Use of a reagent overexpressing the INTS10 gene in the treatment and / or prevention of liver cancer

By overexpressing the INTS10 gene reagent, it inhibits the growth and migration of liver cancer cells and promotes apoptosis of liver cancer cells, solves the problems of hepatocellular carcinoma treatment and prevention, and provides new biomarkers and treatment methods.

CN116271043BActive Publication Date: 2025-06-13ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310122561.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-16
Publication Date
2025-06-13
Estimated Expiration
2043-02-16

AI Technical Summary

Technical Problem

Patients with hepatocellular carcinoma (HCC) have low survival rates, limitations in existing diagnostic and therapeutic approaches, and lack of effective biomarkers and treatments.

Method used

By overexpressing the INTS10 gene reagent, the growth and migration of liver cancer cells are inhibited, the apoptosis of liver cancer cells is promoted, and the expression of cell cycle-related genes is regulated.

Benefits of technology

It is preliminarily confirmed that INTS10 plays a tumor-suppressing role in liver cancer cells, inhibiting the growth and migration of liver cancer cells by inhibiting cell cycle-related pathways, and promoting apoptosis, providing new possibilities for the treatment and prevention of liver cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116271043B_ABST
    Figure CN116271043B_ABST
Patent Text Reader

Abstract

The present invention provides the application of a reagent for overexpressing the INTS10 gene in the treatment and / or prevention of liver cancer, belonging to the technical field of genetic engineering. The reagent is used for overexpressing or activating INTS10, and the drug is used for at least one of the following: promoting cell cycle arrest and apoptosis; inhibiting cell growth; inhibiting cell migration; promoting the expression of P21; inhibiting the expression of CDC25A or CDK4. The reagent for overexpressing or activating INTS10 has significant effects in promoting cell cycle arrest and apoptosis; inhibiting cell growth; inhibiting cell migration; promoting the expression of P21; inhibiting the expression of CDC25A or CDK4.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly to the application of a reagent for overexpressing the INTS10 gene in the treatment and / or prevention of liver cancer. Background Art

[0002] Hepatocellular Carcinoma (HCC) is the sixth most common malignant tumor in the world and one of the main causes of cancer-related deaths globally, with its incidence increasing in recent decades. Although the development of surgical techniques has improved the prognosis of HCC patients, due to the high mortality rate, the overall survival rate of HCC patients remains at a very low level, causing more than 700,000 deaths worldwide every year. The survival rate in China in the past five years is also less than 12.5%. Current research shows that the most common risk factors for HCC are hepatitis B virus (HBV) and hepatitis C virus (HCV). At the same time, alcoholic liver disease (ALD), obesity, and non-alcoholic fatty liver disease (NAFLD) are also important risk factors for HCC, and the incidence of these etiologies is on the rise. Clinically, although computer tomography (CT) and magnetic resonance imaging (MRI) techniques can greatly improve the diagnostic performance of HCC and enable timely treatment, due to their high cost, they cannot be widely screened. Moreover, HCC also has the characteristics of insidious onset, high invasiveness, and metastatic ability, which can lead to patients losing many treatment opportunities. Therefore, exploring genes related to liver cancer and understanding their molecular mechanisms in the occurrence and development of liver cancer helps to find reliable biomarkers and provide more effective treatments for HCC patients.

[0003] The Integrator Complex is a multi-subunit complex composed of at least 14 evolutionarily conserved subunits (Integrator Complex Subunits, INTS1 - INTS14), which binds to phosphorylated RNA polymerase II (RNAPII). Initially described as a complex acting on the 3' end of U-rich small nuclear RNA (snRNA), its function has now been extended to the regulation of RNAPII transcription at the whole-genome level. In the context of mRNA-encoding gene transcription, Integrator has been shown to play an important role in the transition of RNAPII from promoter-proximal pausing to productive elongation and termination. Integrator physically interacts with the negative elongation factor NELF, which promotes RNAPII pausing, and its interacting factor DSIF. DSIF helps to pause in the presence of NELF and acts as a positive elongation factor after NELF is released from the polymerase. In addition, Integrator also interacts with P-TEFb, an RNAPII CTD kinase responsible for ser-2 phosphorylation, which accompanies the transition from pausing to transcriptional elongation, and interacts with the super elongation complex (SEC). P-TEFb can also phosphorylate NELF, triggering its release from the transcription complex and restarting transcription. Meanwhile, in the absence of Integrator, the transcriptional response to stimuli is inhibited, and RNAPII cannot transition from the paused state to productive elongation. INTS10 is a member of the Integrator Complex family. In the human chromosome, the coding gene of INTS10 is located at 8p21.3. According to the previous RNA-SeqAtlas database, INTS10 is expressed in a wide range of tissue types including liver tissue. However, the role of INTS10 in the occurrence and development of liver cancer has not been reported. Summary of the Invention

[0004] To solve the above problems, the present invention provides the application of a reagent overexpressing the INTS10 gene in the treatment and / or prevention of liver cancer. The INTS10 gene can function as a tumor suppressor gene in liver cancer cells.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The application of a reagent overexpressing the INTS10 gene in the treatment and / or prevention of liver cancer.

[0007] The present invention also provides the application of a reagent overexpressing the INTS10 gene in inhibiting the growth and / or migration of liver cancer cells.

[0008] The present invention also provides the application of a reagent overexpressing the INTS10 gene in promoting the apoptosis of liver cancer cells.

[0009] The present invention also provides the use of a reagent overexpressing the INTS10 gene in promoting the expression of P21 and inhibiting the expression of CDC25A or CDK4.

[0010] Preferably, the liver cancer cells are HepG2 cells and / or HCC97H cells.

[0011] The present invention also provides the use of INTS10 protein in the preparation of drugs for treating and / or preventing liver cancer.

[0012] The present invention also provides the use of INTS10 protein in the preparation of drugs for inhibiting the growth and / or migration of liver cancer cells.

[0013] The present invention also provides the use of INTS10 protein in the preparation of drugs for promoting the apoptosis of liver cancer cells.

[0014] The present invention also provides the use of INTS10 protein in the preparation of drugs for promoting the expression of P21 and inhibiting the expression of CDC25A or CDK4.

[0015] Preferably, the liver cancer cells are HepG2 cells and / or HCC97H cells.

[0016] Beneficial effects:

[0017] The present invention explores the function and mechanism of INTS10 in liver cancer cells, and preliminarily suggests that it may play the role of a tumor suppressor gene by inhibiting the cell cycle-related pathway. In the future, the detailed function and molecular mechanism of INTS10 in the occurrence and development of liver cancer will be further studied to provide a basis for the clinical diagnosis and treatment of liver cancer. Description of the drawings

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments.

[0019] Figure 1 Expression of INTS10 in tumor tissues and normal tissues. (A) Analysis of the expression of INTS10 mRNA in 31 tumor tissues and adjacent non-tumor tissues by TCGA on the GEPIA platform; (B) Analysis of the expression of INTS10 in liver cancer tissues (n = 369) and normal tissues (n = 160) using the GEPIA database; (C) Representative immunohistochemical images of INTS10 in liver cancer and normal liver tissues (Human Protein Atlas Database); *P<0.05;

[0020] Figure 2To construct cell lines with stable overexpression or knockdown of the INTS10 gene expression, (A, B) the mRNA level and protein level of INTS10 in HepG2 and HCC97H cells were detected by qRT-PCR and Western blot respectively to identify the overexpression or knockdown effect of INTS10.

[0021] Figure 3 To investigate the effect of INTS10 on the growth and proliferation of hepatocellular carcinoma cells, (C, D) the CCK-8 assay was used to evaluate the growth ability of HepG2 and HCC97H cells after overexpression (C) or knockdown (D) of INTS10. (E, F) The colony formation assay of HepG2 and HCC97H cells was used to evaluate the cell growth ability after overexpression (E) or knockdown (F) of INTS10. (G, H) After overexpression (G) or knockdown (H) of INTS10 in HepG2 and HCC97H cells, the Brdu method was used to evaluate cell proliferation. Data are presented as the mean ± SEM (standard error of the mean) of three independent experiments and analyzed using a two-tailed Student t-test; ns P>0.05, *P<0.05, **P<0.1, ***P<0.001;

[0022] Figure 4 To investigate the effect of INTS10 on the migration ability of hepatocellular carcinoma cells, (A, B) the Transwell assay was used to detect the effect of overexpression (A) or knockdown (B) of INTS10 on the migration ability of HCC cells; Data are presented as the mean ± standard error of the mean (SEM) of three independent experiments and analyzed using a two-tailed Student t-test; **P<0.01;

[0023] Figure 5 To investigate the effect of INTS10 on the cell cycle progression of HCC cells, (A, B) in HepG2 and HCC97H cells, flow cytometry was used to evaluate the cell cycle after overexpression (A) or knockdown (B) of INTS10; Data are presented as the mean ± SEM (standard error of the mean) of three independent experiments and analyzed using a two-tailed Student t-test; ns P>0.05, *P<0.05, **P<0.01;

[0024] Figure 6 To investigate the effect of INTS10 on the apoptosis of HCC cells, (A, B) flow cytometry was used to evaluate the apoptosis ability of HepG2 and HCC97H cells after overexpression of INTS10 (A) or downregulation of INTS10 (B); Data are presented as the mean ± SEM (standard error of the mean) of three independent experiments and analyzed using a two-tailed Student t-test; ns P>0.05, *P<0.05, **P<0.01, ***P<0.001;

[0025] Figure 7 To regulate HCC-related signaling pathways by INTS10, (A) The volcano plot shows differentially expressed genes (log2[fold-change] > 0.3, p < 0.05) in INTS10-deficient HepG2 cells compared with control cells; (B) Functional enrichment analysis of all genes in INTS10-knockdown HepG2 cells (FR = knockdown / control, FR < 0.7, FR > 1.3); (C, D) qRT-PCR and Western blotting analysis of indicated genes after overexpression (C) or knockdown (D) of INTS10 in HepG2 and HCC97H cells. Data are presented as mean ± standard deviation (n = 3), two-tailed Student's t-test; **P < 0.01, ***P < 0.001. Detailed implementation manners

[0026] The present invention provides the use of a reagent for overexpressing the INTS10 gene in the treatment and / or prevention of liver cancer. The present invention has no particular limitation on the type of the reagent, as long as it can overexpress the INTS10 gene.

[0027] In the present invention, the nucleotide sequence of the INTS10 gene is as shown in SEQ ID No. 11, specifically as follows:

[0028]

[0029] The present invention also provides the use of a reagent for overexpressing the INTS10 gene in inhibiting the growth of liver cancer cells. The present invention has no special limitation on the type of the reagent, as long as it can overexpress the INTS10 gene.

[0030] The present invention also provides the use of a reagent for overexpressing the INTS10 gene in inhibiting the migration of liver cancer cells. The present invention has no special limitation on the type of the reagent, as long as it can overexpress the INTS10 gene.

[0031] The present invention also provides the use of a reagent for overexpressing the INTS10 gene in promoting the apoptosis of liver cancer cells. The present invention has no special limitation on the type of the reagent, as long as it can overexpress the INTS10 gene.

[0032] The present invention also provides the use of a reagent for overexpressing the INTS10 gene in promoting the expression of P21, inhibiting the expression of CDC25A or CDK4.

[0033] In the present invention, the liver cancer cells are preferably HepG2 cells and / or HCC97H cells.

[0034] The present invention also provides the use of INTS10 protein in the preparation of drugs for treating and / or preventing liver cancer. The present invention has no special limitation on the type of the drug, as long as the INTS10 protein is medically acceptable.

[0035] The present invention also provides the use of INTS10 protein in the preparation of drugs for inhibiting the growth of liver cancer cells. The present invention has no special limitation on the type of the drug, as long as the INTS10 protein is medically acceptable.

[0036] The present invention also provides the use of INTS10 protein in the preparation of drugs for inhibiting the migration of liver cancer cells. The present invention has no special limitation on the type of the drug, as long as the INTS10 protein is medically acceptable.

[0037] The present invention also provides the use of INTS10 protein in the preparation of drugs for promoting the apoptosis of liver cancer cells. The present invention has no special limitation on the type of the drug, as long as the INTS10 protein is medically acceptable.

[0038] The present invention also provides the use of INTS10 protein in the preparation of drugs for promoting the expression of P21, inhibiting the expression of CDC25A or CDK4.

[0039] In the present invention, the liver cancer cells are HepG2 cells and / or HCC97H cells.

[0040] To further illustrate the present invention, the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0041] Example 1

[0042] 1 Materials and Methods

[0043] 1.1 Cell Lines and Vectors

[0044] Human hepatocellular carcinoma cell lines HepG2 and HCC97H, human embryonic kidney cell line HEK293T (all three cell lines were purchased from ATCC Shanghai Cell Bank); vector pLV-3×Flag-mCherry(2A)Puro-INTS10 for gene overexpression and control vector pLV-3×Flag-mCherry(2A)Puro, and vectors pLV-shRNA-EGFP(2A)Puro, pLV-shRNA-EGFP(2A)Puro-INTS10#1, pLV-shRNA-EGFP(2A)Puro-INTS10#2, and pLV-shRNA-EGFP(2A)Puro-INTS10#3 for gene knockdown (Yingmao Shengye Technology Co., Ltd.).

[0045] 1.2 Main Reagents

[0046] Cell culture medium (Dulbecco's Modified Eagle's Medium, DMEM) and 0.25% trypsin for passage (Beijing Xigong Biotechnology Co., Ltd.); fetal bovine serum (FBS, Gibco); CCK-8 detection kit was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.; Transwell chamber (353097) was purchased from BD-Biocoat, USA; SYBR Green fluorescence quantitative kit was purchased from Kapa, USA; INTS10 antibody (1:1000, NovusBiologicals) etc.

[0047] 1.3 Main Instruments

[0048] Carbon dioxide cell incubator (Thermo Fisher), sterile laminar flow hood (Beijing Hadonglian), high-speed centrifuge (Thermo Scientific), electrophoresis tank (Bio-Rad), electrotransfer tank (Tanon), protein blot imaging instrument (Tanon 5200), fluorescence quantitative PCR instrument (Bio-Rad) etc.

[0049] 1.4 Cell Culture

[0050] The culture medium used in the experiment was DMEM with 10% FBS and 1% penicillin-streptomycin double antibody, and the culture conditions were 37°C, 5% CO 2 , and a certain humidity was maintained.

[0051] 1.5 Construction of stable overexpressing and knockdown INTS10 hepatocellular carcinoma cell lines

[0052] The lentiviral packaging plasmids pMD2.G and pSPAX2 and the target plasmids (3×Flag and 3×Flag-INTS10 and shNC, shINTS10#1, shINTS10#2, shINTS10#3) were co-transfected into the HEK293T cell line at a ratio of 1:2:3. After 8 h (hour), the medium was replaced with normal medium and continued to be cultured. At 48 h, the cell culture supernatant rich in virus particles was collected, filtered through a 0.45 μm filter to remove cell debris, 6× virus concentrate was added, and after mixing, it was allowed to stand for more than 2 h. Centrifuge at 3000 rpm (r / min) for 30 min (minute) at 4°C, resuspend the precipitate with 1 mL of DMEM containing 10% FBS and mix well, and infect HCC97H and HepG2 with 5 μg / mL of Polybrene. At 48 h, puromycin with a final concentration of 2 μg / mL was added for screening.

[0053] 1.6 Protein extraction and Western blotting (WB) experiment

[0054] Collect the cells of the control group and the experimental group, add cell lysate containing protease inhibitor, place it on ice for lysis for 30 min, centrifuge at 12000 rpm for 10 min, transfer the supernatant to a new centrifuge tube, add an appropriate amount of protein loading buffer according to the ratio, and boil for 10 min to obtain the total cell protein sample. Prepare an SDS-PAGE gel with an appropriate concentration, then load the sample, perform electrophoresis and transfer the membrane. After the transfer is completed, place the cellulose acetate membrane containing the target protein in a blocking solution containing 5% skim milk and block it at room temperature for 1 h. Incubate the primary antibody overnight at 4°C, wash it 3 times with TBST, 5 min each time, incubate the secondary antibody at room temperature for 1 h, wash it 3 times with TBST again, and finally develop the film.

[0055] 1.7 RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR)

[0056] Total cellular RNA was extracted according to the kit instructions (Beijing ComWin Biotech Co., Ltd.). After measuring the concentration using a spectrophotometer, 500 ng of RNA was reverse-transcribed into cDNA using the MonScript™ RT III All-in-One Mix kit. Using 5 μL of cDNA as a template, a quantitative real-time PCR (qRT-PCR) amplification experiment was performed (detailed primer information is shown in Table 1). All samples were set with 3 replicates, and the ACTB gene was used as a control to normalize the mRNA quantification results. The INTS10 template was quantitatively analyzed based on the analysis of Ct values and the standard curve.

[0057] 1.8 CCK-8 assay for cell proliferation

[0058] Cells in the logarithmic growth phase were collected, counted, and the cell density was adjusted. 2000 cells per well were seeded in a 96-well plate, with 3 replicates for each group. After culturing the cells for a certain period of time, serum-free DMEM medium containing 10% CCK-8 reagent was added. The absorbance OD value was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader. Data were collected, and statistical analysis was performed based on the recorded data to plot the cell growth curve.

[0059] 1.9 Colony formation assay for cell proliferation

[0060] Cells in the logarithmic growth phase were seeded in a 6-well plate at a density of 2000 cells per well. Cultured for 14 days (day), and the medium was changed every 3 days during this period. When visible colonies appeared, the culture was terminated, fixed with methanol for 30 min, and stained with 0.5% crystal violet solution for 30 min. Finally, the plate was washed and dried, and the colonies were photographed, counted, and statistically analyzed.

[0061] 1.10 BrdU assay for cell proliferation

[0062] After resuspending the cells in the logarithmic growth phase, BrdU at a concentration of 10 μM was added, and the cells were cultured in a 37 °C cell incubator for 30 min - 2 h. After washing with 1% BSA / PBS, the cells were dropped into pre-cooled absolute ethanol and fixed at -20 °C for 1 hour. After washing, 1 mL of 2N HCl / 0.5% Triton X-100 was added, and the mixture was slowly vortexed at room temperature for 1 h; 1 mL of 0.1M Na 2 BO 4Resuspend in (pH 8.5) to neutralize the acid; centrifuge and discard the supernatant, wash once with 0.5% Tween 20 / 1% BSA / PBS, then add BrdU-PE antibody (diluted 1:100), and incubate with slow vortexing at room temperature for 1 h; wash 3 times with 0.5% Tween 20 / 1% BSA / PBS, add an appropriate amount of 300 - 500 μL PBS, and perform flow cytometry to analyze the data.

[0063] 1.11 Detection of cell cycle by flow cytometry

[0064] Collect the cells of the control group and the experimental group, resuspend with 300 μL PBS and then dropwise suspend in 700 μL pre-cooled absolute ethanol, and fix overnight at -20°C. After centrifugation, suspend the cell pellet in 300 - 500 μL PBS containing 20 μg / mL RNAase A (1:200) and 40 μg / mL PI, and incubate at room temperature for 15 min; detect by flow cytometer and analyze the data with FlowJo software.

[0065] 1.12 Detection of cell apoptosis by flow cytometry

[0066] Take the cells of the experimental group and the control group in the logarithmic growth phase, inoculate them in a 12-well plate at a density of 2×10 5 cells / well, and culture them in a cell incubator. At 24 h, stimulate the cells with 800 μM H 2 O 2 Collect the cells, add 100 μL 1×Binding Buffer to resuspend the cells, then add 5 μL V-FITC and 10 μL PI, mix gently, incubate in the dark at room temperature for 15 min, add 400 μL 1×Binding Buffer, place on ice, detect cell apoptosis by flow cytometer, and analyze the data with FlowJo software.

[0067] 1.13 Detection of cell migration ability

[0068] Count the cells in the logarithmic growth phase and dilute them to 5×10 5 cells / mL. Add 800 μL of medium containing 20% FBS to each well of a 24-well plate. Gently place the Transwell chamber into the well of the 24-well plate. Take 200 μL of the above-diluted cell suspension and add it to the Transwell chamber, and continue to culture in the incubator for 18 - 24 h. Transfer the chamber to a 24-well plate containing 1 mL of 4% paraformaldehyde and fix for 15 min, then transfer it to a well containing 1 mL of 0.5% crystal violet solution and stain for 10 min. Gently rinse the chamber with PBS, and carefully wipe off the crystal violet inside the chamber and the cells that have not passed through the membrane with a cotton swab. Take pictures of the cells that have passed through the chamber under the microscope and perform statistical analysis.

[0069] 1.14 Clinical relevance analysis

[0070] The present invention uses the gene expression profiling interactive analysis (GEPIA) http: / / gepia.cancer-pku.cn / detail ) platform and the Human Protein Atlas database to show the expression differences of INTS10 in liver cancer and normal liver tissues at the mRNA and protein levels.

[0071] 1.15 Statistical analysis

[0072] All experiments of the present invention collected 3 pairs of samples for detection, analyzed the Mean±SD of each group using Graphpad Prism 8.0, and used the t-test for statistical tests. P>0.05 was marked as "ns"; P<0.05 was marked as "*"; P<0.01 was marked as "**"; P<0.001 was marked as "***".

[0073] Table 1 Primer sequences for qRT-PCR experiments

[0074] Primer Nucleotide sequence (5’-3’) ACTB-F SEQ ID No.1 GAGAGGGAAATCGTGCGTGACA ACTB-R SEQ ID No.2 ACCCAAGAAGGAAGGCTGGAAA INTS10-F SEQ ID No.3 AAGACTGTTCGGCGAAAGGA INTS10-R SEQ ID No.4 AGGCTGGCTATCGCCTTTTT CDC25A-F SEQ ID No.5 GTGAAGGCGCTATTTGGCG CDC25A-R SEQ ID No.6 TGGTTGCTCATAATCACTGCC CDKN1A-F SEQ ID No.7 TGTCCGTCAGAACCCATGC CDKN1A-R SEQ ID No.8 AAAGTCGAAGTTCCATCGCTC CDK4-F SEQ ID No.9 ATGGCTACCTCTCGATATGAGC CDK4-R SEQ ID No.10 CATTGGGGACTCTCACACTCT

[0075] F, forward; R, reverse

[0076] 2 Results

[0077] 2.1 The mRNA level and protein level of INTS10 are lowly expressed in liver cancer tissues

[0078] To explore the expression level of INTS10 in liver cancer tissues, the gene expression profiling interactive analysis (GEPIA) http: / / gepia.cancer-pku.cn / detail ) platform was used to analyze the expression level of INTS10 mRNA in 31 types of cancer tissues and their corresponding adjacent tissues in TCGA. The results showed that the expression of INTS10 was significantly lower in cancer tissues of about 1 / 5 cancer types than in the corresponding adjacent non-tumor tissues ( Figure 1 in A). Among them, the mRNA expression level of INTS10 in liver cancer tissues was significantly lower than that in adjacent tissues ( Figure 1 in B). At the same time, to study the protein level of INTS10 in liver cancer tissues, the expression differences of INTS10 in liver cancer and normal liver tissues were shown through the Human Protein Atlas database, and the expression of INTS10 in liver cancer tissues was lower than that in normal liver tissues ( Figure 1Therefore, it is speculated in this paper that INTS10 may play the function of a tumor suppressor gene in liver cancer.

[0079] 2.2 INTS10 can inhibit the growth ability of liver cancer cells

[0080] To further study the biological function of INTS10 in the occurrence and development of liver cancer, the present invention constructed liver cancer cell lines with stable overexpression or knockdown of INTS10 by means of lentivirus packaging, and used qRT-PCR and Western blotting techniques to verify the overexpression or knockdown effect of INTS10. The results showed that in HepG2 and HCC97H cells, compared with the control group (pLV-mCherry), the mRNA and protein levels of INTS10 in the overexpression group (pLV-mCherry-INTS10) were significantly increased; compared with the knockdown control group (pLV-EGFP), the expression of INTS10 in the knockdown groups (pLV-shINTS10#2 and pLV-shINTS10#3) was significantly decreased, demonstrating the successful construction of cell lines with stable interference of INTS10 ( Figure 2 The present invention first used the CCK-8 assay to evaluate the effect of INTS10 on the growth ability of liver cancer cells. The results showed that overexpression of INTS10 could inhibit the growth ability of HepG2 and HCC97H cells ( Figure 3 in A), while knockdown of INTS10 significantly promoted the growth ability of liver cancer cells ( Figure 3 in B). Secondly, the present invention also detected the effect of INTS10 on the clonogenic growth ability of liver cancer cells through the cell plate cloning experiment. The results showed that overexpression of INTS10 could significantly inhibit the clonogenic growth ability of HepG2 and HCC97H cells ( Figure 3 in C), while knockdown of INTS10 significantly promoted the clonogenic growth ability of liver cancer cells ( Figure 3 in D). Finally, the Brdu staining method was used to detect the number of proliferating cells. The higher the Brdu positive rate, the stronger the cell proliferation ability. Compared with the Brdu positive rate of the control group cells, the positive rate of the overexpression INTS10 group cells decreased, and the positive rate of the knockdown group cells increased ( Figure 3 in E, F), indicating that stable interference of INTS10 significantly promoted the S-phase DNA synthesis ability of HepG2 and HCC97H cells. These results indicate that INTS10 inhibits the growth ability of liver cancer cells.

[0081] 2.3 INTS10 can inhibit the migration ability of liver cancer cells

[0082] To evaluate whether INTS10 affects the migratory ability of liver cancer cell lines, the present invention stably overexpressed or knocked down INTS10 in liver cancer cells HepG2 and HCC97H and performed Transwell migration assays. The results showed that overexpression of INTS10 significantly inhibited the migratory ability of cancer cells ( Figure 4 in A), while knockdown of INTS10 significantly inhibited the migratory ability of liver cancer cells ( Figure 4 in B). The above results indicate that INTS10 inhibits the growth and migratory ability of liver cancer cells and functions as a tumor suppressor gene in liver cancer progression.

[0083] 2.4 INTS10 can inhibit the cell cycle progression of liver cancer cells

[0084] The cell cycle is a basic process of cell life activities, and cell cycle disorder is one of the important biological mechanisms in tumorigenesis and development. To explore the effect of abnormal expression of INTS10 on the cell cycle of liver cancer cells, the present invention used flow cytometry to observe the changes in the cell cycle after perturbing the INTS10 gene in HepG2 and HCC97H cells. The results showed that after overexpression of INTS10, the number of liver cancer cells in the G1 phase increased significantly, the number of cells in the S phase decreased significantly, while the number of cells in the G2 / M phase did not change significantly ( Figure 5 in A). Conversely, knockdown of INTS10 decreased the number of liver cancer cells in the G1 phase, increased the number of cells in the S phase, and had no significant effect on the number of cells in the G2 / M phase ( Figure 5 in B). The above results suggest that INTS10 can inhibit the G1 / S progression of the cell cycle of liver cancer cells.

[0085] 2.5 INTS10 can significantly promote the apoptosis of liver cancer cells

[0086] Abnormal apoptosis of tumor cells is also one of the important biological mechanisms in tumorigenesis and development. To explore the effect of abnormal expression of INTS10 on the apoptosis of liver cancer cells, Annexin V-APC / PI staining was used to detect the effect of perturbing the INTS10 gene on the apoptosis of HepG2 and HCC97H cells. The results showed that compared with unstimulated cells, overexpression of INTS10 promoted the apoptosis of HepG2 and HCC97H cells ( Figure 6 in A); while knockdown of INTS10 relatively inhibited the apoptosis of liver cancer cells ( Figure 6 in B).

[0087] 2.6 INTS10 functions as a tumor suppressor gene by mediating cell cycle-related regulators

[0088] One of the most significant characteristics of cancer cells is uncontrolled growth. This is often due to gene mutations that lead to dysregulation of the proliferation and anti-apoptotic abilities of cancer cells, and this dysregulated ability is mainly related to the cell cycle. Through research, the present invention found that interfering with the INTS10 gene has a significant impact on the cyclic growth of liver cancer cells. The cyclic growth of cells is mainly regulated by the phosphorylation and dephosphorylation of proteins, and protein phosphatases play an important role in this process. Some studies have shown that phosphatases also play a key role in regulating the cell cycle process and signal transduction. To explore the mechanism of action of INTS10 on liver cancer, the present invention knocked down INTS10 in HepG2 cells and performed RNA-seq analysis. Through differential expression gene analysis, it was shown that knocking down INTS10 significantly upregulated the expression of 1,881 genes and downregulated the expression of 1,443 genes ( Figure 7 in A). Subsequently, the present article performed functional enrichment analysis on all the expressed genes respectively. The results showed that the genes negatively regulated by INTS10 were significantly enriched in anti-cancer signaling pathways such as the cell cycle and apoptosis ( Figure 7 in B). It was found that the two genes, CDC25A and CDKN1A, are recognized as key regulators of cell cycle progression. In different cancers, CDC25A and CDKN1A affect the expression of cyclin-dependent kinase 4 (CDK4), thereby affecting the cell cycle process. Next, the present invention verified the effect of INTS10 on the expression of CDC25A, CDKN1A, and CDK4 in HepG2 and HCC97H cell lines by qRT-PCR and Western Blotting. After overexpressing INTS10, the mRNA levels and protein levels of CDC25A and CDK4 were significantly reduced, while the level of CDKN1A was significantly increased; similarly, after knocking down INTS10, the mRNA levels and protein levels of CDC25A and CDK4 were significantly increased, while the level of CDKN1A was significantly reduced ( Figure 7 in C, D). In summary, the present invention preliminarily reveals that INTS10 may play an anti-cancer function in liver cancer cells by affecting the transcription of proteins related to the G1 / S phase of the cycle, providing a basis for further research on the impact of INTS10 on liver cancer.

[0089] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of a vector overexpressing the INTS10 gene in the preparation of a reagent for promoting the expression of P21 in liver cancer cells, inhibiting the expression of CDC25A in liver cancer cells and CDK4 in liver cancer cells in vitro; The liver cancer cells are HepG2 cells and / or HCC97H cells.

Citation Information

Patent Citations

  • Use of INTS10 gene / protein in inhibiting HBV gene duplication or preventing or treating HBV associated diseases

    CN105833290A

  • Control agent for initial stage of g1 phase of cell cycle

    WO2021157689A1