (2). If the PCR amplification product contains a 113 bp DNA fragment, then the sample to be tested contains millet components; otherwise, the sample to be tested does not contain millet components. The sequence of the 113 bp DNA fragment is shown in SEQ ID NO.

4.

9. A method for detecting millet ingredients, characterized in that: The steps include: (1) Extract nucleic acid from the sample to obtain a DNA template; (2) using the specific primers and probes in the kit according to any one of claims 2 to 5 to perform real-time fluorescent PCR amplification on the DNA template extracted in step (1); (3) Collect fluorescence signals and obtain detection results.

Images