Osteoarthritis drug preparation in miRNA dosage form and preparation method thereof

Abstract

The present invention belongs to the technical field of osteoarthritis treatment, and specifically provides an osteoarthritis drug preparation in the form of a miRNA dosage form and a preparation method thereof. The drug preparation includes miRNA and lipid nanoparticles, and particles with a diameter of 10-600 nanometers are prepared by a microfluidic chip, and miRNA acts on the ZEB2 gene target to reduce the inflammatory response of osteocytes. The preparation method of the osteoarthritis drug preparation provided by the present invention is simple, rapid, and highly active, and can significantly reduce the expression of proinflammatory factors (TNF-α, IL-6, IL-1β and MCP-1) and apoptosis-related proteins, thereby achieving the purpose of treating osteoarthritis.

Description

Technical Field

[0001] The present invention belongs to the technical field of osteoarthritis treatment, and specifically provides an osteoarthritis drug preparation in the form of a miRNA dosage form and a preparation method thereof. Background Art

[0002] Osteoarthritis (OA) is a chronic joint disease characterized by chronic inflammation, progressive articular cartilage destruction and subchondral bone sclerosis. At present, the treatment strategies for early and mid-stage OA are joint pain relief and intra-articular injections, and the treatment strategy for late-stage OA is joint replacement surgery. The most commonly used method for early and mid-stage osteoarthritis is drug therapy. Oral administration makes it difficult for drugs to reach the lesion area through systemic circulation, which not only has poor therapeutic effects on the disease, but may also produce unnecessary side effects. Intra-articular injection allows drugs to reach the lesion area directly, but existing drugs mainly play an anti-inflammatory and analgesic role, and have little effect on cartilage repair.

[0003] In recent years, the application of microRNA (miRNA) in disease treatment has attracted widespread attention. MiRNA is a small endogenous non-coding RNA molecule consisting of approximately 21-25 nucleotides. These small miRNAs usually target one or more miRNAs, and regulate gene expression by inhibiting or breaking target miRNAs at the translation level, thereby achieving disease treatment at the genetic level. For example, miRNA can effectively accelerate the recovery of cartilage damage by regulating the expression of genes related to cartilage matrix synthesis in chondrocytes, thereby increasing the synthesis of extracellular matrix and inhibiting degradation. However, miRNA is extremely fragile outside the cell and is difficult to enter the cell to exert its biological effects. Therefore, the development of new miRNA drug preparations for the treatment of osteoarthritis has become a research hotspot in the field. Summary of the invention

[0004] The purpose of the present invention is to provide an osteoarthritis drug preparation in the form of a miRNA and a preparation method thereof in view of the problems existing in existing osteoarthritis drugs. The osteoarthritis drug in the form of a miRNA can be directly injected into a joint to achieve cartilage repair while reducing inflammation and relieving pain.

[0005] The objective of the present invention is achieved through the following technical scheme: a miRNA dosage form osteoarthritis drug preparation, the preparation consists of miRNA and lipid nanoparticles (LNP).

[0006] The miRNA is miR-200c-3p, and the sequence is UAAUACUGCCGGGUAAUGAUGGA.

[0007] The amount of miRNA in the osteoarthritis drug preparation in the miRNA dosage form is 100 to 2800 μg / ml.

[0008] LNP is a mixture of distearoylphosphatidylcholine (DSPC), cholesterol and 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (DMG-PEG2000) or ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol.

[0009] The osteoarthritis drug in the form of a miRNA is a particle composition with a diameter between 20 and 600 nanometers.

[0010] The drug preparation targets the ZEB2 gene. The miRNA-based osteoarthritis drug is used to prevent or improve osteoarthritis.

[0011] The administration routes of miRNA-based osteoarthritis drugs include subcutaneous, intramuscular, intravenous, and intra-articular injections.

[0012] Another aspect of the present invention:

[0013] The osteoarthritis drug preparation in the form of miRNA is prepared using a microfluidic device. The preparation method comprises the following steps:

[0014] (1) dissolving the liposome raw material in anhydrous ethanol to form solution A;

[0015] (2) dissolving the miRNA in a citric acid buffer to form solution B;

[0016] (3) After mixing the solution A and the solution B using a microfluidic nanomedicine production device, dialyzing using a PBS buffer solution, and sterilizing the filter membrane to obtain a miRNA-formulated osteoarthritis drug.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. miRNA drugs can inhibit inflammation at the genetic level, increase the synthesis of extracellular matrix and inhibit its decomposition, which can effectively accelerate the recovery of cartilage damage. This overcomes the disadvantage that existing drugs mainly play anti-inflammatory and analgesic effects, but have little effect on cartilage repair.

[0019] 2. The method of encapsulating miRNA with lipid nanoparticles overcomes the disadvantages of miRNA being extremely fragile outside the cell and having difficulty entering the cell to exert its biological effects.

[0020] 3. The production of osteoarthritis drugs in the form of miRNA through microfluidic technology can effectively reduce production costs; the physical and chemical properties of the prepared nanoparticles (including particle size, potential, encapsulation rate, and stability) are relatively uniform, and the production and purification processes are easy to achieve standardized operations, further saving time and economic costs.

[0021] 4. The miRNA formulation of osteoarthritis drugs can reduce the expression levels of TNF-α, IL-6, IL-1β, and MCP-1 proteins in mouse ADTC5 cells after LPS stimulation, enhance cell viability, antagonize cell apoptosis, reduce the expression of MMP3, MMP13, and ADAMTS-4, and increase the expression of Collagen II. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a graph showing the effect of the flow rate ratio of the aqueous phase and the ethanol phase in the microfluidic channel on the particle size (Z-AVE) and dispersibility (PDI) of osteoarthritis drugs in the preparation of miRNA dosage forms.

[0023] Figure 2 This is a graph showing the effect of the total flow rate of water phase and ethanol in the microfluidic channel on the particle size (Z-AVE) and dispersibility (PDI) of osteoarthritis drugs in the preparation of miRNA dosage forms.

[0024] Figure 3 The effect of different miR-200c-3p concentrations on the encapsulation rate of miR-200c-3p in miRNA dosage forms of osteoarthritis drugs.

[0025] Figure 4 Electron micrograph of the drug preparation.

[0026] Figure 5 Particle size and dispersion changes of miRNA-formulated osteoarthritis drugs over time under physiological conditions.

[0027] Figure 6 Effect of LPS on ATDC5 cell activity and miR-200c-3p expression level. A. CCK-8 was used to detect cell activity after LPS treatment, B. miR-200c-3p expression level after LPS treatment. Compared with Control, ***p<0.001.

[0028] Figure 7 RT-PCR was used to detect the expression level of miR-200c-3p in ATDC5 cells treated with LPS and transfected with Lipo-miR-200c-3p, ***p<0.001.

[0029] Figure 8Figure 3. Lipo-miR-200c-3p inhibited LPS-induced viability damage in ATDC5 cells after delivering miR-200c-3p.

[0030] Fig. 9 Figure 3. Effect of Lipo-miR-200c-3p delivering miR-200c-3p on the expression of inflammatory factors in ATDC5 cells.

[0031] Fig.10 Effect of Lipo-miR-200c-3p on ATDC5 cell apoptosis by miR-200c-3p. A: Tunel staining to observe changes in cell apoptosis, B: Expression changes of apoptosis-related proteins (bcl2, bax, cleaved-caspase3, caspase3). *p<0.05, ***p<0.001.

[0032] Fig.11 The effect of lipo-miR-200c-3p on the matrix and related proteases of ATDC5 cells. Western blot was used to detect the expression levels of MMP3, MMP13, ADAMTS-4 and Collagen II, *p<0.05, **p<0.01, ***p<0.001.

[0033] Fig.12 After transfection of miR-200c-3p in ATDC5 cells, the expression level of ZEB2 was detected, **p<0.01.

[0034] Fig.13 The results of dual luciferase reporter gene experiments suggested that miR-200c-3p and ZEB2 were bound, *p<0.05.

[0035] Fig.14 The effect of knocking down ZEB2 on the content of proinflammatory factors (TNF-α, IL-6, IL-1β and MCP-1) in cells was determined by ELISA, **p<0.01.

[0036] Fig.15 Western blot was used to detect the effect of knocking down ZEB2 on the expression levels of MMP3, MMP13, ADAMTS-4 and Collagen II, *p<0.05, **p<0.01, ***p<0.001.

[0037] Fig.16 ALC-miR-200c-3p transmits miR-200c-3p to affect the expression of inflammatory factors in ATDC5 cells.

[0038] Fig.17Schematic diagram of a vortex mixer used in the present invention. DETAILED DESCRIPTION

[0039] To further illustrate the present invention, specific implementation methods are as follows.

[0040] Example 1 Preparation and Detection of Nanoparticle Lipo-miR-200c-3p

[0041] (1) A vortex mixer was made using microfluidic chip technology to prepare liposomes for encapsulating miR-200c-3p.

[0042] The homemade vortex mixer of the present invention has an S-shaped mixing chip, the two ends of the left side Y are inlets, and the right side is an outlet, which is conducive to preparing particles with a size at the nanometer level and uniform particle size.

[0043] (2) Dipalmitoylphosphatidylcholine (DPPC), cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG2000) were dissolved in 5 ml of methanol solution at a molar ratio of (90:5:5) as solution A (methanol phase). 10 μg of bioprocessed miR-200c-3p (solid powder) was dispersed in 5 ml of citric acid buffer solution as solution B (aqueous phase). Then, solution A and solution B were injected into a homemade mixer at different flow rate ratios to form a liposome nanoparticle solution loaded with miR-200c-3p (Lipo-miR-200c-3p). The initial lipid (dipalmitoylphosphatidylcholine (DPPC)) concentration in the formula was 4 mg / ml, the water:organic flow rate ratio (FRR) was 4:1, and the total flow rate (TFR) was 25 ml / min.

[0044] In order to optimize the conditions for preparing liposomes in microfluidic chips, the flow rate ratio and total flow rate of the two channels were investigated. Figure 1 As shown in the figure, as the flow rate ratio increases from 1:1 to 5:1, the particle size of the prepared liposomes gradually decreases from 143nm to 95nm. Considering the particle size and uniformity (PDI), the flow rate ratio of 3:1 was selected for subsequent experiments. Under the condition of a fixed flow rate ratio of 3:1, the total flow rate was further explored. Figure 2 It can be seen that as the total flow rate continues to increase, the particle size of the prepared liposomes continues to decrease and the PDI gradually increases. Taking into account the particle size and uniformity, the total flow rate is fixed at 15ml / min: 5ml / min.

[0045] (3) The concentration of miR-200c-3p solution was changed from 250 μg / mL to 500 μg / mL, 1000 μg / mL, 2000 μg / mL, and 4000 μg / mL in sequence. According to the liposome ratio, optimal flow rate ratio, and total flow rate in step (2), the relationship between miR-200c-3p concentration and encapsulation efficiency was studied ( Figure 3 ),from Figure 3 It can be seen that the greater the concentration of miR-200c-3p, the higher the encapsulation rate. When the concentration of miR-200c-3p is 250μg / mL, the encapsulation rate is 40%, and the amount of miRNA in the osteoarthritis drug preparation of the miRNA dosage form is 100μg / mL. When the concentration of miR-200c-3p is 4000μg / mL, the amount of miRNA in the osteoarthritis drug preparation of the miRNA dosage form is 2800g / mL. Therefore, by adjusting the concentration of the miR-200c-3p solution, it is easy to prepare osteoarthritis drugs with a miRNA dosage of 100-2800μg / mL.

[0046] (3) All newly formed liposomes (8 ml) were buffer exchanged by dialysis in 1×PBS pH 7.4 for 1 hour under magnetic stirring to ensure that all liposomes were in solution in 1×PBS pH 7.4. Any non-incorporated free miR-200c-3p was removed by centrifugation and dialysis.

[0047] (4) Transmission electron microscopy (TEM): The morphology of Lipo-miR-200c-3p nanoparticles was observed using JEOL JEM-2010TEM at an accelerating voltage of 100 KV ( Figure 4 ). TEM imaging showed that the particle size of Lipo-miR-200c-3p was about 100 nm.

[0048] (5) Dynamic light scattering (DLS): The particle size distribution of Lipo-miR-200c-3p nanoparticles was measured by dynamic light scattering (DLS). The particle size, particle distribution index (PDI) and Zeta potential of the nanoparticles were determined using a Zetasizer Nano-ZS 90 particle size analyzer and a potentiometer from Malvern.

[0049] (6) 12-week stability test of Lipo-miR-200c-3p nanoparticle size: The prepared Lipo-miR-200c-3p nanoparticles were stored in a refrigerator at 4°C. A portion was taken at regular intervals for particle size test to analyze its stability ( Figure 5 ).like Figure 4 As shown in the figure, the particle size was maintained between 100 and 140 nm for 12 weeks, and the PDI was maintained between 0.2 and 0.3. The structure of Lipo-miR-200c-3p remained stable after long-term storage. The particle size distribution was uniform, which was conducive to storage.

[0050] Example 2

[0051] Study on the effects of liposome nanoparticles Lipo-miR-200c-3p on inflammatory response and apoptosis of ATDC5 cells

[0052] Establishment of cell inflammation model

[0053] ATDC5 cells were cultured in DMEM medium containing 10% FBS. When the cells grew to 70%, 350 μg / ml LPS was used to induce the cells for 6 h, 12 h and 24 h to construct an osteoarthritis chondrocyte model ( Figure 5 The experimental results showed that when ATDC5 cells were treated with 350 μg / ml LPS for 6 h, 12 h, and 24 h, the cell viability and expression of miR-200c-3p gradually decreased over time, and compared with the control group, the cell viability decreased significantly after LPS treatment for 12 h and 24 h ( Figure 5 Therefore, the condition of 350 μg / ml LPS inducing ATDC5 cells for 24 h was selected to construct the osteoarthritis chondrocyte model.

[0054] Cell transfection

[0055] ATDC5 cells were seeded in 12-well plates or 6-well plates, and transfection was performed when the cell confluence reached 70%-80%.

[0056] (1) Remove the culture plate and place it on a sterile clean bench to replace the cells with fresh complete culture medium.

[0057] (2) Dilute Lipo-miR-200c-3p: Use a certain amount of Opti-MEM transfection medium and an appropriate volume of Lipo-miR-200c-3p in an EP tube, and then divide it evenly into the wells of the culture plate. On the second day, replace it with fresh medium and continue to culture for subsequent experiments. The sequence of miR-200c-3p is as follows:

[0058]

[0059] The experimental results show that ( Figure 6 ), after LPS treatment of ATDC5 cells, the miR-200c-3p content was significantly reduced compared with the control group. After Lipo-miR-200c-3p transfection of miR-200c-3p, the expression of miR-200c-3p was significantly increased compared with the LPS and LPS+miR-NC groups, indicating that Lipo-miR-200c-3p can efficiently deliver miR-200c-3p into cells and successfully transfect.

[0060] CCK8 detection

[0061] ATDC5 cells were cultured in DMEM complete medium. The second generation of chondrocytes grew to 90%, and the cells grew well. The complete medium was removed from the cells in the logarithmic growth phase with an aspirator, PBS was added to wash the culture dish, and 0.25% trypsin containing EDTA was digested for 3 minutes. 3 ml of complete medium containing serum was added to terminate the digestion. The ATDC5 cells were then centrifuged, and the cells were resuspended and counted after being blown. 5×103 cells were inoculated in a 96-well plate, and 3 replicates were set up in each group. They were cultured for 6h, 12h and 24h, respectively. The old medium was discarded, and 10μl of CCK8 solution was added to each well after washing with PBS, and incubated at 37℃ for 2h. The well plate was placed in a preheated microplate reader, and the absorbance (OD) of each well was measured at 450nm.

[0062] The results of CCK8 experiments showed that after LPS induction, the viability of ATDC5 cells decreased significantly. However, after LPS treatment and transfection of miR-200c-3p, the cell viability increased compared with that after LPS treatment. After LPS treatment, the viability of ATDC5 cells increased compared with that of the LPS+miR-NC group after adding Lipo-miR-200c-3p and transfecting miR-200c-3p, indicating that the delivery of miR-200c-3p via Lipo-miR-200c-3p can effectively inhibit LPS-induced cell viability damage ( Figure 7 ).

[0063] RT-PCR

[0064] ATDC5 cells were seeded in 12-well plates at a density of 50,000 cells / well, and mRNA was extracted after experimental treatment.

[0065] mRNA extraction and quantification steps:

[0066] (1) Take out the 12-well plate after experimental treatment, remove the complete culture medium, wash twice with PBS, add 500 μl TRIZOL lysis buffer to each well, and let it stand at room temperature for 5 min.

[0067] (2) Pipette the mRNA lysate into a 1.5 ml EP tube, add 100 μl of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 10 minutes.

[0068] (3) Centrifuge at 1.3×104 rpm for 15 min, take the supernatant and place it in a new 1.5 ml EP tube, add 700 μl of isopropanol, mix thoroughly, and let stand at room temperature for 10 min.

[0069] (4) After standing, continue centrifugation at the same speed for 10 min, remove the supernatant, then add 500 μl of 75% ethanol, centrifuge at 6000 rpm for 5 min, and repeat 3 times.

[0070] (5) Remove the remaining ethanol in the centrifuge tube, dry it, add 20-40 μl of deionized water to dissolve the mRNA, and quantify the mRNA concentration using an enzyme marker after 5 minutes. Use TRIZOL solution to lyse and extract the RNA, adjust the concentration to 1 μg / μl, and then start reverse transcription and fluorescence quantitative PCR. The reaction system is as follows:

[0071]

[0072] Mix the above system, incubate at 50℃ for 5min, then 85℃ for 5s to obtain cDNA.

[0073] After reverse transcription, perform Q-PCR according to the reaction system shown in the table below:

[0074]

[0075] Perform PCR amplification as follows:

[0076]

[0077] A total of 40 cycles were performed according to the procedure. The RT-PCR instrument was used to observe whether the primers were feasible, and U6 was used as an internal reference. The 7000HT PCR instrument (AB Company, USA) was used to detect the mRNA level, and the 2-△△CT method was used to analyze the data.

[0078] The PCR primer sequences are as follows:

[0079]

[0080] The results show that Figure 8 ), after LPS treatment of ATDC5 cells, the expression of proinflammatory factors such as TNF-α, IL-6, IL-1β and MCP-1 increased significantly. After LPS treatment and transfection of miR-200c-3p, the expression of proinflammatory factors in ATDC5 cells was significantly lower than that in the LPS group, indicating that overexpression of miR-200c-3p can alleviate LPS-induced cellular inflammatory response to a certain extent. After adding Lipo-miR-200c-3p and transfecting miR-200c-3p, the content of proinflammatory factors was significantly lower than that in LPS+miR-200c-3p, indicating that the delivery of miR-200c-3p via Lipo-miR-200c-3p can more effectively inhibit the LPS-induced inflammatory response of ATDC5 cells.

[0081] ELISA

[0082] The expression of (TNF)-α, IL-1β, IL-6 and MCP-1 in the culture supernatant of ATDC5 cells was detected by ELISA (standard double antibody sandwich method). The OD values ​​were read at 450nm and 570nm (reference) on an ELISA reader, and the concentrations were calculated using the Gen5 DataAnalysis software based on the standard curve.

[0083] (1) Sample collection and storage

[0084] ATDC5 cells were seeded in a 12-well plate at a concentration of 100,000 per well. After LPS-induced osteoarthritis chondrocyte model, miRNA was transfected 24 hours later. After 48 hours of culture, 500 μl of cell culture supernatant was collected, centrifuged to remove the precipitate, and then tested or aliquoted and stored at -20°C.

[0085] (2) Reagent preparation

[0086] ①1x washing solution: dilute 20x concentrated washing solution to 1x according to a certain ratio and store at room temperature.

[0087] ②1x detection buffer: dilute 10x concentrated buffer to 1x according to a certain ratio and use immediately.

[0088] ③ Detection Antibody: Mix the detection antibody thoroughly and dilute the concentrated detection antibody with 1x detection buffer as needed.

[0089] ④ Dilute horseradish peroxidase-labeled streptavidin with 1x detection buffer.

[0090] ⑤ Preparation of TNF-α, IL-1β, IL-6 and MCP-1 standards: Use a certain volume of distilled water to re-dissolve TNF-α, IL-1β, IL-6 and MCP-1 standards according to the requirements of use, so that the concentration of the re-dissolved standards is 20000pg / ml.

[0091] (3) Preparation of cell culture supernatant sample standard curve:

[0092] Take 250 μl of diluted TNF-α, IL-1β, IL-6 and MCP-1 standards respectively, and add the same volume of complete culture medium, and use the highest concentration (10000 pg / ml) as the standard curve. Add 250 μl of culture medium to other EP tubes to be diluted, take the highest concentration standard, and dilute it in a 1:1 series after pipetting.

[0093] (4) Detection steps

[0094] ① Calculate the required test slats according to the experimental design and remove them from the slats.

[0095] ② Add 250 μl 1× washing solution to the detection wells, place the detection plate on a shaker and rotate (45 rpm) for 2 min, remove the washing solution, and tap the microplate upside down on absorbent paper several times to fully remove the residual washing solution.

[0096] ③ Add 100 μl of diluted TNF-α, IL-1β, IL-6 and MCP-1 standards to the duplicate wells.

[0097] ④ Add 20 μl of cell culture supernatant and 80 μl of 1x detection buffer to the sample well.

[0098] ⑤Add 50 μl of diluted detection antibody respectively.

[0099] ⑥ Seal the plate with sealing film, place the detection plate on a shaker at 300 rpm, and incubate in the dark for 2 hours.

[0100] ⑦Repeat step ②.

[0101] ⑧ Add 100 μl of diluted horseradish peroxidase-labeled streptavidin dropwise.

[0102] ⑨ Seal the plate with a sealing film, place the test plate on a shaker at 300 rpm, and incubate at room temperature in the dark for 30-60 minutes.

[0103] ⑩Repeat step ②.

[0104] 100 μl of the color development substrate TMB was added to each well and incubated in an incubator for 30 min.

[0105] Add 100 μl of stop solution to each detection well, and measure the OD value at an absorption wavelength of 450 nm using an enzyme reader within 30 minutes.

[0106] Tunel staining

[0107] ATDC5 cells were inoculated on glass slides. After 24 hours of cell culture, LPS was used to stimulate the cells, followed by cell transfection. After appropriate treatment time, the cells were washed with PBS and fixed with 4% paraformaldehyde for 30 minutes, and then permeabilized with 0.2% Triton X-100. 50μl of Equilibration Buffer was added and incubated for 30 minutes. Then TdT buffer containing FITC-12-dUTPLabling Mix was added and incubated at 37°C in the dark for 60 minutes. The glass slides were washed twice with PBS, and then immersed in 0.3% DAPI solution, incubated at room temperature in the dark for 5 minutes, washed with deionized water for 3 times, and 10μl of anti-fluorescence attenuation reagent was added. The slides were then sealed with coverslips and placed under a fluorescence microscope to observe changes in cell apoptosis. The results were analyzed using Image J software after taking pictures.

[0108] After ATDC5 cells were induced by LPS, the expression of pro-apoptotic factors bax and cleaved caspase3 was upregulated, and the expression of anti-apoptotic factor bcl-2 was downregulated. After LPS treatment and transfection of miR-200c-3p, the expression levels of pro-apoptotic factors bax and cleaved caspase3 in ATDC5 cells were significantly lower than those in the LPS group, while the expression of anti-apoptotic factor bcl-2 was increased, indicating that overexpression of miR-200c-3p can inhibit LPS-induced cell apoptosis to a certain extent. After adding Lipo-miR-200c-3p and transfecting miR-200c-3p, the expression levels of pro-apoptotic factors bax and cleaved caspase3 were reduced compared with the LPS+miR-200c-3p group, indicating that the delivery of miR-200c-3p via Lipo-miR-200c-3p can more effectively inhibit LPS-induced ATDC5 cell apoptosis ( Fig. 9 ).

[0109] Western blot

[0110] (1) Protein extraction and processing

[0111] ATDC5 cells in the logarithmic growth phase were inoculated in a 6-well plate at a density of 2×106 per well, and clathrin was extracted 48 hours later. The treated 6-well plate was taken, the culture medium was removed, the cells were washed, and the 6-well plate was placed on ice. 200 μl RIPA protein lysis buffer was added to each well to lyse the cells, and the protein lysate was collected in a 1.5 ml EP tube. After centrifugation, the precipitate at the bottom of the tube was removed, and the protein solution was carefully aspirated.

[0112] Add 50μl of 5x lodding buffer to each tube, repeatedly blow the cytoplasmic protein solution, place the fully mixed protein solution in an ultrasonic disruptor, and sonicate 4 times at low temperature, voltage 220V, 2 seconds each time. After the protein sample is heated for 5 minutes after sonication, place it on ice to cool down before loading or place it in a -80℃ refrigerator for later use.

[0113] (2) SDS-PAGE gel preparation

[0114] The formula of SDS-PAGE gel is as follows. After the gel solidifies, place it in clean water and store it in a refrigerator at 4°C for later use.

[0115] Ingredients 12% separation gel (10ml) 15% separation gel (10ml) 5% concentration gel (3ml)

[0116] Distilled water 2.0ml 1ml 2.1ml

[0117] 30% acrylamide 4.0ml 5.0ml 0.5ml

[0118] Tris-HCL 3.8ml(1.5M pH8.8)3.8ml(1.5M pH8.8)0.38(1.0M pH6.8)

[0119] 10%SDS 0.1ml 0.1ml 0.03ml

[0120] 10% ammonium persulfate 0.1ml 0.1ml 0.03ml

[0121] TEMED 0.004ml 0.004ml 0.003ml

[0122] (3) Electrophoretic separation

[0123] Take out the spare SDS-PAGE gel, put the gel rack into the electrophoresis tank, and add 500ml of 1x electrophoresis buffer. Take out the cytoplasmic protein and put it on ice to melt. Load 20μl of cytoplasmic protein into the SDS-PAGE gel loading hole, and load 2μl of protein marker at the same time. Turn on the power and set the voltage to 100V. When the protein sample runs to the contact surface between the concentrated gel and the separation gel, adjust the voltage to 120V. When the bromophenol blue migrates to the bottom edge of the glass plate, cut off the power, remove the glass plate, and start the membrane transfer.

[0124] (4) Transfer

[0125] Open the glass plate, take out the SDS-PAGE gel after cytoplasmic protein separation, and remove the concentrated gel. Determine the position of the measured protein according to the Marker separation band, remove other gels, and cut the corresponding SDS-PAGE gel fragments. Cut the PVDF membrane to the same size as the cut gel, soak it in 75% ethanol to activate the PVDF membrane, and then place the PVDF, gel, and filter paper in the transfer buffer; assemble the transfer tank, and assemble the transfer structure by sandwich method. The transfer sequence is: negative pole of power supply → sponge layer → filter paper → SDS-PAGE gel fragment → nitrocellulose membrane → filter paper → sponge layer → positive pole of power supply. Immerse the transfer structure in the transfer solution and remove the bubbles between the filter paper, SDS-PAGE gel and PVDF membrane. Place the transfer tank in ice, add an appropriate amount of transfer buffer, connect the power supply (current 250mA), turn off the power supply after the transfer, take out the hybridization membrane, and recover the transfer solution.

[0126] (5) Immunohistochemical hybridization and imaging

[0127] ① Place the hybridization membrane in 10 ml of blocking solution (5% skim milk) and block on a shaker for 1 hour.

[0128] ② Prepare 1ml-3ml of primary antibody diluent according to the experimental requirements. The primary antibody dilution multiple is determined according to the antibody instructions. Seal the hybridization membrane blocked with skim milk in a disposable plastic film, add the corresponding primary antibody diluent, remove the bubbles in the plastic film, seal the plastic film, place the blocked hybridization membrane on a shaker (speed 25 times / min), and incubate at 4°C overnight.

[0129] ③ Take out the hybridization membrane after incubation, place it in 10 ml TBST buffer, and wash it 3 times on a shaking table at 45 rpm.

[0130] ④ Dilute the secondary antibody (1:5000) in 5% skim milk, place the hybridization membrane in the skim milk containing the secondary antibody, and incubate on a shaker at room temperature for 1 hour.

[0131] ⑤Take out the hybridization membrane after incubation with the secondary antibody and repeat step ③.

[0132] ⑥ Development: Place the hybridized membrane on a plastic film in a dark room, add 200μl of the prepared ECL supersensitive developer (solution 1 and solution 2 mixed in proportion), place the film on the plastic film, and then put it into the X-ray film box. Quickly place the exposed film in the developer, the developer treatment depends on the brightness of the film strip, then place the film in the fixer and quickly rinse for 3 minutes, wash with water and dry at room temperature.

[0133] ⑦ The protein bands in the film were scanned by computer, quantified by Image J software, and the experimental data were processed by Graphpad Prism software.

[0134] The experimental results show that ( Fig.10 ): After ATDC5 cells were induced by LPS, the expression of MMP3, MMP13 and ADAMTS-4 in the cells increased significantly, and the expression of Collagen II decreased significantly. After LPS treatment and transfection of miR-200c-3p, the expression of MMP3, MMP13 and ADAMTS-4 in ATDC5 cells decreased, and the expression of Collagen II increased. After adding Lipo-miR-200c-3p and transfecting miR-200c-3p, compared with the LPS+miR-200c-3p group, the expression of MMP3, MMP13 and ADAMTS-4 decreased, and the expression of Collagen II increased.

[0135] Target gene analysis

[0136] On the basis of LPS-induced ATDC5 cells, miR-200c-3p was transfected (the transfection process was the same as above), and the expression of ZEB2 was detected. The qRT-PCR results showed that compared with the control group, the expression of ZEB2 was significantly downregulated after transfection with miR-200c-3p ( Fig.11 ), in order to further verify the binding of miR-200c-3p and ZEB2 gene, we performed a dual luciferase reporter gene experiment and confirmed that miR-200c-3p and ZEB2 can bind ( Fig.12 ) Subsequently, in order to study the effect of ZEB2 on inflammatory factors and cartilage matrix synthesis and catabolism, we designed siRNA for ZEB2 and specifically knocked down ZEB2 in LPS-induced ATDC5 cells. The expression levels of proinflammatory factors (TNF-α, IL-6, IL-1β and MCP-1) were detected by ELISA, and the expression levels of cartilage catabolism-related proteins (MMP3, MMP13, ADAMTS-4) and cartilage anabolism-related protein Collagen II were detected by western blot. Our studies have shown that proinflammatory factors (TNF-α, IL-6, IL-1β and MCP-1)( Fig.13 ) and cartilage catabolism-related proteins (MMP3, MMP13, ADAMTS-4) were significantly decreased, while the expression level of cartilage anabolism-related protein Collagen II was significantly increased ( Fig.14 The above results indicate that miR-200c-3p enhances the proliferation ability, cell cycle and cartilage anabolism of ATDC5 cells induced by LPS by binding to the ZEB2 gene, and inhibits cell apoptosis, inflammatory infiltration and cartilage catabolism.

[0137] Example 3

[0138] Study on the effects of nanoparticles prepared with different lipid materials to deliver miR-200c-3p on inflammatory response and apoptosis of ATDC5 cells

[0139] (1) Liposomes were prepared using the vortex mixer described in Example 1, and the lipid material was ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) to encapsulate miR-200c-3p.

[0140] (2) ((4-hydroxybutyl) azadiyl) bis(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG2000) were dissolved in 5 ml of methanol solution at a molar ratio of (80:10:10) as solution A (methanol phase). 500 μg of processed and synthesized miR-200c-3p solution was dispersed in 5 ml of citric acid buffer solution (concentration of 100 μg / ml) as solution B (aqueous phase). Then, solution A and solution B were simultaneously injected into a homemade mixer at different flow rate ratios to form a liposome nanoparticle solution loaded with miR-200c-3p (ALC-miR-200c-3p). The total flow rate and flow rate ratio adopted the optimized conditions in Example 1.

[0141] (3) Cellular Inflammation Model Refer to Example 2.

[0142] (4) RT-PCR process Referring to Example 2, a transfection experiment was performed using newly prepared liposome-encapsulated miR-200c-3p to examine the effect of LPS treatment on the expression of inflammatory factors in ATDC5 cells. The results showed that ( Fig.16 ), after LPS treatment of ATDC5 cells, the expression of pro-inflammatory factors such as TNF-α, IL-6, IL-1β and MCP-1 increased significantly. After LPS treatment and transfection of miR-200c-3p with newly prepared liposomes, the expression of pro-inflammatory factors in ATDC5 cells was significantly lower than that in the LPS group, indicating that different cationic lipid materials can be well transfected with miR-200c-3p and effectively inhibit the LPS-induced inflammatory response of ATDC5 cells.

Claims

1. A miRNA dosage form osteoarthritis drug preparation, characterized in that: The pharmaceutical preparation consists of miRNA and lipid nanoparticles; the miRNA is miR-200c-3p, and the sequence number is UAAUACUGCCGGGUAAUGAUGGA; The lipid nanoparticles are prepared using dipalmitoylphosphatidylcholine DPPC, cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol DSPE-PEG2000 as raw materials, or using ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) ALC-0315, cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol DSPE-PEG2000 as raw materials; The preparation method of the osteoarthritis drug preparation in the miRNA dosage form comprises the following steps: (1) Mixing lipid nanoparticle raw materials in ethanol as solution A; (2) Dispersing miRNA in citric acid buffer solution as solution B; (3) Solution A and solution B are then injected into the microfluidic chip at the same time and mixed, and dialyzed using PBS buffer. After the filter membrane is sterilized, a miRNA-based osteoarthritis drug preparation is obtained.

2. The osteoarthritis pharmaceutical preparation in the form of miRNA according to claim 1, characterized in that: The concentration of the miRNA as an active ingredient in the bone and joint pharmaceutical preparation is 100-2800 μg / ml.

3. The osteoarthritis pharmaceutical preparation in the form of miRNA according to claim 1, characterized in that: The drug preparation is a particle composition with a diameter between 20 and 600 nanometers.

4. The osteoarthritis pharmaceutical preparation in miRNA dosage form according to claim 1, characterized in that: The target of the pharmaceutical preparation is the ZEB2 gene.

5. The osteoarthritis pharmaceutical preparation in miRNA dosage form according to claim 1, characterized in that: The administration methods of the pharmaceutical preparation include subcutaneous, intramuscular, intravenous and intra-articular injection.

Images