Application of plum PsERF1B protein and its encoding gene in regulating anthocyanin synthesis in plants

Abstract

The present invention discloses the application of plum PsERF1B protein and its encoding gene in regulating the synthesis of plant anthocyanins. The present invention belongs to the field of biotechnology, and in particular, relates to the application of plum PsERF1B protein and its encoding gene in regulating the synthesis of plant anthocyanins. The protein PsERF1B of the present invention is any of the following proteins: A1) a protein with an amino acid sequence as shown in SEQ ID No.2; A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having more than 80% identity with the protein shown in A1) and having the function of regulating the synthesis of plant anthocyanins; A3) a fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2). The protein PsERF1B can be used to regulate the synthesis of plant anthocyanins, providing a new research strategy for plant variety screening and breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of plum PsERF1B protein and its encoding gene in regulating plant anthocyanin synthesis. Background Art

[0002] Plum is a plant of the genus Prunus in the Rosaceae family, widely distributed all over the world. It is one of the important traditional fruit trees in my country. my country's plum cultivation area and output are both ranked first in the world. Plum fruit is rich in bioactive substances such as carotenoids, vitamins and anthocyanins, and is deeply loved by consumers. Anthocyanins are important bioactive substances, which not only give the fruit a bright color, increase the ornamental value, but also increase the nutrition of the fruit, and are regarded as an important indicator of fruit quality and functional activity. At the same time, the intake of anthocyanins is beneficial to the prevention of human cardiovascular diseases, etc., and promotes human health. The main anthocyanin component of plum pulp is cyanidin 3-O-glucoside, and there is also a trace of cyanidin-3-rutinoside (Wang et al. Compositional modifications of bioactive compounds and changes in the edible quality and antioxidant activity of'Friar'plum fruit during flesh reddening at intermediate temperatures. Food Chemistry, 2018, 254: 26-35). Plum fruit with black or purple peel and yellow flesh turns red after low temperature storage after harvesting. The red change of plum flesh during cold storage is due to the accumulation of high content of anthocyanins. Since anthocyanins are important biologically active functional substances, the red change of flesh is considered to be beneficial to improve the biological activity of plum fruit. Changing the yellow flesh of post-harvest plum fruit to red flesh through low-temperature storage treatment is not only simple and efficient, but also easy to operate.

[0003] The plant anthocyanin biosynthesis pathway is a branch of the flavonoid biosynthesis pathway and is currently a relatively well-studied secondary metabolic pathway. Anthocyanin synthesis is regulated by the MBW complex formed by the transcription factor MYB, basic helix-loop-helix (bHLH) and WD40 repeat protein, and binds to the cis-acting elements of the promoters of the structural genes of the anthocyanin biosynthesis pathway to activate the transcription of these structural genes. In addition to the MBW complex, there are other transcription factors or regulatory proteins involved in the synthesis of anthocyanins. The MYB gene may only be a specific "executor" involved in the regulation of anthocyanin synthesis in the flesh, but it is not the root cause of trait diversity. This study identified key genes, which provide a basis for postharvest regulation of the synthesis of functional active ingredients anthocyanins and provide a reference for the breeding of varieties rich in anthocyanin active functional ingredients. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the synthesis of plant anthocyanins.

[0005] In order to solve the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by the present invention may be any of the following proteins:

[0007] A1) a protein with an amino acid sequence as shown in SEQ ID No. 2;

[0008] A2) a protein having more than 80% identity with the protein shown in A1) and having the function of regulating plant anthocyanin synthesis obtained by replacing and / or deleting and / or adding amino acid residues of the protein shown in A1); for example, a person skilled in the art can obtain a protein mutant having the same function as the amino acid sequence shown in SEQ ID No. 2 by replacing, deleting and / or adding one or more amino acids without affecting its activity according to the amino acid sequence shown in SEQ ID No. 2 and conventional technical means in the art such as conservative substitution of amino acids;

[0009] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1) above is named PsERF1B.

[0011] In order to facilitate purification or detection of the protein in A1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0012] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0014] Those skilled in the art can easily mutate the nucleotide sequence encoding the protein PsERF1B of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein PsERF1B isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein PsERF1B and have the function of the protein PsERF1B.

[0015] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0016] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching for the identity of a pair of amino acid sequences for calculation, the value (%) of identity can then be obtained.

[0017] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0018] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0019] In the above, the protein is derived from plum (Prunus salicina Lindl.).

[0020] In the above, the regulation may be regulating the anthocyanin synthesis of plants by regulating the expression level of PsMYB10.1, or / and the expression level of PsbHLH3, or / and the expression level of anthocyanin synthesis structural genes.

[0021] Furthermore, the anthocyanin synthesis structural gene may specifically be F3'H, ANS, DFR, or / and UFGT.

[0022] The present invention also provides a biological material related to the above protein, and the biological material may be any one of the following:

[0023] B1) a nucleic acid molecule encoding the protein described above;

[0024] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0025] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0026] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0027] B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2);

[0028] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0029] B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).

[0030] In the above biological material, the nucleic acid molecule described in B1) is the gene shown in E1) or E2) below:

[0031] E1) the coding sequence of the coding strand is a cDNA molecule or a DNA molecule of SEQ ID No. 1;

[0032] E2) The nucleotide sequence of the coding strand is a cDNA molecule or a DNA molecule of SEQ ID No. 1.

[0033] The DNA molecule shown in SEQ ID No.1 (PsERF1B gene regulating anthocyanin synthesis in plants) encodes a protein PsERF1B having an amino acid sequence of SEQ ID No.2.

[0034] The nucleotide sequence shown in SEQ ID NO.2 is the nucleotide sequence of the gene (CDS) encoding protein PsERF1B.

[0035] The PsERF1B gene of the present invention can be any nucleotide sequence that can encode protein PsERF1B. Considering the degeneracy of codons and the preference of codons of different species, those skilled in the art can use codons suitable for expression of a specific species as needed.

[0036] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID No. 1.

[0037] B1) The nucleic acid molecule may also include a nucleic acid molecule having a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 1 and originating from the same species.

[0038] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0039] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmids, phages (such as lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), Ti plasmids or viral vectors. Specifically, the vector may be pSAK277.

[0040] The existing plant expression vector can be used to construct a recombinant expression vector containing the PsERF1B gene. The plant expression vector includes, but is not limited to, binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment. The plant expression vector may also contain the 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as, but not limited to, Agrobacterium crown gall induction (Ti) plasmid genes (such as rouge synthase Nos gene), plant genes (such as soybean storage protein gene) 3' end transcription non-translated regions have similar functions.

[0041] When using the PsERF1B gene to construct a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the ubiquitin promoter of corn. They can be used alone or in combination with other plant promoters. In addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0042] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0043] By using any vector that can guide the expression of foreign genes in plants, the PsERF1B gene or gene fragment provided by the present invention is introduced into plant cells or recipient plants, and transgenic cell lines and transgenic plants with altered plant anthocyanin synthesis ability can be obtained. The expression vector carrying the PsERF1B gene can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants.

[0044] As a specific embodiment, the above-mentioned recombinant vector is a recombinant vector pSAK277-PsERF1B. The recombinant vector pSAK277-PsERF1B is a recombinant plasmid obtained by replacing the fragment (small fragment) between the recognition sites of restriction endonucleases EcoRⅠ and HindIII of the pSAK277 vector with the DNA fragment whose nucleotide sequence is shown in sequence 1 in the sequence table, while keeping the other sequences of the pSAK277 vector unchanged.

[0045] The recombinant vector pSAK277-PsERF1B expresses the PsERF1B protein shown in SEQ ID No. 2 in the sequence table.

[0046] The recombinant microorganism may specifically be recombinant Agrobacterium GV3101-PsERF1B.

[0047] The recombinant Agrobacterium GV3101-PsERF1B is a recombinant bacterium obtained by introducing the recombinant vector pSAK277-PsERF1B into Agrobacterium tumefaciens GV3101.

[0048] The microorganism described herein may be yeast, bacteria, algae or fungi. Among them, the bacteria may be from Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc. Specifically, it may be Agrobacterium tumefaciens GV3101.

[0049] The present invention also provides the use of the protein PsERF1B or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in any of the following:

[0050] U1) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in regulating the synthesis of anthocyanins in plants;

[0051] U2) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in the preparation of a product regulating the synthesis of anthocyanins in plants;

[0052] U3) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in cultivating plants with altered anthocyanin synthesis ability;

[0053] U4) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in the preparation of products for cultivating plants with altered anthocyanin synthesis ability;

[0054] U5) Use of the protein or the substance regulating gene expression or the substance regulating the activity or content of the protein in plant breeding.

[0055] Herein, the substance that regulates the activity and / or content of the protein may be a substance that regulates the expression of a gene encoding the protein PsERF1B.

[0056] Herein, the plant anthocyanin content may be the anthocyanin content of leaves.

[0057] In the above application, the substance regulating gene expression or the substance regulating the activity or content of the protein is a biological material related to the protein, and the biological material can be any one of the following B1) to B7):

[0058] B1) a nucleic acid molecule encoding the protein described above;

[0059] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0060] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0061] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0062] B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2);

[0063] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0064] B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).

[0065] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0066] The present invention also provides a method for regulating plant anthocyanin synthesis, comprising regulating the activity and / or content of the above-mentioned protein in the target plant, or / and the expression level of the gene encoding the protein, to regulate the plant's anthocyanin synthesis ability.

[0067] In the above method, regulating the activity and / or content of the protein PsERF1B in the target plant, or / and the expression level of the gene encoding the protein includes introducing the gene PsERF1B encoding the protein into the recipient plant to obtain the target plant with altered anthocyanin synthesis; the PsERF1B encoding gene encodes the protein PsERF1B.

[0068] The introduction refers to introduction by recombinant means, including but not limited to Agrobacterium-mediated transformation, biolistic methods, electroporation, in planta technology, and the like.

[0069] In the above-mentioned applications and methods, the regulation may be increasing, enhancing or up-regulating.

[0070] In the above-mentioned uses and methods, the regulation may be inhibition, reduction or silencing.

[0071] In order to facilitate the identification and screening of transgenic cells or plants, the recombinant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color reactions, antibiotic markers with resistance, or chemical reagent resistance marker genes. It is also possible to directly screen the transformed plants by adversity without adding any selective marker genes. The plants obtained by the above method can be transgenic plants, or they can be plants obtained by conventional breeding techniques such as hybridization. In the above method, the transgenic plants are understood to include not only the first to second generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The transgenic plants include seeds, callus tissues, complete plants and cells.

[0072] The present invention also provides a method for cultivating plants with altered anthocyanin synthesis ability, comprising: 1) increasing, enhancing and / or up-regulating the expression amount of the gene encoding the protein mentioned above in the target plant, or / and increasing, enhancing and / or up-regulating the activity and / or content of the gene encoding the protein mentioned above, to obtain plants with improved anthocyanin synthesis ability;

[0073] 2) Inhibiting, reducing or silencing the expression level of the gene encoding the protein mentioned above in the target plant, or / and inhibiting, reducing or silencing the activity and / or content of the gene encoding the protein mentioned above, to obtain a plant with reduced anthocyanin synthesis ability.

[0074] As an embodiment of the present invention, the method for cultivating a plant with altered anthocyanin synthesis ability comprises the following steps:

[0075] (1) constructing an expression vector containing the PsERF1B gene coding sequence as shown in SEQ ID NO.1;

[0076] (2) introducing the expression vector constructed in step (1) into the plant;

[0077] (3) Plants with altered anthocyanin biosynthesis capabilities were obtained through screening and identification.

[0078] The present invention also provides a method for cultivating plants with improved anthocyanin synthesis ability, comprising the following steps: increasing the content of PsERF1B protein in the plants to obtain plants with improved anthocyanin synthesis ability.

[0079] In the present invention, the purpose of plant breeding includes cultivating plants with altered anthocyanin synthesis ability.

[0080] The plant anthocyanin content may be the anthocyanin content of leaves.

[0081] The plant may be a dicotyledonous plant.

[0082] In the above application or method, the plant is any one of the following:

[0083] C1) dicotyledonous plants;

[0084] C2) Tubular flowers;

[0085] C3) Solanaceae;

[0086] C4) Nicotiana plants;

[0087] C5) Tobacco;

[0088] D2) Plants of the order Rosales;

[0089] D3) Rosaceae plants;

[0090] D4) Prunus;

[0091] D5) Black sapphire plum.

[0092] The present invention obtains an upstream gene that promotes anthocyanin synthesis, which is different from the MYB transcription factor series genes found in previous studies. The present invention transfers PsERF1B into tobacco through transient overexpression, synthesizes anthocyanins in tobacco by regulating metabolic pathways, and increases the anthocyanin content by 1.36 times compared with the group without PsERF1B. The gene of the present invention can also be applied to the genetic engineering improvement of other plants, and has important application value for regulating the anthocyanin content in plant tissues. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1Phylogenetic tree of PsERF1B and AP2 / EREBP genes of other species.

[0094] Figure 2 This is an amino acid sequence alignment of PsERF1B and AP2 / EREBP genes from other species.

[0095] Figure 3 The results of transient expression in tobacco leaves show that the co-expression of PsERF1B, PsMYB10.1 and PsbHLH3 can promote the synthesis and accumulation of anthocyanins. A is the phenotype of tobacco leaves; B is the ratio of a* / b* after transient expression in tobacco leaves; C is the content of anthocyanins in tobacco leaves after transient expression; D is the effect of transient expression on PsERF1B expression revealed by real-time fluorescence quantitative PCR; E is the effect of transient expression on PsMYB10.1 expression revealed by real-time fluorescence quantitative PCR; F is the effect of transient expression on PsbHLH3 expression revealed by real-time fluorescence quantitative PCR; G is the effect of transient expression on the expression of anthocyanin synthesis structural genes revealed by real-time fluorescence quantitative PCR.

[0096] Figure 4 The growth of yeast containing pGBKT7-PsMYB10.1 and pGADT7 in SD / –Leu–Trp–His–Ade medium supplemented with different concentrations of aureobasidin.

[0097] Figure 5 Schematic diagram of the results of the yeast two-hybrid and firefly luciferase complementation systems, demonstrating that PsERF1B and PsMYB10.1 interact in vivo. DETAILED DESCRIPTION

[0098] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0099] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0100] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0101] The black gem plum variety of the present invention was purchased from Demin Farm in Haidian District, Beijing.

[0102] The pSAK277 vector in the present invention was donated by the New Zealand Plant and Food Research Institute and Wu Jun's research group, and has been recorded in: Yao et al. Map-based cloning of the pear gene MYB114 identifies an interaction with other transcription factors to coordinately regulate fruit anthocyanin biosynthesis. The Plant Journal, 2017, 92, 437-451. The public can obtain it from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0103] The pGBKT7 vector in the present invention was kindly donated by Ren Huazhong's research group and has been recorded in: Yin Shuai. Molecular mechanism of cucumber CsPLE and CsYABBYs regulating fruit development. China Agricultural University Ph.D. dissertation, 2022. The public can obtain it from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0104] The pGADT7 vector in the present invention was kindly donated by Ren Huazhong's research group and has been recorded in: Yin Shuai. Molecular mechanism of cucumber CsPLE and CsYABBYs regulating fruit development. China Agricultural University Doctoral Dissertation, 2022. The public can obtain it from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0105] The pCambia1300-cLUC vector in the present invention was kindly donated by Ren Huazhong's research group and has been recorded in: Yin Shuai. Molecular mechanism of cucumber CsPLE and CsYABBYs regulating fruit development. Doctoral dissertation of China Agricultural University, 2022. The public can obtain it from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0106] The cGUS Agrobacterium in the present invention was kindly donated by Zhu Hongliang's research group and has been recorded in: Zeng Ni. Study on the function of SlSGR1 gene in the development and ripening of tomato fruit. Master's thesis of China Agricultural University, 2020. The public can obtain it from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0107] The nGUS Agrobacterium in the present invention was kindly donated by Zhu Hongliang's research group and has been recorded in: Zeng Ni. Study on the function of SlSGR1 gene in the development and maturation of tomato fruit. Master's thesis of China Agricultural University, 2020. The public can obtain it from China Agricultural University. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. The seeds of Nicotiana benthamiana (N. benthamiana) used in the luciferase complementation experiment in the present invention were kindly donated by Qu Guiqin's research group and have been recorded in: Zhou et al. Phytohormone ethylene mediates oligogalacturonic acid-induced growth inhibition in tomato etiolated seedlings. Plant Science, 2023, 330, 111643. The public can obtain it from China Agricultural University. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0108] The N. tabacum seeds used for transient overexpression experiments in the present invention were kindly donated by Wu Jun's research group and have been recorded in: Yao et al. Map-based cloning of the pear gene MYB114 identifies an interaction with other transcription factors to coordinately regulate fruit anthocyanin biosynthesis. The Plant Journal, 2017, 92, 437-451. The public can obtain them from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0109] The Y2HGold yeast strain in the present invention was purchased from Shanghai Weidi Biotechnology Co., Ltd. with the product number YC1002.

[0110] The GV1301 strain in the present invention was purchased from Shanghai Weidi Biotechnology Co., Ltd. with the product number AC1001.

[0111] Example 1. Obtaining PsERF1B protein and its encoding gene

[0112] 1. Cloning of the gene encoding PsERF1B

[0113] The pulp of black jewel plum that turned red during low temperature storage was used as the material. RNA was extracted using RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (spin column type) (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA synthesis was performed using Transcript One-step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing Quanshijin Biotechnology Co., Ltd.). PCR amplification was performed using the specific primer pair PsERF1B-F: ATGGAGATGGAATCTGCT and PsERF1B-R: CTAATAGCTTTGTTCC to obtain the PsERF1B coding region (CDS) sequence. The PCR reaction system was 25 μL, and the components included: PrimeSTAR Max Premix (2X) 12.5 μL, upstream and downstream primers (10 μmmol / L) 1 μL each, cDNA 2 μL, and H2O 8.5 μL. The PCR program was: 98°C pre-denaturation for 3 min, 35 cycles of 98°C for 10 s, 55°C for 15 s and 72°C for 30 s, 72°C for 5 min. The amplified product (i.e., the coding region of the PsERF1B gene) was obtained. The coding sequence of the PsERF1B gene in plum varieties is shown in the nucleotide sequence of SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0114] 2. Phylogenetic tree and amino acid sequence analysis of PsERF1B

[0115] The amino acid sequence of PsERF1B was aligned with the amino acid sequences of AP2 / EREBP from other species using DNAMAN (v6.0, Lynnon Biosoft, USA). A phylogenetic tree was constructed using the neighbor-joining method using MEGA software (v6.0) (Kumar S et al. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6): 1547–1549.). The NCBI accession numbers of the related genes involved are PmERF1B (XP_008235690.1), PpERF1B (XP_007200770.2), PdERFC3 (XP_034228340.1), PaERF1B (XP_021814829.1), PyERF1B (PQQ17832.1), MsERFC3 (XP_050107909.1), MdERF1B (X P_008349063.1), PbERFC3 (XP_009369492.2), PuERF1B (KAB2602276.1), RhERF92 (AYW51734.1), F vERF1B(XP_004289932.1), FaERF85(AZL19487.1), QsERF1B(XP_023906372.1), MrERF1B(KAB12143 94.1), AtRAP2.2 (AT3G14230), AtRAP2.12 (At1G53910), AtERF3 (NM_103946.3), AtERF7 (NM_11292 2.3), AtERF3(NM_103946.3), AtERF7(NM_112922.3), AtERF11(NM_102603.3), AtERF4(NM_112384. 2), AtERF8(NM_104196.3), AtABR1(AT5G64750), AtRAP2.1(BT024691.1), AtRAP2.10(AT4G36900) , AtRAV1(AB013886.1), AtRAV2(AB013887.1), AtRAP2.7(NM_001202696.2), AtAP2(NM_119856.3).

[0116] The results are as follows: Phylogenetic analysis showed that PsERF1B belongs to subgroup IX ( Figure 1), and the closest relative to PsERF1B is Prunus mume PmERF1B. Amino acid sequence alignment showed that PsERF1B contains an AP2 motif, which is a hallmark of the ERF transcription factor family ( Figure 2 ).

[0117] Example 2: Preparation of recombinant plasmid and recombinant genetically engineered bacteria containing PsERF1B gene

[0118] Using specific primer pair: ACTAGTGGATCCAAA GAATTC ATGGAGATGGAATCTGCT (the underlined part is the EcoRⅠ restriction site) and AGAAGTACTCTCGAG AAGCTT CTAATAGCTTTGTTCC (the underlined part is the HindIII restriction site), the product obtained in Example 1 was used as a template for PCR reaction, the PCR reaction system was 25 μL, and the components included: PrimeSTARMax Premix (2X) 12.5 μL, upstream and downstream primers (10 μmmol / L) 1 μL each, cDNA 2 μL, H2O 8.5 μL. The PCR program was: 98°C pre-denaturation for 3 min, 35 cycles of 98°C for 10 s, 55°C for 15 s and 72°C for 30 s, 72°C for 5 min.

[0119] After the PCR product was recovered, the target fragment was connected to the pSAK277 vector digested with EcoRI and HindIII using the Aidlab One Step Seamless Cloning kit, and the recombinant plasmid pSAK277-PsERF1B containing the PsERF1B gene was obtained after sequencing verification. The positive plasmid was then introduced into the Agrobacterium strain GV3101 to obtain the recombinant genetic engineering bacteria containing the PsERF1B gene, that is, the Agrobacterium strain GV3101-PsERF1B containing the overexpression vector pSAK277-PsERF1B.

[0120] Example 3: Cloning of the PsMYB10.1 gene of plum and construction of a recombinant Agrobacterium strain overexpressing PsMYB10.1

[0121] RNA extraction and cDNA synthesis were performed using the flesh of black gem plums that had turned red during low-temperature storage. The specific primer pair PsMYB10.1-F: ATGGAGGGCTCTAACTTGG and PsMYB10.1-R: TTAATGATTCCAAAAGTCCACG were used to amplify the coding region of PsMYB10.1. The PCR reaction system was 25 μL, and the components included: PrimeSTAR MaxPremix (2X) 12.5 μL, 1 μL of each upstream and downstream primer (10 μmmol / L), 2 μL of cDNA, and 8.5 μL of H2O. The PCR program was: 98℃ pre-denaturation for 3 min, 35 cycles of 98℃ for 10 s, 55℃ for 15 s and 72℃ for 30 s, and 72℃ for 5 min. The amplified product (i.e., the coding region of the PsMYB10.1 gene) was obtained. The coding sequence of the PsMYB10.1 gene in plum varieties is shown as the nucleotide sequence of SEQ ID NO.3, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.4.

[0122] The specific primer pair was ACTAGTGGATCCAAAGAATTCATGGAGGGCTCTAACTTGG (the underlined part is the EcoRⅠ restriction site) and AGAAGTACTCTCGAG AAGCTT TTAATGATTCCAAAAGTCCACG (the underlined part is the HindIII restriction site), the product obtained in Example 1 was used as a template for PCR reaction, the PCR reaction system was 25 μL, and the components included: PrimeSTAR Max Premix (2X) 12.5 μL, 1 μL of upstream and downstream primers (10 μmmol / L), 2 μL of cDNA, and 8.5 μL of H2O. The PCR program was: 98°C pre-denaturation for 3 min, 35 cycles of 98°C for 10 s, 55°C for 15 s and 72°C for 30 s, and 72°C for 5 min. After the obtained PCR product was recovered, the target fragment was connected to the pSAK277 vector digested with EcoRⅠ and HindIII using Aidlab One Step Seamless Cloning kit, and sequencing was performed to obtain the recombinant plasmid pSAK277-PsMYB10.1 containing the PsMYB10.1 gene. Then, the positive plasmid was introduced into the Agrobacterium strain GV3101 to obtain the recombinant genetic engineering bacteria containing the PsMYB10.1 gene, namely, the Agrobacterium strain GV3101-PsMYB10.1 containing the overexpression vector pSAK277-PsMYB10.1.

[0123] Example 4: Cloning of the PsbHLH3 gene of Plum and construction of a recombinant Agrobacterium strain overexpressing PsbHLH3

[0124] RNA extraction and cDNA synthesis were performed using the flesh of black gem plums that had turned red during low-temperature storage. The coding region sequence of PsbHLH3 was obtained by PCR amplification using the specific primer pair PsbHLH3-F: ATGGCTGCACCGCCAAGTA and PsbHLH3-R: TTATTTGATTTATTACCCTCTTCAC. The PCR reaction system was 25 μL, and the components included: PrimeSTAR MaxPremix (2X) 12.5 μL, 1 μL of each upstream and downstream primer (10 μmmol / L), 2 μL of cDNA, and 8.5 μL of H2O. The PCR program was: 98℃ pre-denaturation for 3 min, 35 cycles of 98℃ for 10 s, 55℃ for 15 s and 72℃ for 30 s, and 72℃ for 5 min. The amplified product (i.e., the coding region of the PsbHLH3 gene) was obtained. The coding sequence of the PsbHLH3 gene in plum varieties is shown as the nucleotide sequence of SEQ ID NO.5, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.6.

[0125] Using specific primer pair: ACTAGTGGATCCAAA GAATTC ATGGCTGCACCGCCAAGTA (the underlined part is the EcoRⅠ restriction site) and AGAAGTACTCTCGAG AAGCTT TTATTTGATTTATTACCCTCTTCAC (the underlined part is the HindIII restriction site), the product obtained in Example 1 was used as a template for PCR reaction, the PCR reaction system was 25 μL, and the components included: PrimeSTAR Max Premix (2X) 12.5 μL, 1 μL of upstream and downstream primers (10 μmmol / L), 2 μL of cDNA, and 8.5 μL of H2O. The PCR program was: 98°C pre-denaturation for 3 min, 35 cycles of 98°C for 10 s, 55°C for 15 s and 72°C for 30 s, and 72°C for 5 min. After the obtained PCR product was recovered, the target fragment was connected to the pSAK277 vector digested with EcoRI and HindIII using the Aidlab One Step Seamless Cloning kit, and the recombinant plasmid pSAK277-PsbHLH3 containing the PsbHLH3 gene was obtained. Then the positive plasmid was introduced into the Agrobacterium strain GV3101 to obtain the recombinant genetic engineering bacteria containing the PsbHLH3 gene, namely the Agrobacterium strain GV3101-PsbHLH3 containing the overexpression vector pSAK277-PsbHLH3.

[0126] Example 5: Verification of the function of PsERF1B in regulating anthocyanin synthesis

[0127] Tobacco leaves were selected to verify that PsERF1B interacts with specific transcription factors PsMYB10.1 and PsbHLH3 to regulate anthocyanin synthesis.

[0128] 1. The specific experimental steps are as follows: culture recombinant Agrobacterium GV3101-PsERF1B, GV3101-PsMYB10.1, GV3101-PsbHLH3 and GV3101-pSAK277, and resuspend the recombinant Agrobacterium GV3101-PsERF1B, GV3101-PsMYB10.1 and GV3101-PsbHLH3 in infection buffer (10 mmol / L MES, 10 mmol / L MgCl2, 100 μmol / L acetosyringone) to OD 600 is 0.5.

[0129] Set up experimental groups:

[0130] Group 1 infection solution: Mix equal volumes of Agrobacterium culture solutions containing pSAK277-PsMYB10.1, pSAK277-PsbHLH3 and pSAK277 empty vector and let stand in the dark at room temperature for 3 hours.

[0131] 2. Group 2 infection solution: Mix equal volumes of Agrobacterium culture solutions containing pSAK277-PsMYB10.1, pSAK277-PsbHLH3 and pSAK277-PsERF1B plasmids and let stand in the dark at room temperature for 3 hours.

[0132] Select large-leaf tobacco with good growth, and use different leaf veins as the dividing line to take 1 group of infection solutions of pSAK277-PsMYB10.1, pSAK277-PsbHLH3 and pSAK277 empty vector and inject them on the leaves with a needle-free syringe until the tobacco leaf part marked 1 is completely soaked; take 2 groups of infection solutions of pSAK277-PsMYB10.1, pSAK277-PsbHLH3 and pSAK277-PsERF1B plasmids and inject them on other leaves with a needle-free syringe until the entire tobacco leaf part marked 2 is completely soaked; after the tobacco is cultured under the conditions of 24h darkness, 23℃ and 70% relative humidity for 24h, it is transferred to the conditions of 16h:8h light and dark cycle, 23℃ and 70% relative humidity for 4 days.

[0133] The results are as follows Figure 3As shown in A, the tobacco leaves injected with Agrobacterium tumefaciens containing one group of infection solutions containing pSAK277-PsMYB10.1, pSAK277-PsbHLH3 and pSAK277 empty vector accumulated anthocyanins and turned light red, while the tobacco leaves injected with Agrobacterium tumefaciens containing two groups of infection solutions containing pSAK277-PsMYB10.1, pSAK277-PsbHLH3 and pSAK277-PsERF1B accumulated anthocyanins to purple-red.

[0134] 2. Determination of color difference of tobacco leaves

[0135] The color difference of overexpressed tobacco leaves was measured using a colorimeter and a was calculated. * / b * The statistical material experiment was repeated 3 times, that is, there were 3 leaf replicates, each leaf contained 3 control groups, 5 experimental groups had 8 regions, and each group measured 3 regions of 3 leaves, a total of 9 replicates.

[0136] The results are as follows Figure 3 As shown in B: the a* / b* ratio of tobacco leaves transformed with no pSAK277, PsMYB10.1 and PsbHLH3 was only -0.1, while the a* / b* ratio of tobacco leaves transformed with PsERF1B, PsMYB10.1 and PsbHLH3 increased significantly to 0.32. PsERF1B promoted the reddening of tobacco leaves.

[0137] 3. Determination of anthocyanin content in tobacco leaves

[0138] The anthocyanin content of tobacco leaves was measured using the pH differential method. 0.8 g of leaf tissue was homogenized with 4.0 mL of 0.1% (v / v) HCl-methanol solution and extracted by ultrasound in an ice bath for 15 min. The homogenate was centrifuged at 12,000×g for 15 min at 4°C.

[0139] Prepare pH 1.0 and 0.025 mol L -1 Potassium chloride buffer, pH 4.5, 0.4 mol L -1 0.5 mL of sample extract was added to two test tubes, and 0.5 mL of pH 1.0 and pH 4.5 solutions were added to the two test tubes respectively. The samples were allowed to stand at room temperature for 15 min. 0.1% (v / v) HCl-methanol solution was used as a blank. The absorbance values ​​of the solutions in the two test tubes at 520 nm and 700 nm were measured respectively. The measurement was repeated three times. The content of anthocyanin was calculated according to the following formula.

[0140] Anthocyanin content (mg g -1 FW)=A×M×DF×V / w / ε / L

[0141] Where A is the absorbance value (A520 -A 700 ) pH1.0 -(A 520 -A 700 ) pH4.5 ; L is the optical path, 1 cm; ε is the extinction coefficient of cyanidin 3-O-glucoside, 26900; M is the molecular weight of cyanidin 3-glucoside, 449.2; DF is the dilution factor; V is the final volume, mL; W is the sample mass, g. Statistics Materials The experiment had 3 leaf replicates, each leaf contained 3 control groups and 5 experimental groups. All control group areas (i.e., 3 leaves * 3 areas) were sampled and mixed and divided into 3 groups as 3 biological replicates. All experimental group areas (i.e., 3 leaves * 5 areas) were sampled and mixed and divided into 3 groups as 3 biological replicates. Each biological replicate was measured once.

[0142] The results are as follows Figure 3 As shown in C: The anthocyanin content of tobacco leaves transformed with pSAK277 empty vector and PsMYB10.1 and PsbHLH3 was 286 mg kg -1 The anthocyanin content of tobacco leaves co-transformed with PsERF1B, PsMYB10.1 and PsbHLH3 was 675 mg / kg -1 , an increase of 1.36 times. PsERF1B promoted the accumulation of anthocyanins in tobacco leaves.

[0143] 4. Real-time fluorescence quantitative PCR detection of relative content of gene transcripts

[0144] About 0.1 g of sample (tobacco leaves) was ground with liquid nitrogen for RNA extraction. RNA was extracted using a plant RNA mini-extraction kit from Omega, USA. The quality of RNA was tested using a 1.2% agarose gel. RNA concentration was tested using a micro-spectrophotometer Bio-Rad Nano-300. The first-strand cDNA was synthesized using a one-step Transcript One-step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing Quanshijin Biotechnology Co., Ltd.).

[0145] The real-time fluorescence quantitative PCR system was 20 μl, containing about 100 ng of cDNA, 0.2 μmol of each primer and 10 μl of 2×TS Reaction Mix (Beijing Quanshijin). The amplification procedure was as follows: 95°C for 3 minutes of pre-denaturation, followed by 40 cycles of amplification (95°C for 10 seconds, 60°C for 30 seconds). Each amplification well was repeated three times. The tobacco gene UBC2 was used as an internal reference. The expression level was quantified using the standard curve method. There were 3 leaf replicates, each leaf contained 3 control groups and 5 experimental groups. All control group areas (i.e., 3 leaves * 3 areas) were sampled and mixed and divided into 3 groups as 3 biological replicates. All experimental group areas (i.e., 3 leaves * 5 areas) were sampled and mixed and divided into 3 groups as 3 biological replicates. Each biological replicate was measured 3 times.

[0146] Table 1 List of primers for real-time fluorescence quantitative PCR detection

[0147]

[0148]

[0149] The results are as follows Figure 3 As shown in DG, the relative expression of PsERF1B gene in tobacco leaves transformed with pSAK277 empty vector, PsMYB10.1 and PsbHLH3 was 0.12, the relative expression of PsMYB10.1 gene was 2.35, and the relative expression of PsbHLH3 gene was 2.27. The relative expression of PsERF1B gene in tobacco leaves transformed with PsERF1B, PsMYB10.1 and PsbHLH3 was 5.68, and the relative expression of PsMYB10.1 gene was 5.44, which were significantly higher than those in the control group. The relative expression of PsbHLH3 gene was 2.75, which was not significantly different from that in the control group. The relative expression of NtF3'H gene in tobacco leaves transformed with pSAK277 empty vector, PsMYB10.1 and PsbHLH3 was 0.01, NtDFR gene was 1.19, NtANS gene was 5.96, and NtUFGT gene was 0.42. The relative expression of NtDFR gene in tobacco leaves transformed with PsERF1B, PsMYB10.1 and PsbHLH3 was 2.56, and the relative expression of NtANS gene was 8.50, which were not significantly different from the control group. The relative expression of NtF3'H gene was 0.05, and the relative expression of NtUFGT gene was 0.81, which were significantly higher than those in the control group.

[0150] This indicates that PsERF1B activated PsMYB10.1 and upregulated the expression of anthocyanin structural genes F3'H and UFGT.

[0151] Example 6: Yeast two-hybrid verification of protein interaction between PsERF1B and PsMYB10.1

[0152] The full length of PsMYB10.1 gene was inserted into the pGBKT7 vector, and the full length of PsERF1B gene was inserted into the pGADT7 vector. The following four different combinations of recombinant plasmids were transformed into the Y2HGold yeast strain. The specific groups are as follows:

[0153] 1) Transformation of pGBKT7-PsMYB10.1 and pGADT7-PsERF1B recombinant plasmids

[0154] 2) Transformation of pGBKT7-PsMYB10.1 and empty vector pGADT7 recombinant plasmid

[0155] 3) Transformation of empty vector pGBKT7 and pGADT7-PsERF1B recombinant plasmid

[0156] 4) Empty vector pGBKT7 and pGADT7 recombinant plasmid transformation

[0157] Medium preparation method:

[0158] Preparation of SD / -Leu-Trp culture medium: weigh 26.7 g SD base (PM2030, Beijing Coolaibo Technology Co., Ltd.); 0.64 g Do supplement-Leu-Trp (Takara Bio USA, Inc. 630417); 20 g agar, add distilled water to 950 mL, then add appropriate amount of 0.1 mmol L-1 HCl to pH 6.5, finally add distilled water to 1 L, sterilize at 121°C for 20 min, pour into plates, and store at 4°C.

[0159] Preparation of SD / -Leu-Trp-His-Ade medium: weigh 26.7 g of SD base; 0.62 g of Do supplement-Ade-His-Leu-Trp (Takara Bio USA, Inc. 630428); 20 g of agar, add distilled water to 950 mL, then add appropriate amount of 0.1 mmol L-1 HCl to pH 6.5, finally add distilled water to 1 L, sterilize at 121°C for 20 min, pour into plates, and store at 4°C.

[0160] First, the Y2HGold yeast strain cells containing the above recombinant plasmid were cultured in SD / -Leu-Trp medium and then transferred to SD / -Leu-Trp-His-Ade medium. Since PsMYB10.1 has strong self-activation activity, different concentrations of aureobasidin (AbA) (CA2332, Beijing Coolaibo Technology Co., Ltd.) were added to SD / -Leu-Trp-His-Ade medium to inhibit the background expression of PsMYB10.1.

[0161] Add 200, 400, 600, 800 μg L -1 Different concentrations of gold basidin were added to SD / –Leu–Trp–His–Ade medium. A 2 mm Y2HGold yeast positive single clone containing pGBKT7-PsMYB10.1 and empty vector pGADT7 was picked, diluted with 2 mL of water, and 1 mL was taken to measure OD 600 , and the other part was diluted to OD 600 After 0.002, apply it to SD / –Leu–Trp–His–Ade culture medium with different concentrations, culture at 29°C for 48-96h, and take pictures and record.

[0162] like Figure 4 As shown in the experimental results, yeast -1 The aureobasidin-containing SD / –Leu–Trp–His–Ade medium grew vigorously and was found to be highly conserved in the presence of 400 μg L -1 The aureobasidin also grew on SD / –Leu–Trp–His–Ade medium, with only 600 μg L -1 and 800 μg L -1 Aurobacitin can completely inhibit the growth of yeast. Therefore, 600 μg L -1 Aureobasidin was added to SD / –Leu–Trp–His–Ade medium as an inhibitory concentration to conduct protein interaction verification experiments.

[0163] According to the results of the self-activation ability assay, Y2HGold yeast containing pGBKT7-PsMYB10.1 plus pGADT7-PsERF1B or pGBKT7-PsMYB10.1 plus the empty vector pGADT7 were spotted on SD / -Leu-Trp-His-Ade medium containing 600 ng / mL aureobasidin and SD / -Leu-Trp-His-Ade medium containing 600 ng / mL aureobasidin and X-α-gal, respectively, for protein interaction experiments.

[0164] The results are as follows Figure 5As shown in A: Only yeast cells carrying pGBKT7-PsMYB10.1 and pGADT7-PsERF1B can grow in SD / -Leu-Trp-His-Ade medium containing AbA. Yeast cells carrying pGBKT7-PsMYB10.1 and pGADT7 cannot grow. For further verification, the α-galactosidase colorimetric substrate X-α-Gal was added to the medium, and yeast cells carrying pGBKT7-PsMYB10.1 and pGADT7-PsERF1B grew normally in SD / -Leu-Trp-His-Ade medium containing X-α-Gal and AbA, and blue precipitate was produced. These observations indicate that PsERF1B can interact with PsMYB10.1.

[0165] Example 7: Luciferase complementation experiment verifies the interaction between PsERF1B and PsMYB10.1 proteins

[0166] The full-length PsERF1B gene of plum was inserted into the pCambia1300-cLUC vector to obtain PsERF1B-cLUC. The full-length PsMYB10.1 gene of plum with the stop codon removed was inserted into the pCambia1300-nLUC vector to obtain PsMYB10.1-nLUC. The obtained recombinant vectors PsERF1B-cluc and PsMYB10.1-nLUC were transformed into Agrobacterium strain GV3101 by freeze-thaw method. Agrobacterium containing PsMYB10.1-nLUC, PsERF1B-cLUC, pCambia1300-cLUC, pCambia1300-nLUC, nGUS and cGUS were incubated at 28°C for 2 days and resuspended to OD 100 with infection buffer (10 mmol / L MES, 10 mmol / L MgCl2, 100 μmol / L acetosyringone). 600 is 0.8.

[0167] Set up 5 groups, and mix the two infection solutions in a ratio of 1:1 in each group. The groups are as follows:

[0168] 1) pCambia1300-nLUC and pCambia1300-cLUC (nLUC+cLUC for short)

[0169] 2) pCambia1300-nLUC and PsERF1B-cLUC (abbreviated as nLUC+PsERF1B-cLUC)

[0170] 3) PsMYB10.1-nLUC and PsERF1B-cLUC

[0171] 4) PsMYB10.1-nLUC and pCambia1300-cLUC (PsMYB10.1-nLUC+cLUC for short)

[0172] 5) cGUS and nGUS

[0173] After standing in the dark for 3 hours, the mixed infection solution was infected into the leaves of this type of tobacco using a needleless syringe. Each piece of this type of tobacco was divided into 5 parts, and the infection range of each part was a circle with a diameter of 1 cm. After the tobacco was cultured for 24 hours under the conditions of 24 hours of darkness, 23°C and 70% relative humidity, it was transferred to the conditions of 16h:8h light and dark cycle, 23°C and 70% relative humidity for 1 day, and then the fluorescence imaging was observed.

[0174] The results are as follows Figure 5 As shown in B: 1) There is no fluorescence signal in the pCambia1300-nLUC and pCambia1300-cLUC groups

[0175] 2) There is no fluorescence signal in the pCambia1300-nLUC and PsERF1B-cLUC groups

[0176] 3) The PsMYB10.1-nLUC and PsERF1B-cLUC groups had stronger fluorescence signals, indicating that PsMYB10.1 and PsERF1B interacted with each other.

[0177] 4) PsMYB10.1-nLUC and pCambia1300-cLUC groups have no fluorescent signal

[0178] 5) cGUS and nGUS were used as positive control groups and had obvious fluorescence signals.

[0179] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A protein, wherein the amino acid sequence of the protein is as shown in SEQ ID No.

2.

2. The protein according to claim 1, characterized in that: The protein is derived from plum.

3. A biological material related to the protein according to claim 1 or 2, wherein the biological material is any one of the following: B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that: B1) The nucleic acid molecule is a DNA molecule whose coding sequence is SEQ ID No.

1.

5. Use of the protein according to claim 1 or 2 or the biomaterial according to claim 3 in any of the following: U1) Application in regulating the synthesis of anthocyanins in plants; U2) Application in the preparation of products for regulating the synthesis of plant anthocyanins; U3) Application in breeding plants with altered anthocyanin synthesis ability; U4) Use in the preparation of products for breeding plants with altered anthocyanin synthesis ability; U5) Application in plant breeding; The regulating plant anthocyanin synthesis is to promote plant anthocyanin synthesis; The anthocyanin synthesis ability is changed to promote the accumulation of anthocyanins; The plant breeding is to cultivate plant varieties with high anthocyanin accumulation; The plant is tobacco.

6. A method for regulating plant anthocyanin synthesis, characterized in that: The method comprises increasing the content of the protein described in claim 1 or 2 in the target plant, or the expression level of the gene encoding the protein described in claim 1 or 2, to promote the synthesis of tobacco anthocyanins; the plant is tobacco.

7. The method according to claim 6, characterized in that: The method of increasing the content of the protein described in claim 1 or 2 in the target plant, or the expression level of the gene encoding the protein described in claim 1 or 2, comprises introducing the gene encoding the protein into a recipient plant to obtain a target plant whose anthocyanin synthesis is higher than that of the recipient plant; the plant is tobacco.

8. A method for cultivating a plant with improved anthocyanin synthesis ability, comprising: The expression level of the gene encoding the protein of claim 1 in the target plant is increased, or the content of the gene encoding the protein of claim 1 is increased, so as to obtain a plant with increased anthocyanin synthesis; the plant is tobacco.

Images