A gene capable of improving plant cold and heat tolerance and its application

Abstract

The present invention belongs to the field of biological genetic engineering technology, and specifically discloses a gene that can improve plant cold resistance and heat resistance, the gene is DcHSP20-2, the nucleotide sequence is SEQ ID NO:1, and the amino acid sequence of the encoded protein is SEQ ID NO:2. The present invention also discloses the application of the gene in improving plant heat resistance and cold resistance. The present invention can simultaneously improve plant heat resistance and cold resistance by transforming a single gene DcHSP20-2, provides support in molecular biology principles for improving plant heat resistance and cold resistance by constructing transgenic plants, provides gene resources for plant resistance improvement, and has good application prospects in cultivating plants with excellent resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, and in particular relates to a gene capable of improving the cold and heat resistance of plants and its application. Background Art

[0002] Dendrobium catenatum Lindl. is a perennial herbaceous plant of the genus Dendrobium in the orchid family. It is a precious health food with anti-tumor and antioxidant effects, can remove free radicals in the body, and improve immunity. It grows mostly on cliffs and rock crevices in high mountains. The optimal growth temperature is 20-25℃. High and low temperatures severely limit its survival and growth. Based on the sensitivity of Dendrobium to temperature, identifying genes related to temperature stress in the genome of Dendrobium officinale and studying their functions is of great significance for improving the cold and heat tolerance of other plants. In addition, previous studies have mostly focused on improving the single resistance of plants with a single gene. There are no reports on improving the multiple resistance of plants by transforming a gene. Summary of the invention

[0003] The purpose of the present invention is to provide a gene and application that can improve the cold and heat resistance of plants, so as to solve the above technical problems.

[0004] One of the purposes of the present invention is to provide: a gene capable of improving the cold and heat tolerance of plants, the nucleotide sequence of which is SEQ ID NO: 1, and the amino acid sequence of the encoded protein is SEQ ID NO: 2.

[0005] The second object of the present invention is to provide: application of genes in improving heat resistance and cold resistance of plants, wherein the plant is Arabidopsis thaliana.

[0006] The beneficial effects of the present invention are:

[0007] The present invention cloned a gene from Dendrobium officinale and named it "DcHSP20-2", where HSP is a heat shock protein in plants that works under high or low temperature conditions. HSP20 is a gene family with a molecular weight of about 20kDa, HSP20-2 is a gene in this gene family, and Dc represents Dendrobium officinale.

[0008] The present invention cloned a gene DcHSP20-2 from Dendrobium officinale, and found that the gene was induced by temperature stress and could be significantly upregulated under both high and low temperature conditions by using real-time fluorescence quantitative technology. The present invention can simultaneously improve both heat resistance and cold resistance of plants by transforming a gene, providing molecular biological principle support for improving heat resistance and cold resistance of plants by constructing transgenic plants, and providing high-quality gene resources for improving plant resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is a graph showing the results of using electrophoresis to detect RNA in Dendrobium officinale. In the figure, 1-7 are RNA samples taken 0, 3, 6, 9, 12, 24, and 48 hours after the roots were treated with drought stress.

[0010] Figure 2 The results of agarose gel electrophoresis detection of the product DcHSP20-2 gene, M in the figure is DL2000 marker;

[0011] Figure 3 is the relative expression level of DcHSP20-2 gene under high temperature stress and low temperature stress.

[0012] Figure 4 A in the figure is a schematic diagram of DcHSP20-2 constructed into the plant expression vector pCAMBIA2300; in the figure, B is the DNA detection of transgenic Arabidopsis, the primers are DcHSP20-2 gene primers, WT is wild-type Arabidopsis (DcHSP20-2 gene was not detected), 1-15 are different transgenic strains, and M is DL2000 marker.

[0013] Figure 5 The figure shows the analysis of transgenic Arabidopsis thaliana under high temperature stress in a petri dish; in the figure, A shows the stress resistance phenotype analysis of Arabidopsis thaliana after sowing wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana seeds in 1 / 2MS medium, placing them at 45℃ for 2h, and growing them for 1 week; B shows the fresh weight of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana under normal conditions and high temperature treatment; C shows the root length of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana under normal conditions and high temperature treatment. WT: wild-type Arabidopsis thaliana, DcHSP20-2-2: transgenic Arabidopsis thaliana line 2, DcHSP20-2-13: transgenic Arabidopsis thaliana line 13.

[0014] Figure 6 The figure shows the resistance analysis of transgenic Arabidopsis in soil; in the figure, A shows the stress resistance phenotype analysis of wild-type Arabidopsis and transgenic Arabidopsis after 40 days of growth, normal conditions and 6 days of high temperature treatment; B shows the stress resistance phenotype analysis of wild-type Arabidopsis and transgenic Arabidopsis after 40 days of growth, normal conditions and 3 days of low temperature treatment. WT: wild-type Arabidopsis, DcHSP20-2-2: transgenic DcHSP20-2 Arabidopsis line 2, DcHSP20-2-13: transgenic DcHSP20-2 Arabidopsis line 13.

[0015] Figure 7The figure shows the analysis of transgenic Arabidopsis thaliana under low temperature stress in a petri dish; in the figure, A shows the stress resistance phenotype analysis of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana grown for one week after being treated with 4℃ low temperature for 10 days; B shows the fresh weight of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana under normal conditions and low temperature treatment; C shows the root length of wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana under normal conditions and low temperature treatment. WT: wild-type Arabidopsis thaliana, DcHSP20-2-2: transgenic DcHSP20-2 Arabidopsis line 2, DcHSP20-2-13: transgenic DcHSP20-2 Arabidopsis line 13. DETAILED DESCRIPTION

[0016] The following is further described in detail through specific implementation methods:

[0017] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. In order to make the objects, technical solutions and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0018] Experiment 1: Providing a gene that can improve plant tolerance to cold and heat

[0019] A gene capable of improving plant cold and heat tolerance, the nucleotide sequence of which is SEQ ID NO: 1, and the amino acid sequence of the encoded protein is SEQ ID NO: 2. Specifically, the gene DcHSP20-2 is cloned by the following steps:

[0020] S1. Extraction of total RNA from Dendrobium officinale;

[0021] The Dendrobium officinale used in this embodiment is selected from Guangnan, Yunnan, and the Dendrobium officinale tissue culture seedlings are used as experimental materials, the culture temperature is 25°C, and the light / darkness duration is 12h / 12h. After growing for 3 months, the tissue culture seedlings are placed at 42°C and 4°C (the optimum temperature for plant growth is generally between 20-30°C. When the temperature stress treatment is carried out, the general practice is to use 42°C for high temperature stress and 4°C for low temperature stress) for high temperature stress and low temperature stress, and the tissue culture seedlings with consistent growth and strong growth are selected for treatment. At 0, 3, 6, 9, 12, 24, and 48h after treatment, the roots and leaves of 5 tissue culture seedlings are randomly taken and mixed respectively, and then placed in liquid nitrogen for quick freezing and placed in a -80°C refrigerator for storage to obtain Dendrobium officinale sample roots and Dendrobium officinale sample leaves; untreated tissue culture seedlings are used as controls.

[0022] Those skilled in the art use point values ​​to process the experiments of high temperature stress and low temperature stress. Normally, the optimum temperature for plant growth is 20-30°C. If high temperature stress or low temperature stress is to be carried out, the general treatment temperature is 42 / 45°C for high temperature stress and 4°C for low temperature stress. For most plants, it is sufficient to observe their growth at 42°C and 4°C.

[0023] Total RNA extraction was performed using a plant total RNA extraction kit purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number DP432. The specific steps are as follows:

[0024] (1) Homogenization: 50-100 mg of root or leaf samples of Dendrobium officinale were taken and quickly ground into powder in liquid nitrogen, 500 μL of lysis buffer SL pre-added with β-mercaptoethanol was added, and the mixture was immediately vortexed and mixed; centrifuged at 12000 rpm for 2 min;

[0025] (2) Transfer the supernatant to the CS filter column, centrifuge at 12000 rpm for 2 min, and transfer the supernatant in the collection tube to a new RNase-Free centrifuge tube;

[0026] (3) Slowly add 0.4 times the volume of anhydrous ethanol, mix well, transfer the possible solution and precipitate into the adsorption column CR3, centrifuge at 12000 rpm for 2 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0027] (4) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 2 min, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube;

[0028] (5) Add 80 μL of dNase I working solution to the center of CR3 in the adsorption column and leave at room temperature for 15 min;

[0029] Prepare DNaseⅠ working solution: take 10μL DNaseⅠ storage solution into a new RNase-Free centrifuge tube, add 70μL RDD buffer, and mix gently;

[0030] (6) Add 350 μL of deproteinized solution RW1 to the center of adsorption column CR3, centrifuge at 12,000 rpm for 2 min, discard the waste liquid in the collection tube, and return the adsorption column CR3 to the collection tube;

[0031] (7) Add 500 μL of rinse solution RW2 to which anhydrous ethanol has been added in advance to the adsorption column CR3, centrifuge at 12,000 rpm for 2 min, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube;

[0032] (8) Repeat step (7) once;

[0033] (9) Centrifuge at 12000 rpm for 2 min, place the adsorption column CR3 in a new RNase-Free centrifuge tube, add 30-50 μL RNase-Free ddH2O in the center of the adsorption film, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min to obtain the total RNA solution of Dendrobium officinale.

[0034] S2, total RNA detection of Dendrobium officinale;

[0035] Taking the root of Dendrobium officinale as an example, the total RNA of the root of Dendrobium officinale was detected by electrophoresis. The test results are as follows: Figure 1 shown. Figure 1 This is the result of using electrophoresis to detect the root RNA of Dendrobium officinale samples. In the figure, 1-7 are RNA samples of 0, 3, 6, 9, 12, 24, and 48 hours after the roots were treated with drought stress;

[0036] S3, synthesize the first strand of cDNA;

[0037] Use TaKaRa's genomic DNA-removing reverse transcription kit to remove genomic DNA first, and then perform reverse transcription.

[0038] The genomic DNA-free reverse transcription kit was purchased from Takara Biotechnology (Dalian) Co., Ltd. with the catalog number RR047A.

[0039] (1) Genomic DNA removal reaction, the specific reaction system is shown in Table 1:

[0040] Table 1 Reaction system for genomic DNA removal reaction

[0041]

[0042] (2) Reverse transcription reaction:

[0043] Prepare the Master Mix on ice in advance, 10 μL per reaction:

[0044] Table 2 Reaction system of Master Mix

[0045] Reagents Usage 5×PrimeScript Buffer2 4μL Primer Script RT Enzyme Mix 1 1μL Primer(OligodT) 1μL <![CDATA[RNase FreeddH2O]]> 4μL

[0046] After the reaction in (1) is completed, add the pre-prepared mixed solution in (2) to the reaction solution in (1), totaling 20 μL system, and mix well; the reverse transcription conditions are: 42°C, 30 min; 85°C, 5 sec; after completion, cDNA is obtained.

[0047] The cDNA obtained by reverse transcription was used as a template to design the full-length primers of the DcHSP20-2 gene. The specific primer information is as follows:

[0048] F(SEQ ID NO:3): ATGTCCGACGCCTTATCCT;

[0049] R (SEQ ID NO:4): TCAGCCGGAAATCTCAATG.

[0050] The gene DcHSP20-2 was obtained by amplification using 2×TaqMaster Mix. After amplification, the product was detected by agarose gel electrophoresis. The specific results are as follows: Figure 2 2×TaqMaster Mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd., with the catalog number P112. Figure 2 This is the result of detecting the product DcHSP20-2 gene by agarose gel electrophoresis, where M is the DL2000 marker.

[0051] Experiment 2: Expression of DcHSP20-2 gene under high temperature stress and low temperature stress

[0052] (1) Based on Experiment 1, fluorescent quantitative primers for the DcHSP20-2 gene were designed. The specific information of the primers is as follows:

[0053] DcHSP20-2-qRT-F (SEQ ID NO:5): GCGAGAGAAGGCGGAGAAGA;

[0054] DcHSP20-2-qRT-R (SEQ ID NO: 6): GTAGAAAGGATAAACACGAGCAGG.

[0055] The internal standard gene is Actin gene, and the primers are:

[0056] F(SEQ ID NO:7): TTGTGTTGGATTCTGGTGATGTGTGT;

[0057] R (SEQ ID NO:8): TTTCCCGTTCTGCTGTTGTTGTGAA.

[0058] ChamQ TMUniversal SYBR qPCR Master Mix Kit (Code: 7E280C8) was run on Applied Biosystems QuantStudio 3 and 5 system (ThermoFisher Scientific, United States) instruments. The reaction system was as follows:

[0059] Table 3 Fluorescence quantitative PCR reaction system

[0060] Reagents Usage Final concentration SYBR Premix Ex Taq II (2×) 5μL 1× PCR Forward Primer (10 μmol / L) 0.2μL 0.2μmol / L PCR Reverse Primer (10 μmol / L) 0.2μL 0.2μmol / L ROX Referencedye(50×) 0.2μL 1× Template 4μL <![CDATA[ddH2O]]> 0.4μL Total 10μL

[0061] Real-time fluorescence quantitative PCR reaction conditions: 95°C pre-denaturation for 30 seconds, 94°C denaturation for 5 seconds, 60°C annealing and extension for 30 seconds, 45 cycles, read the fluorescence signal after the end: 95°C for 15 seconds, 60°C for 15 seconds, 95°C for 15 seconds, and perform melting curve analysis.

[0062] Calculate relative expression:

[0063] The relative expression of the target gene was calculated using the comparative CT method. The relative expression of the target gene = 2 -△△Ct , where ΔΔCt=(Ct 目的基因 -Ct 看家基因 ) 实验组 -(Ct 目的基因 -Ct 看家基因 ) 对照 The experimental results were repeated three times and the average value was taken for graphical analysis.

[0064] (2) Experimental results:

[0065] The relative expression of DcHSP20-2 gene under high temperature (42℃) stress and low temperature (4℃) stress was studied by real-time fluorescence quantitative PCR technology. It was found that DcHSP20-2 gene could be upregulated under both stresses. The specific experimental results are as follows: Figure 3 shown. Figure 3 is the relative expression level of DcHSP20-2 gene under high temperature stress and low temperature stress.

[0066] In this experiment, the method of extracting RNA from the roots and leaves of Dendrobium officinale samples was the same, and the results were also the same. The extraction was carried out separately from the roots and leaves of Dendrobium officinale samples in order to study the expression patterns of genes in the roots and leaves, that is, Figure 3 However, since the RNA extraction methods and experimental results in the roots and leaves of Dendrobium officinale were the same, Figure 1 The results presented in this article take the RNA in the roots of Dendrobium officinale samples as an example.

[0067] Experiment 3: Construction of a plant expression vector containing the gene DcHSP20-2 and transformation of Arabidopsis thaliana

[0068] (1) Constructing a plant expression vector containing the gene DcHSP20-2. The specific experimental steps are as follows:

[0069] Using cDNA as a template, the expression vector was used to construct primers to amplify the target gene. The specific information of the primers is as follows:

[0070] DcHSP20-2-2300-F BamHI (SEQ ID NO:9): CGGGATCCATGTCCGACGCCTATCCT;

[0071] DcHSP20-2-2300-R KpnI (SEQ ID NO: 10): CGGGTACCTCAGCCGGAAATCTCAATG.

[0072] To facilitate connection, the upstream and downstream primers of the gene were introduced with BamH I and Kpn I restriction sites, respectively. Amplification was performed using 2×TaqMaster Mix, and the amplified product was purified and double-digested, and then connected to the plant expression vector pCAMBIA2300 using T4dNA ligase (NewEngland Biolabs, M0202) to obtain the recombinant plasmid 2300-DcHSP20-2. 2×TaqMaster Mix was purchased from Nanjing Novogene Biotechnology Co., Ltd., with the catalog number P112.

[0073] Figure 4 A in the figure is a schematic diagram of DcHSP20-2 constructed into the plant expression vector pCAMBIA2300, and the gene DcHSP20-2 is connected between BamH I and Kpn I of the pCAMBIA2300 vector; in the figure, B is the DNA detection of transgenic Arabidopsis, the primers are DcHSP20-2 gene primers, WT is wild-type Arabidopsis (DcHSP20-2 gene was not detected), 1-15 are different transgenic strains, and M is DL2000 marker.

[0074] (2) The recombinant plasmid was transformed into Agrobacterium. The specific experimental steps are as follows:

[0075] ①Prepare Agrobacterium competent cells;

[0076] A. Streak Agrobacterium strain GV3101 on a YEP+Rif (25 μg / mL) plate and culture at 30°C for 48 h until plaques appear;

[0077] B. Pick a single colony with a sterile pipette tip and place it in 3mL YEP+Rif medium and culture at 30℃ for 48h.

[0078] C. Take the above bacterial solution and inoculate it into 50mL YEP+Rif medium at a 2% inoculum volume until the OD 600 =0.4-0.6;

[0079] D. 5000r / min, 4℃, centrifugation for 10min;

[0080] E. After removing the supernatant, repeat 4) once;

[0081] F. Wash the bacterial solution with 5 mL of pre-cooled 0.2 mol / L CaCl2 solution, centrifuge at 5000 rpm, 4°C for 10 min;

[0082] G. Repeat step F once and remove the supernatant thoroughly;

[0083] H. Dissolve the precipitate with 5 mL of a mixture of 0.02 mol / L CaCl2 solution and 40% glycerol to obtain Agrobacterium competent cells. Aliquot and store at -80°C for later use.

[0084] ② Transform Agrobacterium with recombinant plasmid;

[0085] A. Place the prepared GV3101 Agrobacterium competent cells on ice and add 5 μL of recombinant plasmid 2300-DcHSP20-2 in the clean bench;

[0086] B. Quickly freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and ice bath for 5 minutes;

[0087] C. Add 600 μL YEP medium and culture at 28°C with shaking for 3-4 hours;

[0088] D. Take 100 μL of the above bacterial solution and apply it on the solid medium of YEP+Rif (25 μg / mL)+Kana (100 μg / mL), and culture at 30℃ for 2-3 days;

[0089] E. Pick a single clone, identify it by PCR, expand the culture, and save the bacterial solution for subsequent transformation of Arabidopsis thaliana.

[0090] (3) Transform Arabidopsis thaliana. The specific experimental steps are as follows:

[0091] ① Transform Arabidopsis thaliana by vacuum infiltration;

[0092] A. Expand the above-preserved bacterial solution to 500 mL YEP+Rif+Kana medium and culture at 28°C until OD 600 =0.8-1.0;

[0093] B. Collect Agrobacterium cells, centrifuge at 6000r / min for 10min, and discard the supernatant;

[0094] C. Dissolve the Agrobacterium precipitate with vacuum infiltration solution and adjust the dissolved OD 600 The value is about 1.0; the vacuum permeate composition is: 2.2g / LMS powder (PhytoTechnology, M519, USA) + 5g / L sucrose (Shanghai Biotechnology Co., Ltd., A610498-0500) + 6-BA (1mg / mL) + 0.04% Silwet L-77 (Beijing Solebold Technology Co., Ltd., g8590) (v / v), pH=5.8 adjusted with sodium hydroxide, prepared with distilled water, and used immediately after preparation. 6-BA is 6-benzylaminopurine, and Silwet L-77 is an organic silicon surfactant.

[0095] D. Cut off the flowering inflorescence of Arabidopsis thaliana that has grown for about one month, immerse it in the infiltration solution, and vacuum pump for 15 minutes. The pressure generally does not exceed 0.085MPa.

[0096] E. Take out the Arabidopsis thaliana and place the flowerpot flat in a moisturizing, light-shielding container overnight;

[0097] F. Move Arabidopsis into a 21°C light incubator and culture under long-day conditions and 80% relative humidity.

[0098] ② Screening of resistant Arabidopsis seedlings;

[0099] A. Take 15-20 mg of Arabidopsis T1 seeds in a sterile 1.5 mL centrifuge tube;

[0100] B. Sterilize with 70% alcohol for 3 minutes (mix by oscillation during this period), centrifuge at 10,000 rpm for 1 minute, remove the supernatant, and wash with sterile water 3-4 times;

[0101] C. Sterilize with 10% sodium hypochlorite for 10 minutes (mix by oscillation during this period), centrifuge at 10,000 rpm for 1 minute, remove the supernatant, and wash with sterile water 4-5 times;

[0102] D. Use a pipette to spread the seeds evenly on MS 1 / 2 + 10 μg / mL G418 medium;

[0103] E. Vernalization treatment: Treat at 4°C for 2-4 days, then transfer to an artificial climate chamber for cultivation (22°C, short day: 8h / d of light, 4000LX of light intensity).

[0104] ③Identification of transgenic Arabidopsis;

[0105] A. Extract DNA from leaves of T3 transgenic Arabidopsis seedlings;

[0106] B. Using the extracted genomic DNA as a template, PCR identification was performed using the same primers used to construct the expression vector (SEQ ID NO: 9 and SEQ ID NO: 10).

[0107] (4) The transgenic Arabidopsis thaliana was subjected to high temperature stress and low temperature stress respectively. The specific experimental steps are as follows:

[0108] ① Phenotypic analysis in culture dishes:

[0109] High temperature treatment: Vernalized transgenic and wild-type Arabidopsis seeds were spotted on 1 / 2MS medium and placed at 45°C for 2 h. After growing for 1 week, the phenotypes were recorded, and the fresh weight and root length were measured.

[0110] Low temperature treatment: Vernalized transgenic and wild-type Arabidopsis seeds were spotted on 1 / 2MS medium and grown for 1 week. Wild-type Arabidopsis and transgenic Arabidopsis with consistent growth were selected and placed in the same culture dish for low temperature treatment at 4°C. The phenotypes were recorded after 10 days, and the fresh weight and root length were measured.

[0111] ② Phenotypic analysis in soil:

[0112] Vernalized transgenic and wild-type Arabidopsis seeds were planted on 1 / 2MS medium and cultured in an artificial climate chamber for 8 days (22°C, short day: 8 h / d, light intensity 150 μmol / m 2 / s), seedlings with the same growth status and size were selected and transplanted into a mixed matrix of vermiculite: nutrient soil = 2:1 for cultivation. After 40 days, wild-type and transgenic Arabidopsis seedlings with the same growth status were selected for stress treatment:

[0113] ① Control group: Normally cultured seedlings were used as controls for high and low temperature treatments. Normal culture conditions were cultured in an artificial climate box: temperature: 22°C, relative humidity: 75%, photoperiod: 16h light / 8h dark, light intensity: 150μmol / m 2 / s.

[0114] In the high temperature stress and low temperature stress treatments, only the temperature changed, and the other conditions were the same.

[0115] ② High temperature treatment: Place the plants in a 45℃ light incubator for 6 days;

[0116] ③ Low temperature treatment: Place the plants in a 4℃ light incubator for 3 days;

[0117] Arabidopsis thaliana under normal conditions, high temperature treatment and low temperature treatment were photographed and recorded.

[0118] Experimental results:

[0119] Figure 5 This is an analysis of the heat resistance of transgenic Arabidopsis in a culture dish. In the figure, A is a phenotypic analysis of the heat resistance of transgenic Arabidopsis; in the figure, B is the fresh weight of wild-type Arabidopsis and transgenic Arabidopsis under normal conditions and high temperature treatment; C is the root length of wild-type Arabidopsis and transgenic Arabidopsis under normal conditions and high temperature treatment. In the figure, WT is wild-type Arabidopsis, DcHSP20-2-2 is transgenic DcHSP20-2 Arabidopsis line 2, and DcHSP20-2-13 is transgenic DcHSP20-2 Arabidopsis line 13. Figure 5 As shown, transgenic Arabidopsis grows significantly better than wild-type Arabidopsis under high temperature stress, and plant fresh weight and root length measurements also show that transgenic plants are taller than wild-type Arabidopsis under high temperature stress. The plant expression vector pCAMBIA2300-DcHSP20-2 was constructed and transformed into the model plant Arabidopsis, and it was found that this gene can not only improve the heat tolerance of Arabidopsis, but also improve the cold tolerance of Arabidopsis.

[0120] Figure 6 To analyze the heat and cold tolerance of transgenic Arabidopsis in soil, Figure 6 A in the middle is a diagram showing the heat tolerance phenotype analysis of transgenic Arabidopsis; Figure 6 Figure B is a cold tolerance phenotype analysis diagram of transgenic Arabidopsis. In the figure, WT is wild-type Arabidopsis, DcHSP20-2-2 is transgenic DcHSP20-2 Arabidopsis line 2, and DcHSP20-2-13 is transgenic DcHSP20-2 Arabidopsis line 13. Figure 6 As shown, the transgenic Arabidopsis thaliana can still grow normally under stress conditions, while the wild-type Arabidopsis thaliana wilts, indicating that the transgenic plants grow better under stress conditions.

[0121] Figure 7 To analyze the cold tolerance of transgenic Arabidopsis thaliana in culture dishes, Figure 7 A in the middle is a cold tolerance phenotype analysis diagram of transgenic Arabidopsis; Figure 7 Figure B shows the fresh weight of wild-type Arabidopsis and transgenic Arabidopsis under normal conditions and low temperature treatment; Figure C shows the root length of wild-type Arabidopsis and transgenic Arabidopsis under normal conditions and low temperature treatment. In the figure, WT is wild-type Arabidopsis, DcHSP20-2-2 is transgenic DcHSP20-2 Arabidopsis line 2, and DcHSP20-2-13 is transgenic DcHSP20-2 Arabidopsis line 13. Figure 7 As shown, the transgenic Arabidopsis grew significantly better than the wild-type Arabidopsis under low temperature stress, and plant fresh weight and root length measurements also found that the transgenic plants were taller than the wild-type Arabidopsis under high temperature stress.

[0122] The above results show that DcHSP20-2 can improve the heat resistance and cold tolerance of plants, provide molecular biological support for improving the heat resistance and cold tolerance of plants by constructing transgenic plants, provide genetic resources for improving plant resistance, and have good application prospects in breeding plants with excellent resistance.

[0123] The preferred specific embodiments of the present invention are described in detail above. It should be understood that a person skilled in the art can make many modifications and changes based on the concept of the present invention without creative work. Therefore, any technical solution that can be obtained by a person skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. Application of DcHSP20-2 in improving heat resistance and cold resistance of plants, characterized in that: The plant is Arabidopsis thaliana; the nucleotide sequence of DcHSP20-2 is SEQ ID NO: 1, and the amino acid sequence of the encoded protein is SEQ ID NO: 2.

Images