Pichia kudriavzevii and its uses

Abstract

The invention discloses a Pichia kudriavzewi yeast and its use, and belongs to the field of microbial technology. The invention is to expand the natural source of 2-octanone flavor, and screen a Pichia kudriavzewi yeast that can produce high 2-octanone from distiller's yeast, and the deposit number is CGMCC No. 26370. The bacteria provided by the invention can achieve a 2-octanone yield of 46.25 mg / L, and the percentage of the target product in the total volatile matter content is large, which provides a basis for the development of the preparation process of 2-octanone natural flavor, and the bacteria has the characteristics of mild fermentation conditions, simple fermentation raw materials, short culture time, etc.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to Pichia kudriavzevii and uses thereof. Background Art

[0002] There are now 14,000 kinds of food additives, and their general functions include preservatives, sweeteners, colorants, thickeners, antioxidants, bleaching agents, anti-adhesives, emulsifiers, defoamers, stabilizers, moisture retainers, acidity regulators, bulking agents, film agents, processing aids, spices and nutritional enhancers. According to their origins, they can be divided into natural food additives and chemically synthesized additives. Natural food additives are natural substances extracted from the metabolites of animals, plants and microorganisms. Chemically synthesized food additives are substances obtained by chemical means by oxidation, reduction, condensation, polymerization and other synthetic reactions of elements or compounds.

[0003] With the rapid development of the food industry, green and safe food additives will become the mainstream direction of the development of the food additive industry, but natural food additives are facing many obstacles. Most natural food additives require certain special resources for processing. The scarcity of resources affects their development to a certain extent. It is expected that by investing in high-tech equipment and production technology to improve productivity and make up for the shortcomings of limited resources, but the current cost is relatively high.

[0004] 2-Octanone is naturally present in cocoa, yogurt, beer, butter, bananas and citrus fruits. It has a musty and ketone aroma, and has the smell of milk, cheese and mushrooms. It has been approved as a food flavoring. The concentration in the final flavored food is about 0.14 mg / kg. However, the currently commercialized 2-octanone is a synthetic flavoring, which is produced by oxidation of 2-octanol, a product of castor oil cracking.

[0005] Therefore, obtaining a strain of bacteria that is easy to cultivate and can produce high 2-octanone from nature is of great significance for obtaining 2-octanone fragrance from natural sources. Summary of the invention

[0006] In view of the gaps in existing research, the present invention screens out a yeast strain capable of producing high 2-octanone from distiller's yeast, which has the characteristics of mild fermentation conditions, simple fermentation raw materials, short culture time, etc.

[0007] The present invention first provides a high-yield 2-octanone Pichia kudriavzevii strain, which is named Pichia kudriavzevii LZLJ1-3 (Pichia kudriavzevii), and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on December 30, 2022, and its deposit number is CGMCC No.26370.

[0008] The ITS sequence of the above-mentioned high-yield 2-octanone-producing Pichia kudriavzevii is shown in SEQ ID NO:1.

[0009] SEQ ID NO:1 ITS sequence of Pichia kudriavzevii with high 2-octanone production:

[0010] GGGTCCTGCGGAAGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAAAAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGC GAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGA GCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAA.

[0011] Among them, the amount of 2-octanone produced by the above-mentioned Pichia kudriavzevii reached 46.25 mg / L.

[0012] The biological characteristics of the above-mentioned high-yield 2-octanone Pichia kudriavzevii are as follows: after being cultured on YPD solid culture medium at 30°C for 2 to 3 days, the colonies are creamy white and dull, and the bacteria are convex and wrinkled.

[0013] Among them, in the above-mentioned high-yield 2-octanone Pichia kudriavzevii, the YPD solid culture medium is: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 15g / L, pH 7.0, and high-pressure steam sterilization at 115°C for 20 minutes.

[0014] The present invention also provides the use of the above-mentioned Pichia kudriavzevii with high 2-octanone production in the preparation of natural flavor 2-octanone.

[0015] The present invention also provides a process for producing 2-octanone by fermenting the above-mentioned Pichia kudriavzewi, which comprises the following steps: activating the Pichia kudriavzewi and then inoculating it into a fermentation medium, culturing at a temperature of 30°C, a shaking speed of 120 rpm, aerobic culturing for 72 hours, a pH value of 7.0, and after the fermentation is completed, centrifuging and separating to obtain a supernatant.

[0016] Among them, in the above process, the activation operation is: inoculate Pichia kudriavzevii into YPD medium, and culture it at 20-30° C. for 12-20 hours to activate three generations.

[0017] Wherein, in the above process, the YPD medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, pH 7.0, high pressure steam sterilization at 115°C for 20 minutes.

[0018] Among them, in the above process, the fermentation medium is: malt extract powder 130g / L, chloramphenicol 0.1g / L, pH 7.0, and high-pressure steam sterilization at 115°C for 20 minutes; the inoculation amount when accessing the fermentation medium is 1-5% by volume.

[0019] Beneficial effects of the present invention:

[0020] The invention obtains a high-yield 2-octanone Pichia kudriavzevii yeast from distiller's yeast and names it LZLJ1-3. The strain is easy to culture, and can achieve a 2-octanone yield of 46.25 mg / L without optimizing the fermentation method, and the target product accounts for a large percentage of the total volatile matter content, which has important practical significance for promoting the development of the preparation process of 2-octanone natural flavor.

[0021] The deposit number of the Pichia kudriavzevii LZLJ1-3 of the present invention is CGMCC No. 26370. The deposit time is December 30, 2022, and the deposit center is: General Microbiological Center of China Microbiological Culture Collection Administration (CGMCC), the address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Postal Code 100101. The classification name is Pichiakudriavzevii LZLJ1-3. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the colony morphology of Pichia kudriavzevii LZLJ1-3.

[0023] Figure 2 This is the GC-MS graph of 2-octanone produced by Pichia kudriavzevii LZLJ1-3.

[0024] Figure 3This is the GC-MS molecular fragmentation mass spectrum of 2-octanone produced by Pichia kudriavzevii LZLJ1-3.

[0025] Figure 4 This is the GC-MS molecular fragmentation mass spectrum of 2-octanone standard. DETAILED DESCRIPTION

[0026] Specifically, the present invention provides a high-yield 2-octanone Pichia kudriavzevii strain, whose strain name is Pichia kudriavzevii LZLJ1-3 (Pichia kudriavzevii), which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on December 30, 2022, and its deposit number is CGMCC No.26370.

[0027] The ITS sequence of the Pichia kudriavzevii with high 2-octanone production of the present invention is shown in SEQ ID NO: 1.

[0028] The Pichia kudriavzevii yeast of the present invention can produce 46.25 mg / L of 2-octanone through fermentation culture.

[0029] The biological characteristics of the above-mentioned high-yield 2-octanone Pichia kudriavzevii are as follows: after being cultured on YPD solid culture medium at 30°C for 2 to 3 days, the colonies are creamy white and dull, and the bacteria are convex and wrinkled.

[0030] Among them, in the above-mentioned high-yield 2-octanone Pichia kudriavzevii, the YPD solid culture medium is: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 15g / L, pH 7.0, and high-pressure steam sterilization at 115°C for 20 minutes.

[0031] Based on the above findings, the present invention also provides the use of the above-mentioned Pichia kudriavzevii with high 2-octanone production in the preparation of natural flavor 2-octanone.

[0032] The present invention also provides a process for producing 2-octanone by fermenting the above-mentioned Pichia kudriavzewi, which comprises the following steps: activating the Pichia kudriavzewi and then inoculating it into a fermentation medium, culturing at a temperature of 30°C, a shaking speed of 120 rpm, aerobic culturing for 72 hours, a pH value of 7.0, and after the fermentation is completed, centrifuging and separating to obtain a supernatant.

[0033] In the present invention, the activation operation is: inoculating Pichia kudriavzevii into YPD medium, and culturing at 20-30° C. for 12-20 hours, and activating for three generations.

[0034] In the present invention, the YPD medium contains: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, pH 7.0, and is sterilized by high pressure steam at 115° C. for 20 minutes.

[0035] In the present invention, the fermentation medium is: 130 g / L malt extract powder, 0.1 g / L chloramphenicol, pH 7.0, and sterilized by high pressure steam at 115°C for 20 minutes; the inoculation amount when inoculating the fermentation medium is 1-5% by volume.

[0036] The present invention is further described in detail below by way of examples, but the protection scope of the present invention is not limited to the scope of the examples.

[0037] The culture medium formula involved in the embodiment is:

[0038] Red Bengal solid culture medium: peptone 5g / L, glucose 10g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate 0.5g / L, Red Bengal 0.03g / L, chloramphenicol 0.1g / L, agar 15g / L, pH 7.0, high pressure steam sterilization at 115℃ for 20 minutes.

[0039] YPD medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, pH 7.0, high pressure steam sterilization at 115°C for 20 min.

[0040] YPD solid medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, agar 15 g / L, pH 7.0, high pressure steam sterilization at 115°C for 20 min.

[0041] Fermentation medium: malt extract powder 130 g / L, chloramphenicol 0.1 g / L, pH 7.0, high-pressure steam sterilization at 115°C for 20 minutes.

[0042] Example 1: Screening of yeast producing 2-octanone

[0043] Take 1.5g of koji sample (Jiangsu Suzhou Bee brand sweet koji) and put it into a 250mL conical flask mixed with glass beads and 50mL of sterile water. Oscillate it on a shaker at 37℃ at 115r / min overnight. Take 1mL of supernatant by natural static sedimentation method and dilute it continuously to 10 with sterile water. -5 , take 0.2mL of each dilution gradient and spread it on a Bengal red solid culture medium plate, and culture it at 30℃ for 2-3 days; then pick out a single colony with vigorous growth, separate and purify it through multiple streaking, and then inoculate it into YPD culture medium. The culture temperature is 30℃, and the shaking speed is 120rpm. After culturing for 2-3 days, the volatile products are qualitatively determined by headspace solid phase microextraction / gas chromatography-mass spectrometry technology (HS-SPME / GC-MS).

[0044] The specific method of HS-SPME / GC-MS is as follows:

[0045] (1) The seed solution was inoculated into YPD medium at a volume ratio of 1%, and 10 mL of the solution was added to a 15 mL sample bottle. The culture temperature was 30° C. and the shaking speed was 120 rpm for 48 hours.

[0046] (2) HS-SPME extraction conditions: The extraction head was inserted into the headspace of the sample bottle and adsorbed at 60°C for 50 min. The extraction head after adsorption was removed and inserted into the gas chromatography injection port and desorbed at 250°C for 5 min.

[0047] (3) GC analysis conditions: Gas chromatography conditions: HP-INNOWAX chromatographic column (60 m × 0.25 mm × 0.25 μm); heating program: starting temperature 40 °C, hold for 5 min, increase to 100 °C at 4 °C / min, then increase to 230 °C at 6 °C / min, hold for 10 min, carrier gas is high-purity helium (1.0 mL / min); injection port temperature 250 °C, no split.

[0048] Mass spectrometry conditions: electron ionization source, electron energy 70 eV; electron multiplier voltage 350 V; ion source temperature 230 °C; transfer line temperature 250 °C; mass range 40-450 m / z.

[0049] According to the HS-SPME / GC-MS results, a yeast strain with a strong ability to produce 2-octanone was obtained and stored at -80°C with 30% glycerol for further analysis.

[0050] Example 2: Molecular identification of yeast producing 2-octanone

[0051] Biological characteristics of target yeast: Culture on YPD solid medium at 30℃ for 2 days and observe the colony morphology, such as Figure 1 As shown, the colonies are creamy white and dull, and the body is convex and wrinkled.

[0052] Molecular biology identification method: aspirate 1mL of bacterial solution and centrifuge at 10000rpm for 5min, remove the supernatant to obtain bacterial mud, add CTAB solution and phenol-chloroform-isoamyl alcohol (volume ratio of 25:24:1) to extract nucleic acid DNA, centrifuge at 12000rpm for 5min to obtain the supernatant, add an equal volume of chloroform-isoamyl alcohol (volume ratio of 24:1), mix well, centrifuge at 12000rpm for 5min to obtain the supernatant, rinse twice with ethanol solution, centrifuge at 12000rpm for 5min to remove the supernatant, blow dry the precipitate, add 50μL of sterile water to resuspend it, and obtain the strain DNA template.

[0053] The primers were ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') whose ITS sequence was shown in SEQ ID NO: 2 and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') whose ITS sequence was shown in SEQ ID NO: 3, and PCR amplification was performed.

[0054] ①Reaction system (20 μL)

[0055] 10×Ex Taq buffer 2μL ITS1 1μL ITS4 1μL 5u Ex Taq 0.2μL 2.5mM dNTP Mix 1.6μL DNA 0.5μL <![CDATA[ddH2O]]> 13.7μL

[0056] ②Reaction procedure

[0057] Pre-denaturation: 95℃, 5min, denaturation: 95℃, 30s, annealing: 56℃, 30s, extension: 72℃, 1min30s, denaturation, annealing and extension for 25 cycles, final extension: 72℃, 10min.

[0058] The sequencing was completed by Shanghai Sangon Biotechnology Co., Ltd. The gene sequence of the ITS fragment obtained by sequencing was compared with NCBI's BLAST to determine the species information of the strain, which was identified as Pichia kudriavzevii and named Pichia kudriavzevii LZLJ1-3.

[0059] Example 3: Detection experiment of volatile metabolites of yeast

[0060] (1) Preparation of test samples: The glycerol storage tube of Pichia kudriavzevii LZLJ1-3 was dissolved and inoculated into 5 mL of YPD medium, and cultured at 30°C for 12-20 h. After activation for three generations, the inoculation amount was inoculated into 400 mL of fermentation medium at 1% (volume ratio), the culture temperature was 30°C, the shaker speed was 120 rpm, the aerobic culture was carried out for 72 h, and the pH value was 7.0. After the fermentation was completed, the fermentation liquid was obtained, and the supernatant was taken after centrifugation at 10000 rpm for 5 min.

[0061] (2) Detection of volatile metabolites:

[0062] The volatile metabolites in the sample were detected according to the HS-SPME / GC-MS method in Example 1, with 0.822 mg / mL 2-octanol as the internal standard, and the compound search results were matched with the NIST standard library. The target compound was confirmed when the similarity reached more than 80%. The culture broth without bacterial fermentation was used as the blank control group to calculate the substance content.

[0063] Test results such as Figure 2 , Figure 3 , Figure 4As shown, the content of 2-octanone produced by the fermentation of Pichia kudriavzevii LZLJ1-3 was 46.25 mg / L, accounting for 76.28% of the total volatile matter content.

Claims

1. Pichia kudriavzevii, characterized in that: The strain of Pichia kudriavzevii is named Pichia kudriavzevii ( Pichia kudriavzevii ) LZLJ1-3, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, and its deposit number is CGMCC No.26370.

2. Use of the Pichia kudriavzevii described in claim 1 in the preparation of the natural flavor 2-octanone.

3. A process for producing 2-octanone by fermenting Pichia kudriavzevii according to claim 1, characterized in that: After activating Pichia kudriavzevii, the yeast was inoculated into the fermentation medium. The culture temperature was 30°C, the shaking speed was 120 rpm, the culture was aerobic for 72 hours, and the pH value was 7.

0. After the fermentation was completed, the yeast was centrifuged and the supernatant was collected.

4. The process according to claim 3, characterized in that: The activation operation is as follows: inoculate Pichia kudriavzevii into YPD medium, and culture at 20-30° C. for 12-20 hours to activate three generations.

5. The process according to claim 3 or 4, characterized in that: The fermentation medium is: 130 g / L malt extract powder, 0.1 g / L chloramphenicol, pH 7.0, and sterilized by high-pressure steam at 115° C. for 20 minutes; the inoculation amount when inoculating the fermentation medium is 1%-5% by volume.

Images