Biomarkers for Thoracic Aortic Aneurysms and Their Applications

Abstract

The present invention discloses a thoracic aortic aneurysm biomarker and its application, and the biomarker is miR-885-3p. The present invention firstly studies and finds that compared with healthy controls, miR-885-3p is significantly highly expressed in patients with thoracic aortic aneurysm (p < 0.01), indicating that miR-885-3p can be used as a biomarker for thoracic aortic aneurysm, and can be used to assist in the diagnosis of thoracic aortic aneurysm in the early stage; at the same time, the present invention also studies and finds that inhibiting the expression of miR-885-3p can inhibit aortic diameter expansion, alleviate aortic cell apoptosis, and inhibit vascular smooth muscle cell migration and invasion, indicating that miR-885-3p can be used as a therapeutic target for thoracic aortic aneurysm.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a thoracic aortic aneurysm biomarker and application thereof. Background Art

[0002] Aortic aneurysm (AA) is a cardiovascular disease caused by vascular wall lesions. When the disease occurs, the aorta undergoes local or widespread pathological expansion (exceeding 50% of the normal blood vessel diameter), which seriously threatens human health. AA can be limited to a certain section of the aorta, such as the ascending aorta, thoracic aorta, abdominal aorta, etc., or it can involve the entire aorta. Among them, the incidence of thoracic aortic aneurysm (TAA) has been increasing.

[0003] The occurrence of TAA is not related to age and gender. It is a high-risk disease caused by tumor-like expansion due to structural damage and weakening of the aortic wall caused by various reasons. Vascular smooth muscle cells (vSMCs) are one of the main components of the aortic wall and can be divided into static contractile type and activated synthetic type. The phenotypic conversion of VSMCs is related to vascular diseases and is therefore also considered to be one of the factors affecting TAA.

[0004] Currently, there are limited treatments for TAA. Although aortic replacement and intravascular stent implantation can be used as effective treatments for TAA, the large surgical trauma and complex postoperative complications are important factors affecting the treatment effect of TAA. Therefore, finding a precise therapeutic target from the pathogenesis of TAA has become a research hotspot in this field.

[0005] Studies have found that the phenotypic conversion of VSMCs is regulated by a class of small non-coding RNA molecules, namely microRNA; when a part of the microRNA sequence (called the seed region) interacts with the 3′-UTR region of the mRNA transcript, translation inhibition occurs. For example, the Chinese invention application with publication number CN105925705A discloses a marker for aortic aneurysm, which is miR663a; the study found that compared with the healthy control group, the miR663a content in the serum of patients with aortic aneurysm was significantly increased, and there was a correlation between miR663a and the onset time: the shorter the onset time, the higher the miR663a content. Therefore, miR663a can be used to assist in the diagnosis of aortic aneurysm.

[0006] So far, there has been no report on the association of miR-885-3p with thoracic aortic aneurysm. Summary of the invention

[0007] The purpose of the present invention is to provide a thoracic aortic aneurysm biomarker and its application, which provides a new target for the auxiliary diagnosis and treatment of thoracic aortic aneurysm.

[0008] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is:

[0009] A thoracic aortic aneurysm biomarker, the biomarker is miR-885-3p.

[0010] The present invention is the first to study and find that, compared with healthy controls, miR-885-3p is significantly overexpressed in patients with thoracic aortic aneurysm (p < 0.01), indicating that miR-885-3p can be used as a biomarker for thoracic aortic aneurysm and can be used to assist in the early and rapid diagnosis of thoracic aortic aneurysm.

[0011] The present invention also provides a reagent for detecting the expression level of miR-885-3p, which includes PCR primers for specifically amplifying miR-885-3p, a probe that specifically binds to miR-885-3p, or a gene chip fixed with the probe; those skilled in the art can develop the above reagent based on the sequence of miR-885-3p, as long as the expression level of miR-885-3p can be accurately detected.

[0012] As an example of a specific embodiment, the PCR primers for specifically amplifying miR-885-3p may include:

[0013] Upstream primer: 5′-CGTTAGGCAGCGGGGTGTAG-3′;

[0014] Downstream primer: 5′-ATCCAGTGCAGGGTCCGAGG-3′.

[0015] The present invention also provides the use of a reagent for detecting the expression level of miR-885-3p in preparing a thoracic aortic aneurysm diagnosis kit.

[0016] The present invention also provides the use of a miR-885-3p inhibitor in the preparation of a drug for treating thoracic aortic aneurysm. The present invention has found that inhibiting the expression of miR-885-3p can inhibit aortic diameter expansion, alleviate aortic cell apoptosis, and inhibit vascular smooth muscle cell migration and invasion, indicating that miR-885-3p can be used as a therapeutic target for thoracic aortic aneurysm.

[0017] The present invention also provides another thoracic aortic aneurysm biomarker, which is the RGS8 gene or its expression product.

[0018] The present invention first discovered that the target mRNA of miR-885-3p is the RGS8 gene, and miR-885-3p exerts its effect (i.e., induces thoracic aortic aneurysm) by inhibiting the expression of the RGS8 gene. Therefore, the RGS8 gene or its expression product can also be used as a biomarker for thoracic aortic aneurysm, and by detecting the expression level of the RGS8 gene or its expression product, thoracic aortic aneurysm can be assisted in the diagnosis.

[0019] Based on this, the present invention also provides a reagent for detecting the expression level of RGS8, which includes a PCR primer for specifically amplifying the RGS8 gene, a probe that specifically binds to the RGS8 gene, a gene chip fixed with a probe that specifically binds to the RGS8 gene, or an antibody that specifically binds to the RGS8 protein. Those skilled in the art can develop the above reagent based on the RGS8 gene or the RGS8 protein, as long as the expression level of the RGS8 gene and its expression product can be accurately detected.

[0020] As an example of a specific implementation, the PCR primers for specifically amplifying the RGS8 gene may include:

[0021] Upstream primer: 5′-GGATGCCTGTCTCACAAGTCA-3′;

[0022] Downstream primer: 5′-CCTCGTAGCTTCTTCTGTCGATA-3′.

[0023] The present invention also provides the use of the above reagent for detecting the expression level of RGS8 in preparing a diagnostic kit for thoracic aortic aneurysm.

[0024] The present invention also provides the use of the RGS8 expression promoter in the preparation of a thoracic aortic aneurysm treatment drug.

[0025] The present study found that promoting RGS8 expression can inhibit aortic diameter expansion, alleviate aortic cell apoptosis, and inhibit vascular smooth muscle cell migration and invasion, indicating that RGS8 can be used as a therapeutic target for thoracic aortic aneurysm.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] (1) The present invention first discovered that, compared with healthy controls, miR-885-3p was significantly overexpressed in patients with thoracic aortic aneurysm (p < 0.01). At the same time, the targeted mRNA of miR-885-3p was the RGS8 gene. miR-885-3p exerted its effect by inhibiting the expression of the RGS8 gene, which resulted in a significantly low expression of RGS8 in patients with thoracic aortic aneurysm compared with healthy controls (p < 0.001). This indicated that miR-885-3p and RGS8 or their expression products could be used as biomarkers for thoracic aortic aneurysm, and could be used to assist in the early and rapid diagnosis of thoracic aortic aneurysm, thus providing a new approach for the early and rapid diagnosis of thoracic aortic aneurysm.

[0028] (2) The present invention is the first to find that inhibiting the expression of miR-885-3p or promoting the expression of RGS8 can inhibit aortic diameter expansion, alleviate aortic cell apoptosis, and inhibit vascular smooth muscle cell migration and invasion, indicating that both miR-885-3p and RGS8 can serve as therapeutic targets for thoracic aortic aneurysm, providing a new approach for the treatment of thoracic aortic aneurysm. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Comparison of miR-885-3p expression levels in aortic tissues of TAA patients and healthy controls;

[0030] Among them, Control means healthy control, TAA means aortic tissue; Relative miR-885-3p expression means the relative expression level of miR-885-3p, the same below;

[0031] Figure 2 To compare the expression levels of RGS8 gene in aortic tissues of TAA patients and healthy controls;

[0032] Among them, Relative RGS8 mRNA expression refers to the relative expression level of RGS8 gene mRNA, the same below;

[0033] Figure 3 The dilation of rat aorta under different treatments;

[0034] Among them, sham represents the sham operation group, model represents the model group, and model+IC represents the model+

[0035] miR-885-3p inhibitor control group, model+I represents model+miR-885-3p inhibitor group; the same below;

[0036] Figure 4 Comparison of the expression levels of miR-885-3p in rat aorta tissue under different treatments;

[0037] Figure 5 HE staining results of rat aorta tissue under different treatments;

[0038] Figure 6 The Western blot results of related proteins in rat aorta tissue under different treatments;

[0039] Among them, α-SMA indicates α-smooth muscle actin, SM-MHC indicates smooth muscle myosin heavy chain, MMP-2 indicates matrix metalloproteinase 2, MMP-9 indicates matrix metalloproteinase 9, and GAPDH is an internal reference; the same below;

[0040] Figure 7 Comparison of the expression levels of related proteins in rat aorta tissue under different treatments;

[0041] Among them, Relative protein expression means the relative expression level of protein; the same below;

[0042] Figure 8 The results of observation of rat aorta tissue under different treatments under fluorescence microscope after TUNEL staining;

[0043] Fig. 9 Cell apoptosis in rat aorta tissue under different treatments;

[0044] Among them, TUNEL positive cells (%) means TUNEL positive cells (percentage);

[0045] Fig.10 The Western blot results of RGS8 protein in rat aorta tissue under different treatments;

[0046] Fig.11 Comparison of the expression level of RGS8 protein in rat aorta tissue under different treatments;

[0047] Among them, Relative RGS8 protein expression indicates the relative expression level of RGS8 protein, the same below;

[0048] Fig.12 Comparison of the expression levels of miR-885-3p in rat A10 cells under different treatments;

[0049] Wherein, control represents the normal culture cell group, model represents the cell group co-incubated with 20 ng / ml platelet-derived growth factor BB (PDGF-BB) for 12 hours, model+IC represents the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after transfection with miR-885-3p inhibitor control, and model+I represents the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after transfection with miR-885-3p inhibitor; the same below;

[0050] Fig.13 Comparison of the expression levels of miR-885-3p in human VSMC cells under different treatments;

[0051] Fig.14 Comparison of the viability of rat A10 cells under different treatments;

[0052] Wherein, OD value means OD value, the same below;

[0053] Fig.15 Comparison of the viability of human VSMC cells under different treatments;

[0054] Fig.16 Optical microscope images of migrating cells in human VSMC cells and rat A10 cells under different treatments;

[0055] Fig.17 Optical microscope images of invasive cells in human VSMC cells and rat A10 cells under different treatments;

[0056] Fig.18 Comparison of relative migration rates of rat A10 cells under different treatments;

[0057] Among them, Relative migration rate (%) means relative migration rate (percentage), the same below;

[0058] Fig.19 Comparison of relative migration rates of human VSMC cells under different treatments;

[0059] Fig. 20 Comparison of relative invasion rates of rat A10 cells under different treatments;

[0060] Wherein, Relative invasion rate (%) means relative invasion rate (percentage), the same below;

[0061] Fig.21 Comparison of relative invasion rates of human VSMC cells under different treatments;

[0062] Fig. 22Comparison of the relative expression levels of RGS8 gene in rat A10 cells under different treatments;

[0063] Fig.23 Comparison of the relative expression levels of RGS8 gene in human VSMC cells under different treatments;

[0064] Fig.24 Comparison of the relative expression levels of RGS8 protein in rat A10 cells under different treatments;

[0065] Fig.25 Comparison of the relative expression levels of RGS8 protein in human VSMC cells under different treatments;

[0066] Fig.26 The target prediction results for miR-885-3p;

[0067] Fig. 27 Comparison of relative luciferase activity of rat A10 cells under different treatments;

[0068] Among them, RGS8-WT represents the recombinant vector of the wild-type gene of RGS8, RGS8-MUT represents the recombinant vector of the mutant gene of RGS8, M represents the miR-885-3p mimic, MC represents the mimic control, and Relative luciferase activity represents the relative luciferase activity, the same below;

[0069] Fig.28 Comparison of relative luciferase activity of human VSMC cells under different treatments;

[0070] Fig.29 Comparison of relative expression levels of GS8 gene in rat A10 cells under different treatments;

[0071] Among them, control refers to the normal cultured cell group, siNC refers to the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after being transfected with siNC, and siRGS8 refers to the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after being transfected with siRGS8; the same below;

[0072] Fig.30 Comparison of relative expression levels of GS8 gene in human VSMC cells under different treatments;

[0073] Fig.31 Comparison of the relative expression levels of GS8 protein in rat A10 cells under different treatments;

[0074] Fig.32 Comparison of the relative expression levels of GS8 protein in human VSMC cells under different treatments;

[0075] Fig.33 Comparison of the viability of rat A10 cells under different treatments;

[0076] Among them, siNC+IC represents the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after transfection with siNC and miR-885-3p inhibitor control, siNC+I represents the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after transfection with siNC and miR-885-3p inhibitor, siRGS8+IC represents the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after transfection with siRGS8 and miR-885-3p inhibitor control, siRGS8+I represents the cell group co-incubated with 20 ng / ml PDGF-BB for 12 hours after transfection with siRGS8 and miR-885-3p inhibitor; the same below;

[0077] Fig.34 Comparison of the viability of human VSMC cells under different treatments;

[0078] Fig.35 Optical microscope images of migrating cells in human VSMC cells and rat A10 cells under different treatments;

[0079] Fig.36 Comparison of relative migration rates of rat A10 cells under different treatments;

[0080] Fig.37 Comparison of relative migration rates of human VSMC cells under different treatments;

[0081] Fig.38 Optical microscope images of invasive cells in human VSMC cells and rat A10 cells under different treatments;

[0082] Fig.39 Comparison of relative invasion rates of rat A10 cells under different treatments;

[0083] Fig.40 Comparison of relative invasion rates of human VSMC cells under different treatments;

[0084] Fig.41 The Western blot results of related proteins in rat A10 cells under different treatments;

[0085] Fig.42 Comparison of the expression levels of related proteins in rat A10 cells under different treatments;

[0086] Fig.43 The Western blot results of related proteins in human VSMC cells under different treatments;

[0087] Fig.44 Comparison of the expression levels of related proteins in human VSMC cells under different treatments. DETAILED DESCRIPTION

[0088] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0089] Example 1 Expression of miR-885-3p and RGS8 in TAA patients

[0090] (1) Sample acquisition

[0091] This study included 16 patients (including 8 males and 8 females) with TAA who were hospitalized from March 2018 to March 2019.

[0092] The inclusion criteria were as follows: (1) patients diagnosed with TAA; (2) patients were willing to cooperate with the researchers.

[0093] The exclusion criteria were as follows: (1) patients with other types of critical illness; (2) patients with severe mental disorders; (3) patients with other types of vascular diseases; and (4) patients refusing to cooperate with the researchers.

[0094] At the same time, 8 volunteers with normal physiological conditions were selected as the control group. There was no significant difference in age and gender between patients and controls. This study was approved by the Ethics Committee (2018020079), and all participants signed informed consent. Aortic specimens were collected from TAA patients and healthy controls, and all specimens were stored in liquid nitrogen before use.

[0095] (2) QRT-PCR detection of miR-885-3p and RGS8 expression levels

[0096] First, total RNA was extracted from tissue or cell samples using a miRNA extraction and isolation kit and an RNA extraction kit, and then the concentration of total RNA was quantified using NanoDrop2000 (Thermo Fisher Scientific). Then, the total RNA was reverse transcribed into cDNA using a miRNA cDNA first-strand synthesis kit and a universal reverse transcription kit. Then, qRT-PCR reaction was performed using SYBR Green qPCR Master Mix, and U6 and GAPDH were regarded as standardization controls. The primers used in the qRT-PCR reaction are shown in Table 1.

[0097] Table 1 Primer information required for QRT-PCR reaction

[0098]

[0099] Use 2 -ΔΔCtThe qRT-PCR reaction results were analyzed by Figure 1 and Figure 2 .

[0100] Depend on Figure 1 It can be seen that compared with the healthy control group, the expression of miR-885-3p in the aortic tissue of TAA patients was significantly upregulated (p<0.01).

[0101] Depend on Figure 2 It can be seen that compared with the healthy control group, the expression of RGS8 in the aortic tissue of TAA patients was significantly downregulated (p < 0.001).

[0102] Example 2 Effect of miR-885-3p in TAA rats

[0103] (1) Animal model construction and grouping

[0104] With approval, 40 specific pathogen-free (SPF) male SD rats were purchased from Hangzhou Medical College. The weight and age of the SD rats were 250-300 g and 7-8 weeks, respectively. The animals were housed in an environment with a 12-h day-night cycle, 40-60% humidity, and a temperature of 21-24°C.

[0105] The rats were randomly divided into 4 groups: sham group (sham), model group (model), model + miR-885-3p inhibitor control group (model + IC), and model + miR-885-3p inhibitor group (model + I), with 10 rats in each group.

[0106] Among them, rats in the model group, model+IC group and model+I group were first subjected to TAA model construction: after anesthetizing the rats with sodium pentobarbital (40 mg / kg), tracheotomy was performed on the rats, and the rat trachea was intubated with a cannula connected to a small animal ventilator. The respiratory rate of the ventilator parameters was 100 times / min and the tidal volume was 3 ml; the descending thoracic aorta was completely exposed by thoracotomy in the 5th intercostal area on the left edge of the sternum, and the vascular adventitia was immersed in 0.5 mol / L CaCl2 for 20 minutes; after the blood vessels were obviously changed and expanded, the cotton gauze was removed and the chest cavity was flushed with normal saline; after appropriately adjusting the ventilator to promote the re-expansion of the left lung, the chest drainage tube was retained and the chest cavity was closed layer by layer with 5-0 sutures; after the chest drainage tube was completely emptied and the pleural effusion was extracted, the ventilator was removed; after fully cleaning the respiratory secretions, the trachea and skin were closed with 6-0 polypropylene sutures; after extubation, the rats were put back into the cage, and the rats were fed with feed and water 4 hours after surgery.

[0107] In the sham group, rats were directly placed in saline for 20 minutes.

[0108] 28 days after surgery, rats in the model+IC and model+I groups were intraperitoneally injected with 4 mg / kg of IC-antagomir and I-antagomir, respectively, once a week for two weeks; the sham and model groups did not receive any treatment; after the experiment, the rats were euthanized, and the aortic tissue was removed for subsequent analysis.

[0109] (2) Comparison of aortic dilatation

[0110] The aortic dilation of each group of mice was observed. Figure 3 shown.

[0111] Depend on Figure 3 It can be seen that compared with the sham group, the aorta of the rats in the model group was dilated; compared with the model+IC group, the aorta dilation of the rats in the model+I group was alleviated.

[0112] (3) Comparison of miR-885-3p expression

[0113] QRT-PCR was performed in the same manner as in Example 1, and the primers used are shown in Table 2.

[0114] Table 2 Primer information required for QRT-PCR

[0115]

[0116] Test results such as Figure 4 shown.

[0117] Depend on Figure 4 It can be seen that compared with the sham group, the expression of miR-885-3p in the aorta of rats in the model group was significantly upregulated (p<0.001); compared with the model+IC group, the expression of miR-885-3p in the aorta of rats in the model+I group was significantly downregulated (p<0.001), indicating that the miR-885-3p inhibitor can significantly downregulate the expression level of miR-885-3p in the aorta, thereby inhibiting aortic dilatation.

[0118] (4) HE staining analysis

[0119] The aorta tissue of each group was embedded in paraffin and then cut into 5-micron thick sections; the sections were routinely dewaxed with xylene and hydrated with gradient ethanol, and then stained with hematoxylin solution for 5 minutes; after rinsing the excess staining solution with tap water, the sections were differentiated with differentiation solution for 30 seconds and then rinsed with tap water; the sections were stained with eosin solution for 1 minute, and then routinely dehydrated, transparentized, and sealed; finally, the staining results were observed under an optical microscope (100×), as shown in Figure 5 shown.

[0120] Depend on Figure 5 It can be seen that compared with the sham group, the aorta in the model group gradually expanded; compared with the model+IC group, the aortic dilatation in the model+I group was alleviated.

[0121] (5) Western blot analysis

[0122] Total protein was obtained from aortic tissue or cells by RIPA lysis buffer, and the concentration was determined by BCA protein detection kit; the quantitative protein was denatured and separated by SDS-PAGE; the membrane was electrotransferred to nitrocellulose membrane and blocked in 5% skim milk; the blocked membrane was incubated with primary antibody at 4°C overnight, and then incubated with secondary antibody at 37°C for 1 hour the next day; luminescence imaging was performed on the chemiluminescence detection system using ECL kit, and the results are shown in Figure 6 and Figure 7 .

[0123] Depend on Figure 6 and Figure 7 It can be seen that compared with the sham group, the expressions of α-SMA (α-smooth muscle actin) and SM-MHC (smooth muscle myosin heavy chain) in the model group were significantly upregulated (p<0.05, p<0.001), while the expressions of MMP-2 (matrix metalloproteinase 2) and MMP-9 (matrix metalloproteinase 9) were significantly upregulated (p<0.001); compared with the model+IC group, the expressions of α-SMA and SM-MHC in the model+I group were significantly upregulated (p<0.05, p<0.001), while the expressions of MMP-2 and MMP-9 were significantly downregulated (p<0.001).

[0124] (6) TUNEL detection of cell apoptosis

[0125] The apoptosis of aortic cells in each group was detected using a TUNEL kit (C1088, Bio-Tech). After routine dewaxing and hydration of the slices, the slices were reacted with proteinase K solution for 20 minutes; after washing with PBS three times, the slices were incubated with 3% hydrogen peroxide solution at room temperature for 20 minutes, and then reacted with the prepared TUNEL solution at 37°C in a dark room for 1 hour; after terminating the reaction, the slices were reacted with DAPI solution; after sealing with anti-fluorescence quenching sealing solution, the slices were observed under a fluorescence microscope. The results are shown in Figure 2. Figure 8 The statistical results of cell apoptosis are shown in Fig. 9 shown.

[0126] Depend on Figure 8 and Fig. 9It can be seen that compared with the sham group, the aortic cell apoptosis rate in the model group was significantly increased (p<0.001); compared with the model+IC group, the aortic cell apoptosis rate in the model+I group was significantly decreased (p<0.001).

[0127] (7) Western blot detection of RGS8 protein expression

[0128] The same method as in “(5) Western blot analysis” was used to detect the expression of RGS8 protein in rats in each group. The results are shown in Table 1. Fig.10 and Fig.11 shown.

[0129] Depend on Fig.10 and Fig.11 It can be seen that compared with the sham group, the expression of RGS8 in the model group was significantly downregulated (p<0.001); while compared with the model+IC group, the expression of RGS8 in the model+I group was significantly upregulated (p<0.01).

[0130] Example 3 Effects of MiR-885-3p on the biological behavior of rat or human vascular smooth muscle cells (VSMCs) and the expression of RGS8

[0131] (1) Cell culture and grouping

[0132] Rat VSMCs (A10) and human VSMCs were obtained from ATCC (USA). The two types of cells were inoculated in DMEM complete medium and incubated at 37° C. in a humidified atmosphere of 95% air and 5% CO 2 .

[0133] Both cell lines were divided into 4 groups: control group (normal cell culture), model group (cells were co-incubated with 20 ng / ml platelet-derived growth factor BB (PDGF-BB) for 12 hours), model+IC group (cells were transfected with miR-885-3p inhibitor control and co-incubated with 20 ng / ml PDGF-BB for 12 hours), and model+I group (cells were transfected with miR-885-3p inhibitor and co-incubated with 20 ng / ml PDGF-BB for 12 hours).

[0134] (2) Cell transfection

[0135] MiR-885-3p inhibitor (miR20004948-1-5) and inhibitor control (IC, miR2N0000002-1-5) were purchased from Rebo. A10 and VSMC were transfected with Lipofectamine 2000. After 48 hours, qRT-PCR was performed to evaluate the transfection efficiency. The results are shown in Fig.12 and Fig.13 shown.

[0136] Depend on Fig.12 and Fig.13 It can be seen that compared with the control group, the expression level of miR-885-3p in the model group was significantly upregulated (p < 0.001); compared with the model + IC group, the expression level of miR-885-3p in the model + I group was significantly downregulated (p < 0.001), indicating that the transfection was successful.

[0137] (3) Cell viability test

[0138] A10 and VSMC cells (2×10 4 / well) were inoculated into each well of a 96-well plate, and then placed in a cell culture incubator for 24 hours; each group of cells was treated accordingly as listed in the above "(Cell culture and grouping)"; after culturing for 24 hours and 48 hours, 10 μL of CCK-8 solution was added to each well; after incubation for 3 hours, the absorbance (450 nm) was checked by an enzyme reader to understand the cell viability. The test results are shown in Fig.14 and Fig.15 shown.

[0139] Depend on Fig.14 and Fig.15 It can be seen that compared with the control group, the cell viability of the model group was improved (p < 0.001); compared with the model + IC group, the cell viability of the model + I group was reduced (p < 0.01, p < 0.001).

[0140] (4) Cell migration and invasion ability test

[0141] Cell migration and invasion can be assessed by Transwell assay.

[0142] Specifically, cells were deprived of FBS for 12 hours and then seeded into inserts. For migration experiments, inserts did not need to be coated with matrix gel in advance, while for invasion experiments, inserts needed to be coated with matrix gel in advance. Culture medium containing 10% FBS was added to the corresponding lower chamber to attract cells. Then, the 24-well plate was placed in a cell culture incubator for 48 hours. Non-invaded or migrated cells in the upper chamber were removed with a cotton swab, and cells in the lower chamber were fixed in 4% paraformaldehyde and then stained with 0.1% crystal violet. Finally, images of migrating or invading cells were obtained using an optical microscope (250 times), and the results are shown in Figure 2. Fig.16 and Fig.17 As shown; the migration rate and invasion rate of cells were statistically analyzed, and the results are shown Fig.18 , Fig.19 , Fig. 20 and Fig.21 shown.

[0143] Depend on Fig.18 , Fig.19 , Fig. 20 and Fig.21 It can be seen that compared with the control group, the migration rate and invasion rate of the cells in the model group were increased (p < 0.001), while compared with the model + IC group, the migration rate and invasion rate of the cells in the model + I group were decreased (p < 0.001), indicating that MiR-885-3p promoted the migration and invasion of A10 and VSMC cells, while MiR-885-3p inhibitor inhibited the migration and invasion of A10 and VSMC cells.

[0144] (5) QRT-PCR detection of RGS8 gene expression

[0145] The RGS8 primers and GAPDH listed in Tables 1 and 2 were used to detect the expression of RGS8 gene in A10 cells and VSMC cells, respectively. Fig. 22 and Fig.23 shown.

[0146] Depend on Fig. 22 and Fig.23 It can be seen that, whether it is A10 cells or VSMC cells, compared with the control group, the expression level of RGS8 gene in the model group cells was significantly downregulated (p < 0.001); compared with the model + IC group, the expression level of RGS8 gene in the model + I group cells was significantly upregulated (p < 0.001).

[0147] (6) Western blot detection of RGS8 protein expression

[0148] The expression of RGS8 protein in A10 cells and VSMC cells was detected by the same method as in Example 2. The results are as follows: Fig.24 and Fig.25 shown.

[0149] Depend on Fig.24 and Fig.25 It can be seen that, whether it is A10 cells or VSMC cells, compared with the control group, the expression level of RGS8 protein in the model group cells was significantly downregulated (p < 0.001); compared with the model + IC group, the expression level of RGS8 protein in the model + I group cells was significantly upregulated (p < 0.001).

[0150] Example 4 Screening and verification of target genes of miR-885-3p

[0151] (1) Bioinformatics analysis

[0152] The targets of miR-885-3p were predicted by TargetScan (https: / / www.targetscan.org / vert_72 / ), such as Fig.26 shown.

[0153] (2) Dual fluorescence reporter gene assay

[0154] The predicted wild-type (RGS8-WT) and mutant (RGS8-MUT) binding sites were inserted into the pmirGLO vector to construct RGS8-WT and RGS8-MUT recombinant vectors; the recombinant vectors and miR-885-3p mimics (M, miR10004948-1-5, purchased from Rebo) or mimics control (MC, miR01102-1-1, purchased from Rebo) were co-transfected into cells. After 48 h of transfection, the cells were harvested and the luciferase activity was detected by Dual Luciferase Reporter Assay Kit (Promega); the ratio of firefly to Renilla luciferase activity was then determined, and the results are shown in Figure 2. Fig. 27 and Fig.28 shown.

[0155] Depend on Fig. 27 and Fig.28 It can be seen that the miR-885-3p mimics can inhibit the relative fluorescence activity of the RGS8-WT group (p < 0.001), but do not affect the relative fluorescence activity of the RGS8-MUT group, indicating that miR-885-3p and RGS8 have a targeting relationship.

[0156] Example 5 miR-885-3p affects the biological behavior of rat or human vascular smooth muscle cells (VSMCs) by targeting RGS8

[0157] (1) Cell grouping

[0158] A10 cells and VSMCs cells were divided into 3 groups: control group (normal cell culture), siNC group (cells were transfected with siNC and incubated with 20 ng / ml PDGF-BB for 12 hours), and siRGS8 group (cells were transfected with siRGS8 and incubated with 20 ng / ml PDGF-BB for 12 hours).

[0159] siRGS8 was purchased from Ruibo Company, and the sequences are:

[0160] Human: CTGACCATCCAGTTGGCAAAG (SEQ ID No. 17);

[0161] Rat: GTGCAATGCGGCTCCATATAA (SEQ ID No. 18).

[0162] (2) Cell transfection and transfection efficiency assessment

[0163] A10 and VSMC were transfected with Lipofectamine 2000. After 48 hours, QRT-PCR was performed in the same manner as in "(5) QRT-PCR detection of RGS8 gene expression" in Example 3 to evaluate the transfection efficiency. The results are shown in FIG. Fig.29 and Fig.30 As shown; at the same time, Western blot analysis was performed using the same method as in Example 3 "(6) Western blot detection of RGS8 protein expression" to evaluate the transfection efficiency; the results are shown Fig.31 and Fig.32 shown.

[0164] Depend on Fig.29 and Fig.30 It can be seen that compared with the siNC group, the expression level of RGS8 gene in the siRGS8 group was significantly downregulated (p < 0.001). Fig.31 and Fig.32 It can be seen that compared with the siNC group, the expression level of RGS8 protein in the cells of the siRGS8 group was significantly downregulated (p < 0.001), indicating that the transfection was successful.

[0165] (3) Cell grouping and transfection

[0166] A10 cells and VSMCs cells were divided into 4 groups: siNC+IC group (cells were transfected with siNC and miR-885-3p inhibitor control and then incubated with 20 ng / ml PDGF-BB for 12 h), siNC+I group (cells were transfected with siNC and miR-885-3p inhibitor and then incubated with 20 ng / ml PDGF-BB for 12 h), siRGS8+IC group (cells were transfected with siRGS8 and miR-885-3p inhibitor control and then incubated with 20 ng / ml PDGF-BB for 12 h), and siRGS8+I group (cells were transfected with siRGS8 and miR-885-3p inhibitor and then incubated with 20 ng / ml PDGF-BB for 12 h);

[0167] According to the above grouping, A10 and VSMC were transfected with Lipofectamine 2000, and subsequent experiments were performed 48 hours later.

[0168] (4) Cell viability test

[0169] The cell viability was tested according to the method of Example 3(3). Fig.33 and Fig.34 shown.

[0170] Depend on Fig.33 and Fig.34 It can be seen that, whether it is A10 cells or VSMC cells, compared with siNC+IC, the cell viability of the siNC+I group was significantly decreased (p<0.01), while the cell viability of the siRGS8+IC group was increased (p<0.05, p<0.01); compared with the siNC+I group, the cell viability of the siRGS8+I group was significantly increased (p<0.01); compared with the siRGS8+IC group, the cell viability of the siRGS8+I group was significantly decreased (p<0.05).

[0171] (6) Cell migration and invasion ability test

[0172] The migration and invasion abilities of cells were tested according to the method of Example 3(4). Fig.35 , Fig.36 , Fig.37 , Fig.38 , Fig.39 and Fig.40 shown.

[0173] Depend on Figures 35 to 40It can be seen that, whether it is A10 cells or VSMC cells, compared with siNC+IC, the cell migration rate and invasion rate of the siNC+I group were significantly decreased (p<0.001), while the cell migration rate and invasion rate of the siRGS8+IC group were significantly increased (p<0.01); compared with the siNC+I group, the cell migration rate and invasion rate of the siRGS8+I group were significantly increased (p<0.001); compared with the siRGS8+IC group, the cell migration rate and invasion rate of the siRGS8+I group were significantly decreased (p<0.01); indicating that the MiR-885-3p inhibitor inhibited the migration and invasion of A10 and VSMC cells, while siRGS8 promoted the migration and invasion of A10 and VSMC cells.

[0174] (7) Western blot detection of related protein expression

[0175] Western blot was performed in the same manner as in Example 2 “(5) Western blot analysis” to detect the expression of α-SMA, SM-MHC, MMP-2 and MMP-9 proteins in each group of cells. The test results are shown in Fig.41 , Fig.42 , Fig.43 and Fig.44 .

[0176] Depend on Figure 41 to Figure 44 It can be seen that compared with siNC+IC, the expression of α-SMA and SM-MHC in siNC+I group was significantly upregulated, and the expression of MMP-2 and MMP-9 was significantly upregulated, while the expression of α-SMA and SM-MHC in siRGS8+IC group was significantly downregulated, and the expression of MMP-2 and MMP-9 was significantly upregulated; compared with siNC+I group, the expression of α-SMA and SM-MHC in siRGS8+I group was significantly downregulated, and the expression of MMP-2 and MMP-9 was significantly upregulated; compared with siRGS8+IC group, the expression of α-SMA and SM-MHC in siRGS8+I group was significantly upregulated, and the expression of MMP-2 and MMP-9 was significantly downregulated.

Claims

1. Application of reagents for detecting miR-885-3p expression levels in the preparation of thoracic aortic aneurysm diagnostic kits.

Images