Major QTL loci and InDel molecular markers of chromosome C06 related to flowering time in Brassica napus and their applications

Abstract

The present invention discloses a major effect QTL locus of chromosome C06 related to the flowering time of Brassica napus, an InDel molecular marker and an application thereof, and belongs to the field of molecular biology. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 and SEQ ID NO: 4. Experimental results show that the strain carrying the sequence of SEQ ID NO: 3 has an earlier flowering time, and the strain carrying the sequence of SEQ ID NO: 4 has a later flowering time. The major effect QTL locus of chromosome C06 of the present invention has a higher contribution rate to the flowering time trait of Brassica napus, and plays a key role in regulating the flowering time trait of Brassica napus. The molecular markers closely linked thereto can assist in the selection of early flowering materials and cultivate early flowering and early maturing rapeseed. The molecular markers have the advantages of good accuracy, high efficiency and high cost performance, and are suitable for large-scale promotion and application. The present invention is helpful for the cloning of genes related to the flowering time of rapeseed and the development of functional markers of genes related to the flowering time.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a major QTL site of a C06 chromosome related to the flowering time of Brassica napus, an InDel molecular marker and an application thereof. Background Art

[0002] Flowering is an important turning point in the growth process of higher plants, indicating that the plant changes from vegetative growth to reproductive growth. Under the combined action of external environmental factors and plant endogenous substances, plants grow and develop from the seedling stage to the adult stage and are induced to flower, which is the most important stage in the life of plants. Plants are different from animals. Plants can only survive better if they constantly change themselves to adapt to the external environment. The time when crops change from vegetative growth to reproductive growth determines whether the crops can flower in time, and whether the crops can flower in time ultimately determines the yield and quality of the crops. Brassica napus is one of the important oil crops in my country. Brassica napus is divided into three ecotypes: winter rapeseed, semi-winter rapeseed and spring rapeseed according to whether its flowering requires vernalization. In-depth research on the flowering regulation mechanism of Brassica napus will help breeders to cultivate excellent rapeseed varieties that can adapt to different ecological environments in China, which is of great significance for ensuring high and stable yields.

[0003] There are currently two commonly used strategies for cloning flowering genes in the study of flowering genes in Brassica napus: one is to refer to the information of flowering genes in the model plant Arabidopsis thaliana, directly separate them by homologous sequence method in Brassica napus, obtain each copy, and then analyze the expression of flowering genes in the material. The second strategy is to use different populations to locate the flowering period QTL of Brassica napus from the perspective of forward genetics. Many of these studies are based on linkage mapping analysis of parents. Based on this strategy, researchers have found different copies of genes such as FLC and FT genes that are important in flowering regulation in Brassica napus, and found that these copies have strong and weak differentiation in function. In addition, in recent years, a large number of studies have been based on association mapping analysis of natural populations. Through natural populations, many SNP markers have been found to be located in the flowering gene region. These SNP markers can be well used in molecular breeding in the later stage.

[0004] The flowering time of Brassica napus is a typical quantitative trait, which is regulated by multiple genes and is also affected by the external environment, indicating that the inheritance of the flowering time trait is relatively complex. Therefore, it is necessary to provide a major effect QTL locus for the flowering time trait of Brassica napus, which has a high contribution rate to the flowering time trait of Brassica napus and plays an important role in regulating the flowering time of Brassica napus, so as to enrich the research on the flowering time of Brassica napus. Summary of the invention

[0005] The purpose of the present invention is to provide a major effect QTL site of chromosome C06 related to the flowering time of Brassica napus, an InDel molecular marker and an application thereof, so as to solve the problems existing in the above-mentioned prior art. The molecular marker can be used to detect the early or late flowering time of Brassica napus, predict the early or late flowering time of Brassica napus, effectively select the early or late flowering time of Brassica napus, and can also be used for molecular marker-assisted breeding of Brassica napus with early flowering time, thereby accelerating the process of early flowering and early maturity breeding of Brassica napus. The molecular marker has the advantages of good accuracy, high efficiency and high cost performance, and is suitable for large-scale promotion and application.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a molecular marker linked to a major QTL locus related to the flowering time trait of Brassica napus. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:3 and SEQ ID NO:4.

[0008] Preferably, the major QTL locus for the flowering time trait of Brassica napus is located between base 33585972 and base 34116003 of chromosome C06 of Brassica napus.

[0009] The present invention also provides a primer set for amplifying the molecular marker, and the primer set is a sequence as shown in SEQ ID NO: 1-2.

[0010] The present invention also provides a kit for identifying the molecular marker, and the kit comprises the primer set.

[0011] The present invention also provides a kit for identifying flowering time traits of Brassica napus, and the kit comprises the primer set.

[0012] The present invention also provides the use of the molecular marker, the primer set, or the kit in Brassica napus breeding.

[0013] The present invention also provides the use of the molecular marker, the primer set, or the kit in assisting the screening of Brassica napus varieties with different flowering times.

[0014] The present invention also provides a method for screening Brassica napus varieties with different flowering times, comprising the following steps:

[0015] The target gene is amplified using the genome of the Brassica napus sample to be tested as a template, the correlation between the target gene and the flowering time of Brassica napus is analyzed, and Brassica napus varieties with different flowering times are screened; the nucleotide sequence of the target gene includes the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0016] Preferably, when the target gene carries the sequence shown in SEQ ID NO: 3, the sample to be tested is an early-flowering Brassica napus variety; when the target gene carries the sequence shown in SEQ ID NO: 4, the sample to be tested is a late-flowering Brassica napus variety.

[0017] Preferably, the PCR amplification system includes: 2 μL of DNA template, 5 μL of 2×Tap PCR Mix, 1 μL of upstream and downstream primers, and 2 μL of ddH2O;

[0018] The PCR amplification program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 45 s, for a total of 35 cycles; and extension at 72°C for 10 min.

[0019] The present invention adopts a simplified genome sequencing method to sequence the genome of the parents and 178 DH materials, and then constructs the population genetic map through SNP-based Bin marker analysis. Combined with the flowering period phenotypic data of three years and six repetitions, the composite interval mapping standard model (model 6) of WinQTLcart2.5 software is used to detect the flowering period QTL of three years and six repetitions, and further determine the stability of the main effect QTL. The present invention discovered a main effect flowering time QTL located on chromosome C06, named cqDTF-C06, which is an environmentally stable QTL. The site is located between the 33585972nd base and the 34116003rd base of the C06 chromosome of Brassica napus, and the contribution rate of the site to the flowering time trait of Brassica napus is 6.07-16.03%. The present invention also predicts the candidate gene of the QTL, and develops a tightly linked insertion and deletion (InDel) marker for the cqDTF-C06 gene site. The results of this study enhance the understanding of the molecular regulatory mechanisms of flowering time and provide molecular markers that can be used for breeding of rapeseed flowering time traits.

[0020] The present invention discloses the following technical effects:

[0021] The present invention successfully locates a major flowering QTL locus cqDTF-C06 of Brassica napus by constructing a DH population and its high-density genetic map, and designs a tightly linked molecular marker using the sequence of the cqDTF-C06 segment itself: InDel marker C06-25. Experimental verification shows that the strain carrying the InDel marker SEQ ID NO: 3 (C06-25a, 141bp) sequence has an earlier flowering time, and the strain carrying the InDel marker SEQ ID NO: 4 (C06-25b, 174bp) has a later flowering time, and the difference in flowering time between the two reaches a significant level. The present invention provides an excellent molecular marker for early flowering and early maturity breeding and improvement of Brassica napus, and early flowering materials can be selected and bred through molecular marker-assisted selection, thereby cultivating early flowering and early maturity rapeseed, which has the advantages of good accuracy, high efficiency and high cost performance. The present invention will be helpful for cloning genes related to flowering time of rapeseed and developing functional markers of genes related to flowering time. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 A technical flow chart for the development and identification of the major QTL loci and InDel molecular markers of the C06 chromosome for the flowering time trait of Brassica napus of the present invention;

[0024] Figure 2 The flowering phenotype diagrams of the early-flowering parent 158A and the late-flowering parent SGDH284 of the Brassica napus of the present invention; A is a field phenotype picture taken on March 21, 2020 after sowing on October 21, 2019 in a winter rapeseed environment, and B is a field phenotype picture taken on March 28, 2020 after sowing on October 21, 2019 in a winter rapeseed environment;

[0025] Figure 3 This is a frequency distribution diagram of flowering period phenotypes of the Brassica napus 158A-SGDH population of the present invention for one replicate in 2018-2019, three replicates in 2019-2020, and two replicates in 2020-2021; the abscissa is flowering time (days), and the ordinate is density (the percentage of individual plants that bloomed on the same day to the total number);

[0026] Figure 4 This is the correlation analysis of the six repeated flowering period phenotypes over three years of the present invention;

[0027] Figure 5It is the genetic linkage map of the 158A-SGDH population of the present invention;

[0028] Figure 6 The linkage group bin marker information of C06 of the present invention;

[0029] Figure 7 Identification of candidate genes for the flowering time QTL interval of the C06 linkage group of Brassica napus of the present invention; the upper curve represents the QTL identified in six replicates in three environments, the lower curve represents the additive effect of the QTL of the same color, the main effect QTL cqDTF-C06 is shown under the confidence interval, and the candidate genes related to flowering time are shown under the main effect QTL cqDTF-C06;

[0030] Figure 8 The banding patterns of 158A-SGDH population A0-A47 and parents 158A (P1) and SGDH284 (P2) analyzed by cqDTF-C06 gene locus-specific InDel marker C06-25;

[0031] Fig. 9 Results of variance analysis of six replicates of the 158A-SGDH population using the specific InDel marker C06-25 at the cqDTF-C06 locus; "C06-25a" in the figure indicates the family carrying the cqDTF-C06 early-flowering parent locus, and "C06-25b" indicates the family carrying the cqDTF-C06 late-flowering parent locus; flowering time statistics are mean ± SEM; * indicates P < 0.05, ** indicates p < 0.01. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] like Figure 1 As shown, it is a technical flow chart for the construction of DH population, phenotypic identification, map construction, QTL positioning, identification of major QTL candidate genes, and development and identification of major QTL interval molecular markers in the present invention. Specifically: the biparental materials 158A and SGDH284 used in the present invention are DH pure lines obtained by microspore culture and doubling of the semi-winter material Zhongyou 9988 and the European high-oil variety winter material Sollux promoted in production using microspore culture technology in the early stage (Keet al 2020). These two pure line materials showed cold-resistant and stable growth from autumn sowing to winter in Anhui Province. After the new year, 158A showed rapid growth, rapid bolting, and flowering about 8 days in advance compared with SGDH284. Using the two as parents, the F1 generation obtained by hybridization, through its anther microspore culture, obtained a DH population containing 178 materials, which was named 158A-SGDH in the present invention.

[0038] Example 1 Analysis of flowering period phenotype of 158A-SGDH population

[0039] The phenotypic difference of flowering period between the early-flowering parent 158A and the late-flowering parent SGDH284 in the semi-winter rapeseed environment (Fengyang, Anhui) was extremely significant (see Table 1 and Figure 2 , Figure 2 Middle A is a field phenotype picture taken on March 21, 2020 after sowing on October 21, 2019 in a winter rapeseed environment. At this time, the early-flowering parent 158A has already bloomed; Figure 2Middle B is a field phenotypic picture taken on March 28, 2020 after sowing on October 21, 2019 in a winter rapeseed environment. At this time, the late-flowering parent SGDH284 began to bloom; scale bar = 10 cm).

[0040] After constructing the 158A-SGDH population based on the two as parents, the population was planted in a winter rapeseed environment: one replicate (FY18.1) was planted on October 18, 2018; and the flowering phenotype of the population was investigated in March and April 2019 (see Tables 1 and Figure 3 ). Then, on October 21, 2019, the group was planted in three replicates (FY19.1, FY19.2, and FY19.3); and then the flowering phenotype of the group was investigated in March and April 2020 (see Tables 1 and Figure 3 The present invention continued to plant two replicates of this population (FY20.1 and FY20.2) on October 15, 2020, and investigated the flowering phenotype of this population material in March and April 2021 (see Tables 1 and Figure 3 ). Therefore, through three years of phenotyping, a total of 6 repeated flowering period phenotypic data were collected (see Tables 1 and Figure 3 ). From the phenotypic distribution diagram, it can be seen that the 158A-SGDH population showed a normal distribution trend in three years and six replicates, indicating that the flowering period is a quantitative trait controlled by multiple genes. Moreover, compared with 2018-2019, the flowering period of the 158A-SGDH population in 2019-2020 and 2020-2021 was significantly earlier (see Figure 3 ).

[0041] Table 1 Phenotypic variation of flowering time (days) in the 158A-SGDH population and its parents

[0042]

[0043]

[0044] The data in the table were compared by t-test. ***p<0.001. a Mean ± SEM, SEM indicates standard error of the mean.

[0045] In order to determine whether the overall shift in flowering period of the 158A-SGDH population in 2018-2019, 2019-2020, and 2020-2021 would affect the subsequent QTL detection of flowering period, the correlation of the six repeated flowering periods of the 158A-SGDH population in the above three years was analyzed. It was found that the correlation of flowering period between the six replicates reached an extremely significant correlation level (see Figure 4 ). This indicates that the flowering period phenotypes among the replicates can be used for the next step of flowering period QTL detection.

[0046] Example 2 Construction of the genetic map of the 158A-SGDH population

[0047] A total of 178 material samples and parental samples of the 158A-SGDH population were sent to Shanghai Paisonno Biotechnology Co., Ltd. for simplified genome sequencing. A total of 360.87Gb of data was generated after simplified genome sequencing. The average Q20 quality score was above 98.69%, and the GC content was about 39.09%. The DH population samples measured no less than 1G of data, and the average sequencing depth of each strain was 1.70 times. The parental 158A and SGDH284 obtained sequences of 5,064,588,459bp and 5,362,611,753bp, respectively, with sequencing depths of 3.67 times and 4.19 times, respectively.

[0048] The genetic map of the 158A-SGDH population was obtained through simplified genome sequencing, and a total of 946,690 SNPs were obtained through analysis and screening. In order to construct the genetic map, the 946,690 SNPs were further filtered, and the main filtering conditions were as follows:

[0049] (1) Parental genotype: loci that remain homozygous in both parents and are inconsistent between the parents;

[0050] (2) Sequencing depth: retain sites with progeny sequencing depth > 2;

[0051] (3) Deletion rate: retain sites with a deletion rate of <0.5 in the offspring.

[0052] Finally, 13,395 bin markers were screened, converted into genotype format, and organized into the input file format of MSTmap software. The software MSTmap was used to group and draw linkage groups. Finally, a total of 2,777 bin markers were anchored to 19 linkage groups, with a total length of 3268.01 cM and an average marker spacing of 1.18 cM (see Figure 5 ).

[0053] Example 3 QTL location of flowering time in 158A-SGDH population

[0054] QTL analysis was performed using the standard model (model 6) of composite interval mapping using WinQTLCart 2.5 software. The phenotypic data for flowering period were the phenotypic values ​​of 178 lines, repeated six times in three years. A total of 56 QTLs for flowering period were detected through QTL analysis (see Table 2). The proportion of phenotypic variation explained by a single QTL ranged from 2.70% to 32.04%. The identified QTLs were distributed in 12 linkage groups, and the confidence intervals (CIs) of QTLs in different experiments overlapped. Among the 56 QTLs, 44 could be integrated into 12 reproducible common QTLs through meta-analysis, which were named cqDTF-A02, cqDTF-A04, cqDTF-A06-1, cqDTF-A06-2, cqDTF-A07, cqDTF-A09, cqDTF-C02, cqDTF-C04-1, cqDTF-C04-2, cqDTF-C05, cqDTF-C06 and cqDTF-C09 (Table 2).

[0055] Among these shared QTLs, the results shown in Table 2 show that: cqDTF-C02 was detected in all six replicates; cqDTF-C06 was also detected in six replicates, of which five replicates were detected in a common interval, and one replicate was located in the 3.38-28.99 cM interval; cqDTF-A04 was also detected in six replicates, of which five replicates were detected in a common interval; cqDTF-A07 and cqDTF-C09 were detected in all five replicates. Four QTLs (cqDTF-A02, cqDTF-A06-3, cqDTF-A06-4, and cqDTF-C05) were detected in three replicates, and three QTL loci were detected in two replicates: cqDTF-A09-2, cqDTF-C04-1, and cqDTF-C04-2.

[0056] Table 2 QTL detection of flowering time in 158A-SGDH population

[0057]

[0058]

[0059]

[0060] a The proportion of phenotypic variation explained by the QTL; b+ and - indicate the direction of additive effects.

[0061] Two stable major QTLs (cqDTF-C02 and cqDTF-C06) were detected for flowering time. The cqDTF-C06 gene locus is located on linkage group C06 (see Figure 6), cqDTF-C06 explained 6.07-16.13% of the phenotypic variation (Table 2). Meta-analysis results showed that the peak value of the cqDTF-C06 locus in the genetic linkage map was 41.98 cM, with a CI of 40.37-43.60 cM, and the markers on both sides were chrC06_bin10767 and chrC06_bin10772; the physical distance between the markers was 33585972 to 34116003 bp (see Figure 6 ).

[0062] The above results show that cqDTF-C06 can be stably detected in 6 replications over three years, 5 of which were located in the same interval. Therefore, this site is a stable major QTL site for flowering time.

[0063] Example 4 Prediction of candidate genes in the major flowering time QTL cqDTF-C06 region

[0064] Based on the reference genome of Brassica napus ZS11 (http: / / yanglab.hzau.edu.cn / BnIR), 65 genes were predicted in the 530-kb cqDTF-C06 region. Based on the microcollinearity of the target regions in Brassica napus and Arabidopsis thaliana, a gene that may be associated with flowering time was detected: BnaC06G0229100ZS (AT3G61250 / AtMYB17) (see Figure 7 ).

[0065] Example 5 Development and application of InDel markers in the major flowering time QTL cqDTF-C06 region

[0066] Based on the Illumina sequencing data of 158A and SGDH284, InDel markers for cqDTF-C06 were developed using the ZS11 reference genome. An InDel marker with parental polymorphism and strong banding pattern was screened out, which was C06-25. The primer sequence for amplifying this marker was:

[0067] C06-25L: 5'-CGTCGCTACTTGGTACTCGG-3' (SEQ ID NO: 1);

[0068] C06-25R: 5'-ACCGGATGTTAACGAGTCAAGT-3' (SEQ ID NO: 2).

[0069] The 48 strains of the DH population and the analysis of the parents 158A (P1) and SGDH284 (P2) were analyzed using the C06-25 marker. Figure 8As shown, it shows the test results of using C06-25 marker to detect and identify the 158A-SGDH population family numbered A0 to A47 and the parents 158A (P1) and SGDH284 (P2). The test is as follows:

[0070] (1) DNA extraction of test samples

[0071] DNA was extracted using the CTAB method. The reagents and steps are as follows (refer to Doyle et al; 1987):

[0072] (2) Preparation of reagents

[0073] Tris-HCl (1.0M / L, pH 8.0): 60.58 g Tris-Base and 21 mL concentrated HCl were added with dd H2O to make up to 500 mL.

[0074] EDTA (0.5M / L, pH 8.0): 186 g EDTA and 25 g NaOH (granules) were added with dd H2O and the volume was adjusted to 1 L.

[0075] 2% CTAB: 81.9g NaCl, 100mL 1.0M / L Tris-HCl (pH8.0), 40mL 0.5M / LEDTA (pH8.0), 20g CTAB, add ddH2O to make up to 1L, and it can be used for DNA extraction after sterilization.

[0076] 5M / L NH4AC: 385.4g NH4AC and add dd H2O to make up to 1L.

[0077] 76% Ethanol (containing 10 mM NH4AC): 760 mL of anhydrous ethanol and 2 mL of 5 M / L NH4AC, add dd H2O to make up to 1 L.

[0078] 3M / L NaAc (pH 5.2): 246.09g NaAc was added with dd H2O and HAC to make up to 1L, and the pH was adjusted to 5.2 with HAC.

[0079] 24:1: Pipette 22 mL of isoamyl alcohol into 500 mL of chloroform and mix well.

[0080] (3) CTAB method DNA extraction steps

[0081] ① Use a numbered 2mL centrifuge tube to take a small amount of young leaves (cotyledons for seedlings germinated indoors) and freeze them in a -20℃ freezer for later use.

[0082] ② Grind the sample: take out the centrifuge tube and place it on ice, open the lid and add clean steel beads, add 100μL CTAB at the same time, cover it and place it in the grinder adapter (28times / s, 30s), take out the centrifuge tube after grinding, open the lid, pour out the steel beads, and add 300μL CTAB.

[0083] ③ Place the centrifuge tube on the centrifuge box plate and bathe it in a water bath at 55-60°C for 50-60 minutes, shaking it gently every 10 minutes. After the water bath, place it in a fume hood to cool at room temperature (approximately 30-60 minutes).

[0084] ④ Add an equal volume (400 μL) of 24:1 solution into the tube, shake gently for 10 min, and centrifuge at 12000 rpm for 10 min.

[0085] ⑤ Aspirate the supernatant (200 μL) and transfer it to a 1.5 mL centrifuge tube with the same number as the original one (pre-add 1 / 10 volume of 3 M / L NaAc of the supernatant), add twice the volume of frozen anhydrous ethanol (-20°C refrigerator overnight), and let it stand for 20 to 30 minutes.

[0086] ⑥ If the DNA clumps are large, you can directly pick out the DNA with the gun tip and pour out the ethanol. If the amount of DNA is small, cover the lid, centrifuge at 8000rpm for 2 minutes, then open the lid and pour out the alcohol.

[0087] ⑦ Then add 76% ethanol to wash the precipitate (can be overnight), rotate occasionally, and repeat 1 to 2 times.

[0088] ⑧ Gently pour out the alcohol, place the DNA at the bottom of the tube, blow dry at room temperature, add TE or ddH2O to dissolve, place in a 37℃ constant temperature box for 1 hour and shake well. For long-term storage, please place in a -20℃ freezer.

[0089] (4) Amplification system and procedures:

[0090] The PCR reaction system (10 μL system) is as follows:

[0091]

[0092] (5) Amplification procedure:

[0093] Step 1: pre-denaturation at 94°C for 3 minutes;

[0094] Step 2: denaturation at 94°C for 30 seconds;

[0095] Step 3: annealing at 60°C for 30 seconds;

[0096] Step 4: extension at 72°C for 45 seconds;

[0097] Step 5: Return to step 2 and repeat 35 times;

[0098] Step 6: 72°C for 10 minutes;

[0099] Step 7: 4℃ for 5 minutes.

[0100] (6) Electrophoresis detection method:

[0101] Polyacrylamide gel electrophoresis detection (6% PAGE):

[0102] ① Reagent preparation

[0103] A. 5×TBE was prepared as follows: Tris-base 107.8 g, EDTA 7.44 g, boric acid 55.0 g, and the volume was adjusted to 2 L with ultrapure water.

[0104] B. 6% PAGE was prepared as follows: 200 mL of 5×TBE, 114 g of acrylamide, and 6 g of methylene acrylamide. The volume was adjusted to 2 L with ddH2O, and filtered with double-layer filter paper for later use.

[0105] C. Preparation of 10% ammonium persulfate (AP): 10 g of ammonium persulfate, add ultrapure water to make up to 100 mL.

[0106] D. Silver stain: 1.5 g silver nitrate dissolved in 1.5 L dH2O.

[0107] E. Developer: 0.6g sodium carbonate and 30g sodium hydroxide are dissolved in 1.5L dH2O. When developing, add 6mL formaldehyde (37%) in a fume hood and mix well before use.

[0108] ② Gel preparation

[0109] A. Before using, the long glass should be cleaned with detergent and dried.

[0110] B. Wipe the long and short glass separately with anhydrous ethanol, and let it dry until the ethanol evaporates.

[0111] C. Seal the two glasses, place them in the electrophoresis tank, turn the nuts to adjust the tightness, and seal the edges with agar.

[0112] D. Pour about 30 mL of 6% PAGE into a beaker, then add 300 μL AP and 30 μL TEMED respectively, and stir quickly and evenly.

[0113] E. Quickly pour the PAGE gel between the two glasses, tap the glass gently to prevent bubbles. Then insert the back of a clean comb between the two glasses. Generally, electrophoresis can be performed after 20-30 minutes.

[0114] ③ Electrophoresis

[0115] Before electrophoresis, use a pipette to remove the broken gel on the glass plate and rinse it with buffer. Carefully remove the comb and place it on the electrophoresis tank for pre-electrophoresis. After the pre-electrophoresis, insert the spotting comb into the glass for spotting. Run the electrophoresis at 80W for the required time.

[0116] ④ Development

[0117] A. Remove the long glass, with the adhesive side facing up, and quickly rinse it with 1L ddH2O (about 10 seconds).

[0118] B. Silver staining for 8-10 minutes (the silver staining solution is 0.5g AgNO3 dissolved in 1L dH2O).

[0119] C. Take out the gel, gently shake off the staining solution attached to the surface of the gel, and rinse with 1L dH2O (about 40-60 seconds).

[0120] D. Remove the gel, gently shake dry, and develop in developer (0.5L dH2O, 9.5g NaOH, 1mL formaldehyde) until satisfactory results are achieved.

[0121] E. After development is completed, place the gel in a rinse basin and soak it briefly to remove the developer on the surface.

[0122] F. Take out the gel, read the band and take pictures on a dedicated light box.

[0123] The experimental results showed that the InDel marker C06-25 was related to the flowering time of Brassica napus.

[0124] Through sequencing, it was found that the amplified fragment of the InDel marker C06-25 sequence of the early flowering line was 141 bp in length (the fragment was named C06-25a), and the sequence was shown in SEQ ID NO: 3:

[0125] CGTCGCTACTTGGTACTCGGTTTATACTCGTCAATCTGACTCGTGCTCAGTTTA AAAAATTAAGTATTTGACATTGTCAAGTCAAATAACAATTGATAAGTATCATTGTTT TTTCTTCTACTTGACTCGTTAACATCCGGT.

[0126] The amplified fragment of the InDel marker C06-25 sequence of the late-flowering strain is 174 bp in length (the fragment is named C06-25b), and the sequence is shown in SEQ ID NO: 4:

[0127] CGTCGCTACTTGGTACTCGGTTTATACTCGTCAATCTGACTCGTGCTCAGTTTAAAAAATTAAGTATTTGACATTGTCAAGTCAAATAACAATTGATAAATTTTATTAATTGTAAGCACGAATCAAGTATAAGTATCATTGTTTTTTCTTCTACTTGACTCGTTAACATCCGGT.

[0128] Therefore, in order to verify the application of the marker, the present invention used InDel marker C06-25 to analyze the flowering time of six replicates of the 158A-SGDH population at the cqDTF-C06 gene locus. After testing a total of 178 materials in the 158A-SGDH population, variance analysis was performed by combining the marker genotype with the flowering period phenotype of six replicates over three years. The results are as follows: Fig. 9 As shown, the difference in flowering time between the strain carrying the 174bp fragment of the InDel marker C06-25b band and the strain carrying the 141bp fragment of the InDel marker C06-25a band reached a significant level. The strain carrying the 174bp fragment of the InDel marker was a later flowering strain, and the strain carrying the 141bp fragment of the InDel marker was an earlier flowering strain.

[0129] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a primer set for amplifying molecular markers in assisting the screening of Brassica napus varieties with different flowering times, characterized in that: The nucleotide sequences of the molecular markers are shown in SEQ ID NO: 3 and SEQ ID NO: 4; the primer set is the sequence shown in SEQ ID NO: 1-2; when the target gene carries the sequence shown in SEQ ID NO: 3, it is an early-flowering Brassica napus variety; when the target gene carries the sequence shown in SEQ ID NO: 4, it is a late-flowering Brassica napus variety.

2. A method for screening Brassica napus varieties with different flowering times, characterized in that: The following steps are involved: The genome of the Brassica napus sample to be tested is used as a template, the target gene is amplified using the primer set shown in SEQ ID NO: 1-2, the correlation between the target gene and the flowering time of Brassica napus is analyzed, and Brassica napus varieties with different flowering times are screened; When the target gene carries the sequence shown in SEQ ID NO: 3, the sample to be tested is an early-flowering Brassica napus variety; when the target gene carries the sequence shown in SEQ ID NO: 4, the sample to be tested is a late-flowering Brassica napus variety.

3. The method according to claim 2, characterized in that The PCR amplification system included: 2 μL DNA template, 5 μL 2×Taq PCR Mix, 1 μL upstream and downstream primers, and 2 μL ddH2O; The PCR amplification program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 45 s, for a total of 35 cycles; and extension at 72°C for 10 min.

Images