A ZIF-8-CeO 2 -miR200c nanozyme

Abstract

The present invention discloses a ZIF-8-CeO2-miR200c nanozyme and a preparation method and application thereof. The present invention proposes for the first time that miR200c can reduce radiosensitivity and can prepare products for preventing and treating RISI, and provides a preparation method of a nanozyme containing miR200c: first prepare CeO2 nanoparticles, then add miR200c, 2-methylimidazole solution and zinc nitrate solution in sequence, and obtain a complex by sequential self-assembly; then encapsulate the above complex with C18PMH-PEG to synthesize ZIF-8-CeO2-miR200c. The ZIF-8-CeO2-miR200c nanozyme prepared by the present invention can promote the proliferation, migration, angiogenesis and anti-apoptosis ability of HaCaT and HUVEC cells, thereby exerting synergistic anti-radiation ability in vivo and in vitro. Provide an important reference for the biomaterial treatment of RISI.

Description

Technical Field

[0001] The present invention relates to the technical field of RISI prevention and treatment, and in particular to a ZIF-8-CeO2-miR200c nanozyme and a preparation method and application thereof. Background Art

[0002] Radiation-induced skin injury (RISI) is a common complication of nuclear radiation and clinical radiotherapy. There is currently no specific treatment in clinical practice. However, skin radiation reaction is a common side effect that limits the dose and therapeutic effect of radiotherapy. Among cancer patients receiving radiotherapy, up to 95% will experience skin reactions, and nearly 10% will experience severe skin damage. At present, the exact mechanism of RISI is still unclear, and there is a lack of standardized methods for effective prevention and treatment.

[0003] CeO2NPs nanoparticles are relatively stable and have good biocompatibility, low toxicity, low cost and environmental friendliness. Ce has two main oxidation states, including tetravalent (Ce 4+ ) and trivalent (Ce 3+ ), CeO2NPs have a cubic fluorite structure and Ce 3+ and Ce 4+ . The main advantage of cerium dioxide (CeO2) is the creation of oxygen (O) vacancies in the structure. Therefore, it is helpful in the treatment of various oxidative stress-related diseases. As a metal-organic framework, ZIF-8 consists of zinc ions linked to N atoms in 2-methylimidazole. ZIF-8 nanoparticles are multifunctional nanocarriers that modulate functional nucleic acids such as DNA zyme through electrostatic and ligand interactions. ZIF-8 nanoparticles can achieve tumor-targeted accumulation of nucleic acid payloads through enhanced permeability and retention effects and promote cellular uptake of nucleic acids without degradation. In acidic TME, ZIF-8 can effectively inhibit the oxidative stress of the tumor by eliminating Zn 2+ The coordination interaction with imidazole promotes the controlled release of nucleic acids. In addition, it is an attractive gene carrier due to its excellent biodegradability and low cytotoxicity. However, there are no reports on the use of miR200c for RISI repair or prevention. Therefore, how to prepare RISI efficient repair materials with ZIF-8 as a carrier is a problem that needs to be solved. Summary of the invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide a ZIF-8-CeO2-miR200c nanozyme and its preparation method and application. The ZIF-8-CeO2-miR200c nanozyme prepared by the present invention can promote the proliferation, migration, angiogenesis and anti-apoptosis ability of HaCaT and HUVEC cells, thereby exerting synergistic anti-radiation ability in vivo and in vitro. It provides an important reference for RISI biomaterial treatment.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the use of miR200c in the preparation of products for preventing and treating RISI.

[0007] In a second aspect of the present invention, a ZIF-8-CeO2-miR200c nanozyme is provided, which is prepared by the following method:

[0008] (1) dispersing CeO2 nanoparticles in deionized water to obtain CeO2 dispersion, dissolving miR200c in deionized water to obtain miR200c solution, adding the miR200c solution to the CeO2 dispersion and stirring; then adding 2-methylimidazole solution, continuing to stir, and then adding zinc nitrate solution to react, and after the reaction is completed, centrifuging and washing the precipitate;

[0009] (2) Dissolve C18PMH-PEG in ultrapure water, add the precipitate obtained in step (1), ultrasonically treat in an ice bath, and obtain ZIF-8-CeO2-miR200c nanozyme after centrifugation.

[0010] Preferably, in step (1), the concentration of the CeO2 dispersion is 10 mg / ml; and the concentration of the miR200c solution is 20 OD / mL.

[0011] Preferably, in step (1), the concentration of the 2-methylimidazole solution is 20 mg / ml; the concentration of the zinc nitrate solution is 100 mg / ml.

[0012] Preferably, in step (1), the volume ratio of the CeO2 dispersion, the miR200c solution, the 2-methylimidazole solution and the zinc nitrate solution is 1:1:1:2.

[0013] Preferably, in step (1), the reaction time is 30 min.

[0014] Preferably, in step (1), the preparation method of the CeO2 nanoparticles is: mixing a cerium nitrate solution and polyallylamine hydrochloride at room temperature, and obtaining CeO2NPs after centrifugal washing.

[0015] The concentration of the cerium nitrate solution was 3.5 mg / mL, and the concentration of the polyallylamine hydrochloride was 37.4 mg / mL.

[0016] miR200c was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0017] Positive chain: AACAUUCAACGCUGUCGGUGAGU (as shown in SEQ ID NO.1); reverse chain: UCACCGACAGCGUUGAAUGUUU (as shown in SEQ ID NO.2).

[0018] Note: According to the WIPO ST.26 standard, "T" represents uracil in RNA sequences and thymine in DNA sequences. The "T" in sequence 1 and sequence 2 in the sequence table of the present invention represents uracil U.

[0019] Preferably, in step (2), the ratio of the added amounts of C18PMH-PEG, ultrapure water and precipitate is 100 mg:5 mL:10 mg.

[0020] Preferably, in step (2), the ultrasonic time is 90 min, the power is 1000 W; and the centrifugation is 21000 g for 3 h.

[0021] The third aspect of the present invention provides the use of ZIF-8-CeO2-miR200c nanozyme in at least one of the following 1) to 2):

[0022] 1) Preparation of drugs for the prevention and treatment of RISI;

[0023] 2) Prepare RISI wound repair products.

[0024] Beneficial effects of the present invention:

[0025] (1) The present invention uses zeolite imidazolate framework material as a carrier to synthesize ZIF-8-CeO2-miR200c nanozyme by sequential self-assembly, and then encapsulates the above complex with C18PMH-PEG to synthesize ZIF-8-CeO2-miR200c to improve its dispersibility and stability and protect miRNA from RNase degradation.

[0026] (2) The ZIF-8-CeO2-miR200c nanozyme prepared by the present invention can promote the proliferation, migration, angiogenesis and anti-apoptosis of HaCaT and HUVEC cells, thereby exerting synergistic anti-radiation ability in vivo and in vitro, providing an important reference for RISI biomaterial therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1: Material characterization, (A) SEM image of ZIF-8-CeO2-miR200c, (B) FT-IR of ZIF-8-CeO2-miR200c;

[0028] Figure 2 :Particle size and potential analysis of ZIF-8-CeO2-miR200c; (A) Zeta point distribution map of ZIF-8-CeO2-miR200c, (B) Zeta point distribution map and specific information of ZIF-8-CeO2-miR200c, (C) Particle size of ZIF-8-CeO2-miR200c, (D) Particle size and specific information of ZIF-8-CeO2-miR200c;

[0029] Figure 3 : Biocompatibility and antibacterial activity of ZIF-8-CeO2-miR200c, (A) FITC / DAPI images of ZIF-8-CeO2-miR200c co-cultured with HaCaT cells, (B) CCK-8 assay of ZIF-8-CeO2-miR200c co-cultured with HaCaT cells, (C) antibacterial activity against G+ (MRSA) and G- (Escherichia coli), (D) bacterial counts in C *p<0.05;

[0030] Figure 4 :In vitro cytological study of ZIF-8-CeO2-miR200c, (A) In vitro tube formation assay, (B) The number of blood vessels in A, (C) The effect of the material on the migration of HaCaT cells, (D) The percentage of cell migration in C, *p<0.05;

[0031] Figure 5 : ZIF-8-CeO2-miR200c in RISI mouse model: A) Wound images on day 1 and day 14, (B) wound area on day 14, (C) overall recovery time. DETAILED DESCRIPTION

[0032] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0033] As introduced in the background technology section, traditional drug delivery systems can produce some local side effects such as burning, skin irritation, greasiness, stinging, itchy rash, erythema and tenderness, thus limiting their application. Liposomes, NPs and hydrogels all require special storage conditions, and phospholipids are more unstable in liposome preparation due to redox reactions. Therefore, a safe and efficient RISI repair material is needed.

[0034] Based on this, the purpose of the present invention is to provide a ZIF-8-CeO2-miR200c nanozyme and its preparation method and application. The present invention fixes CeO2 nanozyme on the surface of ZIF-8 to obtain good catalase activity and prevent its aggregation. ZIF-8-CeO2 exhibits significant anti-ROS ability in physiological pH or weakly acidic wound microenvironment. In addition, both ZIF-8 and miR200c are negatively charged, so the presence of positively charged CeO2 reduces their electrostatic repulsion. MiR200c is loaded by ZIF-8-CeO2 because miR200c can reduce DNA damage-induced apoptosis by directly targeting RAD17 and regulating the CHK2 pathway. The above complex is then encapsulated with C18PMH-PEG to synthesize ZIF-8-CeO2-miR200c to improve its dispersibility and stability and protect miRNA from degradation.

[0035] The nanocarrier of the ZIF-8 core-shell structure in the present invention is suitable for penetrating the wound surface for drug delivery, and the miR200c thus produced is embedded in the nanotransfer body to promote its effective penetration and delivery into the stratum corneum wound surface. This effectively improves the previous problems of miR200c, including poor systemic absorption, low bioavailability, and high systemic clearance after oral administration. The experimental results show that ZIF-8-CeO2-miR200c has good free radical scavenging ability, no obvious cytotoxicity, effectively promotes cell migration, vascularization, anti-apoptosis, and reduces intracellular ROS, indicating that the material can be effectively used to protect RISI.

[0036] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0037] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels.

[0038] Note: C18PMH-PEG was purchased from Zhengzhou Feinman Biotechnology Co., Ltd., and can also be prepared by referring to the preparation method of a C18-PMH-PEG complex disclosed in patent CN110408041B;

[0039] miR200c was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd., unit: 20OD. Example

[0040] (1) Synthesis of CeO2NP

[0041] Ce nitrate solution (3.5 mg / mL) and polyallylamine hydrochloride solution (37.4 mg / mL) were mixed in a volume ratio of 9:1 at room temperature for reaction, and the solid after centrifugation was washed with double distilled water to obtain CeO2NP.

[0042] (2) Synthesis of ZIF-8-CeO2-miR200c

[0043] The CeO2NP obtained in step (1) was dispersed in deionized water to obtain a 10 mg / ml CeO2 dispersion. 20 OD of miR200c was dissolved in 1 mL of water to obtain a miR200c solution. The miR200c solution was added to the CeO2 dispersion and stirred for 3 hours. Then 20 mg / ml of 2-methylimidazole solution was added, stirred for 30 minutes, and then 100 mg / ml of zinc nitrate solution was added. The volume ratio of CeO2 dispersion, miR200c solution, 2-methylimidazole solution and zinc nitrate solution was 1:1:1:2. After reacting for 30 minutes, centrifuge and wash the precipitate, disperse the precipitate in water, and store in the dark at 4°C. 10 mg of the precipitate and 100 mg of C18PMH-PEG were added to 5 mL of ultrapure water. After ultrasonic treatment in an ice bath for 90 min, the unstable nanocomposite was removed by centrifugation at 21,000 × g for 3 h to obtain the ZIF-8-CeO2-miR200c nanozyme.

[0044] Transmission electron microscopy was used to observe the morphology of ZIF-8-CeO2-miR129. Dynamic light scattering was used to assess particle size and potential. Fourier transform infrared spectra were recorded using a Nicolet 6700 FTIR spectrometer (4000–600 cm). Energy dispersive spectroscopy (EDS) / X-ray photoelectron spectroscopy (XPS) was used to analyze the elemental composition of the materials. Figure 1 A shows the TEM imaging features of ZIF-8-CeO2-miR200c after encapsulation with ZIF-8 shell. Fourier transform infrared (FT-IR) spectroscopy shows that the typical absorption peaks of CeO2, ZIF-8 and miRNA are displayed in ZIF-8-CeO2-miR200c particles ( Figure 1 B). The average particle size of ZIF-8-CeO2 is 1294nm and the zeta potential is 34.6mV ( Figure 2 ), these characterizations all indicate that the material has been successfully synthesized.

[0045] Compared with unencapsulated CeO2NPs, ZIF-8 can maintain colloidal stability. TEM and SEM images show that the surface of ZIF-8 is clean and smooth, and although discrete black spots can be clearly seen on the surface of ZIF-8 in the presence of CeO2, high-resolution TEM also shows that drug-loaded ZIF-8 successfully fixes CeO2 nanoparticles to the surface of drug carriers.

[0046] Comparative Example 1

[0047] (1) Synthesis of CeO2NP

[0048] Ce nitrate solution (3.5 mg / mL) and polyallylamine hydrochloride solution (37.4 mg / mL) were mixed in a volume ratio of 9:1 at room temperature for reaction, and the solid after centrifugation was washed with double distilled water to obtain CeO2NP.

[0049] (2) Synthesis of ZIF-8-CeO2

[0050] The CeO2NP obtained in step (1) was dispersed in deionized water to obtain a 10 mg / ml CeO2 dispersion. A 20 mg / ml 2-methylimidazole solution was added, stirred for 30 minutes, and then a 100 mg / ml zinc nitrate solution was added; the volume ratio of the CeO2 dispersion, the 2-methylimidazole solution and the zinc nitrate solution was 1:1:2. After reacting for 30 minutes, the precipitate was centrifuged and washed, and the precipitate was dispersed in water and stored in the dark at 4°C. 10 mg of the precipitate and 100 mg of C18PMH-PEG were added to 5 mL of ultrapure water. After ultrasonic treatment in an ice bath for 90 minutes, the ZIF-8-CeO2 was obtained by centrifugation at 21000×g for 3 hours to remove unstable nanocomposites.

[0051] Comparative Example 2

[0052] Synthesis of ZIF-8miR200c

[0053] 20OD of miR200c was dissolved in 1mL of water to obtain miR200c solution; 20mg / ml of 2-methylimidazole solution was added, stirred for 30 minutes, and then 100mg / ml of zinc nitrate solution was added; the volume ratio of miR200c solution, 2-methylimidazole solution and zinc nitrate solution was 1:1:2. After 30 minutes of reaction, centrifugation and washing of the precipitate were performed, and the precipitate was dispersed in water and stored in the dark at 4°C. 10 mg of precipitate and 100mg of C18PMH-PEG were added to 5mL of ultrapure water. After ultrasonic treatment in an ice bath for 90 minutes, centrifugation at 21000×g for 3 hours was performed to remove unstable nanocomposites to obtain ZIF-8-miR200c.

[0054] Test Example 1: In vitro cytological test

[0055] 1. Experimental process

[0056] Biocompatibility evaluation and cell morphology observation: The cytological experiment was divided into 5 groups, group A was a normal cell group, group B was a normal cell + 5 Gy irradiation group, group C was a normal cell + 5 Gy irradiation + ZIF-8-CeO2-miR200c group, group D was a normal cell + 5 Gy irradiation + ZIF8-miR200c group, and group E was a normal cell + 5 Gy irradiation + ZIF8-CeO2 group. CCK-8 assay was used to evaluate cytotoxicity. HaCat cells were cultured at 2×10 3 Cells were seeded at a density of 10 cells / well into groups AC at 37°C in DMEM supplemented with 5% fetal bovine serum and 1% penicillin / streptomycin.

[0057] After 1, 4, and 7 days of incubation, cell viability was quantified using the CCK-8 assay. To investigate the effects of cytoskeletal morphology, HaCat cells were seeded on AE group media for 24 h, and then the cells were washed three times. They were washed with prewarmed phosphate-buffered saline and fixed with prewarmed 4% paraformaldehyde at room temperature. The fixed cells were rinsed and soaked with phosphate buffer. The cells were then incubated with phalloidin at 37 °C without light and DAPI (2-(4-amidinophenyl)-6-indolecarboxamidine dihydrochloride) for 30 min and 5 min. Fluorescence images of stained cells were obtained using a confocal laser scanning microscope (780, Zeiss, Germany). HaCat cells were then stained with DAPI and phalloidin for fluorescence observation.

[0058] Scratch migration: HaCaT cells were grown to confluence in complete medium and seeded in 24-well plates (2 × 10 4 / well). The monolayer (0h) was crossed with a pipette, tip and Zeiss video microscope for examination at 24h. Individual experiments were repeated five times per group and specific measurements were performed using ImageJ 1.48v software (NIH, USA). The assay was repeated three times.

[0059] In vitro tube formation test: Mix 2×10 4 HaCaT cells were seeded on Matrigel-coated 96-well plates and then added to the AE group. After 24 h of stimulation, the newly formed tubes were photographed using an inverted phase microscope (Olympus, USA). Each group was repeated five times.

[0060] Bacterial co-culture: MRSA (methicillin-resistant Staphylococcus aureus) and Escherichia coli (E. coli) were purchased from the Army Medical University. The bacteria were amplified (overnight growth) to 1 × 10 9 Colony forming units (CFU) / mL, and then diluted to 1×10 4 The same amount of bacterial liquid was inoculated into the coated plate, and after incubation at 37°C for 24 hours, the change in bacterial count was measured.

[0061] Statistical analysis: All tables and statistical data were drawn using GraphPad Prism 9.0 software. Each experiment was repeated three times, and all data are expressed as mean ± standard error. The two groups were compared using Student's t test, and differences were considered statistically significant when P < 0.05.

[0062] 2. Test results

[0063] Biocompatibility and antibacterial activity of ZIF-8-CeO2-miR200c: Hacat cells were co-cultured with ZIF-8-CeO2-miR200c for 7 days, and subsequent FITC / DAPI staining showed that the cell morphology was not significantly different from that of the normal group, and the nucleus and cytoplasm were intact ( Figure 3 A). CCK-8 assay showed that on day 3, after irradiation with 3 Gy, the OD of HaCaT cells in groups B and C decreased, indicating that radiation significantly inhibited cell growth ( Figure 3 B). On day 6, the OD of group C recovered significantly and was significantly higher than that of group B (p < 0.05), indicating that ZIF-8-CeO2-miR200c may not affect the growth of irradiated cells in the short term, while the growth curve of irradiated cells returned to normal in the long term (>6 d). Figure 3 As shown in C, methicillin-resistant Staphylococcus aureus (MRSA, Gram-positive, G+) and Escherichia coli (G-) grew well in the control group, but ZIF-8-CeO2-miR200c effectively inhibited bacterial growth ( Figure 3 C and 3D), the antibacterial effect was ZIF-8-CeO2-miR200c group > ZIF8-CeO2 group > ZIF8-miR200c group.

[0064] In vitro cellular studies of ZIF-8-CeO2-miR200c: Effects of ZIF-8-CeO2-miR129 on HUVEC tube formation Figure 4 A and 4B. After irradiation with 3 Gy, angiogenesis in group B was significantly limited, and the angiogenesis effect of ZIF-8-CeO2-miR200c in group C was the best (p<0.05), and the angiogenesis effect was ZIF-8-CeO2-miR200c group > ZIF8-miR200c group > ZIF8-CeO2 group.

[0065] HaCaT cells were co-cultured with each group of materials for about 24 hours, and then the cell scratch test was performed ( Figure 4C and 4D). The migration rate of group B was significantly decreased at 24 h (p < 0.05), which may be related to the effect of radiation on cell migration, but the migration inhibition effect of ZIF-8-CeO2-miR200c was significantly decreased in group C, indicating that the substance increased the migration rate of irradiated cells (p < 0.05), and the cell migration effect was ZIF-8-CeO2-miR200c group > ZIF8-miR200c group > ZIF8- CeO2 group.

[0066] Test Example 2: In vivo cytological test

[0067] RISI mouse model: About 0.2 ml of pentobarbital was injected intraperitoneally to anesthetize each mouse. Then a linear accelerator emitting 6 Mev electron rays was used (irradiation field 1 cm × 1 cm; one irradiation; 30 Gy; 10 min; dose 300 cGy / min). In this case, the source skin was kept at a distance of 1 meter, and the lead plate was used to shield the remaining skin. After irradiation of each group, the irradiation area was still coated with 48-hour intervals, with a total duration of 7-14 days, and divided into five groups, each containing five mice. The five groups were AE groups, namely Group A (healthy mice), Group B (mice + 30 Gy irradiation), Group C (mice + 30 Gy irradiation + ZIF-8-CeO2-miR200c), Group D (mice + 30 Gy irradiation + ZIF-8-miR200c) and Group E (mice + 30 Gy irradiation + ZIF-8-CeO2).

[0068] To determine recovery activity, the wound area before / after recovery was measured using the IPP6.0® as follows:

[0069] Wound recovery status = (initial wound area - wound area after fixed recovery time) / initial wound area × 100%.

[0070] The RISI score is then calculated using the Douglas and Fowler method.

[0071] Hematoxylin-eosin (HE) staining and histology-based analysis: Wound samples from each mouse were collected 14 days after wounding to prepare paraffin sections, which were then stained with HE before obtaining high-quality images for dataset results.

[0072] like Figure 5 As shown in A, all mice were shaved, photographed, and treated on the first day. On the 14th day, the mice were photographed again, and local skin tissues were finally collected for HE staining. Compared with group B, wound recovery in groups C, D, and E was enhanced (p<0.05); compared with groups D and E, group C was significantly improved (p<0.05, Figure 5B and 5C); the wound recovery of group D was better than that of group E, indicating that miR200c has the function of repairing RISI. The results showed that ZIF-8-CeO2-miR200c enhanced the migration and proliferation activity of epidermal cells to induce wound recovery.

[0073] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of ZIF-8-CeO2-miR200c nanozyme in the preparation of radiation skin injury wound repair products, characterized in that: The ZIF-8-CeO2-miR200c nanozyme was prepared by the following method: (1) dispersing CeO2 nanoparticles in deionized water to obtain CeO2 dispersion, dissolving miR200c in deionized water to obtain miR200c solution, adding the miR200c solution to the CeO2 dispersion and stirring; then adding 2-methylimidazole solution, continuing to stir, and then adding zinc nitrate solution to react, and after the reaction is completed, centrifuging and washing the precipitate; (2) Dissolve C18PMH-PEG in ultrapure water, add the precipitate obtained in step (1), ultrasonically treat in an ice bath, and obtain ZIF-8-CeO2-miR200c nanozyme after centrifugation.

2. The use according to claim 1, characterized in that: In step (1), the concentration of the CeO2 dispersion is 10 mg / ml; the concentration of the miR200c solution is 20 OD / mL.

3. The use according to claim 1, characterized in that: In step (1), the concentration of the 2-methylimidazole solution is 20 mg / ml; the concentration of the zinc nitrate solution is 100 mg / ml.

4. The use according to claim 1, characterized in that: In step (1), the volume ratio of the CeO2 dispersion, the miR200c solution, the 2-methylimidazole solution and the zinc nitrate solution is 1:1:1:

2.

5. The use according to claim 1, characterized in that: In step (1), the reaction time is 30 min.

6. The use according to claim 1, characterized in that: In step (1), the preparation method of the CeO2 nanoparticles is: at room temperature, cerium nitrate solution and polyallylamine hydrochloride are mixed, and the mixture is centrifuged and washed to obtain CeO2NPs.

7. The use according to claim 1, characterized in that: In step (2), the ratio of the added amounts of C18PMH-PEG, ultrapure water and precipitate is 100 mg:5 mL:10 mg.

8. The use according to claim 1, characterized in that: In step (2), the ultrasonic time is 90 minutes and the power is 1000w; the centrifugation is 21000g for 3 hours.

Images