Application of OsbHLH002 protein or its encoding gene in regulating plant cellulose synthesis or secondary wall development

Abstract

The present invention provides an application of OsbHLH002 protein or its encoding gene in regulating plant cellulose synthesis or secondary wall development, and relates to the technical field of plant molecular biology. The amino acid sequence of the OsbHLH002 protein of the present invention is shown in SEQ ID No. 2. The present invention obtains mutants of the OsbHLH002 gene by means of genetic engineering, and the results show that the four mutant types of Osbhlh002 show a lodging phenotype compared with wild-type plants, and the complementary strain can restore the phenotype of secondary wall development defects of the mutant. The present invention provides an important application direction for increasing the cellulose content of plants and increasing the thickness of secondary walls, and also provides an important reference for breeding lodging-resistant excellent varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular biology, and in particular to the application of OsbHLH002 protein or its encoding gene in regulating plant cellulose synthesis or secondary wall development. Background Art

[0002] The cell wall is a characteristic structure that distinguishes plant cells from animal cells and plays a vital role in plant growth and development. Plant cell walls are divided into primary and secondary walls according to the components of cell wall biosynthesis and the location of the cell (Underwood, 2012; Barros et al., 2015). The secondary wall is produced by thickened specific plant cell types, which are involved in many key biological processes in plants, such as mechanical support, water and nutrient transport, anther and pod dehiscence, and various stress responses (Zhong and Ye, 2015; Zhang et al., 2021). The secondary wall is mainly composed of cellulose, hemicellulose and lignin, which account for most of the plant biomass. Cellulose is the main component in both the primary and secondary walls, accounting for about 1 / 3 of the dry weight of the plant. It is the main determinant of the mechanical strength of plant tissues and is also the most abundant natural organic macromolecule on earth. It has important application prospects in agricultural production, industrial manufacturing, and the development and utilization of new energy. Therefore, the study of the molecular mechanism of cellulose deposition and secondary wall formation and regulation has important theoretical value and scientific significance.

[0003] In 1986, researchers observed the cellulose complex enzyme structure CSC (Cellulose synthase complex) in the cell membrane of higher plants. As a "factory" for cellulose catalysis and synthesis, it is assembled by cellulose synthase subunits (CESA) (Haigler and Brown, 1986; Pear et al., 1996). At present, at least 10 CESA genes have been identified in Arabidopsis, among which AtCESA4, AtCESA7, and AtCESA8 are key genes controlling the synthesis of secondary wall cellulose in Arabidopsis (Han Xiao et al., 2014). Eleven CESA genes have been identified in rice, and the synthesis of secondary wall cellulose requires the joint participation of OsCESA4 / 7 / 9. OsCESA4 / 7 / 9 is the homologous gene of AtCESA4 / 7 / 8 in rice (Tanaka et al., 2003), proving that the synthesis of secondary wall cellulose is conserved among different species.

[0004] Transcriptional regulation is a large-scale control mechanism of cellulose synthesis because it affects multiple metabolic pathways simultaneously and regulates the transcription of many genes involved in cellulose formation. In the dicot model plant Arabidopsis, a precise model of the regulatory network for secondary wall cellulose synthesis has been established. In this transcriptional regulatory network, a series of NAC and MYB transcription factors are included, as well as a small number of bHLH and WRKY transcription factors (Zhong et al., 2010; Zhang et al., 2021). Some NAC proteins function as first-layer master regulators, including VND1-7 (VASCULAR-RELATED NACDOMAIN1-7), NST1, SND1 / NST3 and NST2. VND1-7 are related to the development of xylem vessel cells. Among them, VND6 and VND7 are the main switch genes for xylem vessel formation. Overexpression will cause the thickening of metaxylem and protoxylem, respectively (Zhou et al., 2014; Kubo et al., 2005); NST1 / 2 and SND1 have been reported to co-regulate the synthesis of secondary cell walls (Zhong and Ye, 2015). These secondary wall-related NACs have been shown to regulate the expression of a series of downstream transcription factors, such as MYBs, thereby regulating the biosynthesis of secondary wall cellulose deposition. MYB46 and MYB83 are directly regulated by the first-layer master switches NST1 / 2, SND1 and VND6 / 7 in the regulatory network. They are specifically expressed in stem vessel cells and vascular tissue cells (Zhong et al., 2007; Yamaguchi et al., 2011), and are key node genes regulating the formation of Arabidopsis secondary cell walls. OsMYB61 and OsMYB103L regulate secondary wall cellulose synthesis by directly binding to the promoters of OsCesAs. Some known NAC-type transcription factors, including rice OsSND2, OsNAC9, and OsNAC31, act as first-tier regulators that directly mediate the expression of other MYB-type genes and promote cellulose biosynthesis.

[0005] bHLH transcription factors are a class of proteins widely present in plants, which play an important role in plant development regulation, stress response, hormone synthesis and light signal transduction. The classic ICE1 (Inducer of CBF Expression1) encodes a bHLH transcription factor, and plants overexpressing the ICE1 gene have significantly improved cold tolerance (Chinnusamy et al., 2003). Another bHLH transcription factor ZHOUPI (ZOU) was reported to mediate the seed development process of Arabidopsis (Yang et al., 2008); in addition, it and ICE1 regulate the seed dormancy process by regulating the accumulation of ABA during seed maturation (MacGregor et al., 2019). The Arabidopsis PHYTOCHROME B mutant phyB deposited thinner secondary cell walls in stem fiber cells, but thicker cell walls were observed in the PHYTOCHROMEINTERACTING FACTOR (PIF) quadruple mutant pif1pif3pif4pif5 (pifq); in addition, PIF4 interacted with MYC2 / 4, inhibiting their transduction activity on the primary regulatory transcription factor NST1, thereby inhibiting the thickening of the secondary wall of Arabidopsis stem fiber cells (Luo et al., 2022). However, the role of bHLH transcription factors in secondary wall formation has been less studied. Despite great progress in the transcriptional regulatory network of Arabidopsis, our understanding of the regulatory mechanism of secondary wall cellulose development in the monocot rice is still quite limited. Rice is one of the most important staple crops and it produces huge agricultural biomass residues. Therefore, it is necessary to explore and discover more relevant genes involved in the development of rice secondary walls.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The present invention aims at the deficiency of the prior art in the research on the regulation mechanism of plant secondary wall development, and provides the application of OsbHLH002 protein or its encoding gene in regulating plant cellulose synthesis or secondary wall development.

[0008] The technical solution provided by the present invention is as follows:

[0009] In one aspect, the present invention provides the use of OsbHLH002 protein or its encoding gene in regulating plant cellulose synthesis or secondary wall development. The amino acid sequence of the OsbHLH002 protein is shown in SEQ ID No.2.

[0010] The present invention obtains mutants of the OsbHLH002 gene by means of genetic engineering, and the results show that four types of Osbhlh002 mutants show a lodging phenotype compared with wild-type plants, while the complementary strains can restore the phenotype of secondary wall development defects of the mutants. The OsbHLH002 protein or its encoding gene of the present invention can be used to regulate the development of plant secondary walls, especially the cellulose synthesis and deposition of secondary walls.

[0011] The "OsbHLH002 protein" in the present invention includes a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2, and a protein with the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2.

[0012] In one embodiment, the nucleotide sequence of the gene encoding the OsbHLH002 protein is shown as SEQ ID No.1.

[0013] The present invention covers sequences having a similarity of 90% or more, preferably 95% or more, and more preferably 99% or more to the nucleotide sequence shown in SEQ ID No. 1 and having the same function. The present invention also covers sequences having one or more base substitutions, replacements, deletions and / or additions to the nucleotide sequence shown in SEQ ID No. 1 and having the same function.

[0014] In another aspect, the present invention provides a use of a biomaterial comprising a gene encoding an OsbHLH002 protein in regulating plant cellulose synthesis or secondary wall development, wherein the biomaterial comprises:

[0015] (A) an expression cassette containing a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID No. 1;

[0016] (B) a recombinant vector containing the expression cassette described in (A);

[0017] (C) a recombinant microorganism containing the expression cassette described in (A) or the recombinant vector described in (B);

[0018] (D) A recombinant cell containing the expression cassette described in (A) or containing the recombinant vector described in (B).

[0019] In one embodiment, the recombinant vector is an overexpression vector of the OsbHLH002 gene.

[0020] In one embodiment, the recombinant expression vector comprises a transcript that initiates transcription of the target gene. In order to obtain overexpression of the target gene, the promoters contained in the recombinant expression vector include, but are not limited to: constitutive promoters; tissue, organ and development-specific promoters and inducible promoters.

[0021] In one embodiment, the overexpression vector contains the Ubiquitin promoter or the CaMV 35S promoter.

[0022] In one embodiment, the recombinant vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, such as but not limited to pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb.

[0023] In one embodiment, the recombinant vector is a pENTR-3FLAG vector.

[0024] In one embodiment, the recombinant microorganism is Agrobacterium, preferably, the recombinant microorganism is Agrobacterium EHA105.

[0025] In one embodiment, the regulation is to promote the synthesis of secondary wall cellulose by increasing the expression level of the OsbHLH002 gene or the activity of the OsbHLH002 protein in the plant.

[0026] In one embodiment, the plant is a monocot or a dicot.

[0027] In one embodiment, the plant comprises rice.

[0028] In a specific embodiment, the plant is wild-type rice (Nipponbare).

[0029] In another aspect, the present invention provides a method for cultivating lodging-resistant transgenic rice, taking the gene OsbHLH002 as a target gene, and improving the expression level of the OsbHLH002 gene or the activity of the OsbHLH002 protein in rice by genetic engineering methods to obtain transgenic rice.

[0030] In one embodiment, the genetic engineering method comprises introducing the OsbHLH002 gene into the recipient rice.

[0031] In one embodiment, the nucleotide sequence of the OsbHLH002 gene is shown as SEQ ID No.1.

[0032] In the present invention, the transgenic rice includes seeds, callus, complete plants and cells. The transgenic rice includes not only the first generation of transgenic rice obtained by transforming the gene into the target plant, but also its progeny.

[0033] Beneficial effects of the present invention:

[0034] The present invention clearly verifies for the first time the important role of OsbHLH002 protein or its encoding gene in regulating plant cellulose synthesis or secondary wall development. When the gene function is lost, the plant has secondary wall development defects. This shows that the gene plays an important role in secondary wall development, which is beneficial to promote plant secondary wall biosynthesis, increase plant cellulose content, and increase secondary wall thickness. The present invention provides an important theoretical basis for the study of the development mechanism of secondary wall and the cultivation of new lodging-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A schematic diagram of the mutation sites of four mutants of the OsbHLH002 gene provided by the present invention;

[0036] Figure 2 The four mutant types of Osbhlh002 provided by the present invention showed a lodging phenotype compared with the wild-type plants.

[0037] Figure 3 The Osbhlh002-1 gOsbHLH002 and Osbhlh002-1 gOsbHLH002-3FLAG complementation strains provided by the present invention can restore the phenotype of secondary wall development defect of Osbhlh002-1;

[0038] Figure 4 A schematic diagram of the difference in thickness of the secondary wall of leaf sheaths between the wild type and the Osbhlh002 mutant provided by the present invention;

[0039] Figure 5 The present invention provides the measurement results of cell wall thickness and cellulose content of the wild type, Osbhlh002 mutant and its complementation line. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. The following embodiments and features in the embodiments can be combined with each other without conflict. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] Discovering and verifying more genes involved in plant cell wall regulation is of great significance for crop breeding and increasing yield. At present, genes related to plant secondary wall development have been gradually discovered and their functions have been identified, but there are few studies on the role of bHLH transcription factors in secondary wall formation, and the function and mode of action of OsbHLH002 in the molecular regulatory network mediated by it in rice secondary wall development or cellulose synthesis have not been reported.

[0042] The experimental results of the present invention on the mutation of the OsbHLH002 gene show that the OsbHLH002 functional loss mutant strain has secondary wall development defects, which are specifically manifested as a phenotype of weakened sheath support, significantly reduced secondary wall thickness and significantly reduced cellulose content. This indicates that the OsbHLH002 gene has an important function in the synthesis of rice secondary walls. In addition, the present invention constructs a complementary strain and finds that the complementary strain can restore the phenotype of secondary wall development defects of Osbhlh002-1, further verifying the role of the gene in plant secondary wall development. The present invention provides a new gene resource for rice secondary wall cellulose synthesis and provides a theoretical basis for crop molecular design breeding.

[0043] The OsbHLH002 gene sequence involved in the present invention has a full length of 1575 bp, and the nucleotide sequence is shown in SEQ ID NO.1, encoding 524 amino acids.

[0044] In one example, the present invention provides an application of an OsbHLH002 protein or a gene encoding the same in regulating plant cellulose synthesis or secondary wall development. The amino acid sequence of the OsbHLH002 protein is shown in SEQ ID No. 2: .

[0045]

[0046] In one embodiment, upregulating the activity or expression level of the OsbHLH002 protein or its encoding gene can regulate the development of plant secondary wall or the synthesis of secondary wall cellulose.

[0047] In a specific embodiment, the OsbHLH002 gene is introduced into the plant by using an overexpression vector for overexpression, thereby controlling the expression level of the OsbHLH002 gene (increasing the expression level) to promote the deposition of plant secondary wall cellulose.

[0048] In a specific embodiment, increasing the expression level of the OsbHLH002 gene can increase the content of secondary wall cellulose, increase the thickness of the secondary wall, and enhance the supporting capacity of the leaf sheath.

[0049] The present invention clarifies the function of OsbHLH002 and biological materials containing the same in promoting the deposition of plant secondary wall cellulose. Since the mutation of OsbHLH002 will lead to the lodging trait of the plant, lodging-resistant transgenic plants can be cultivated by increasing or improving the expression of the gene.

[0050] In one embodiment, the present invention provides a method for cultivating lodging-resistant transgenic rice, wherein the expression level of the OsbHLH002 gene or the activity of the OsbHLH002 protein in rice is increased by genetic engineering methods to obtain the lodging-resistant transgenic rice.

[0051] Definitions of terms used in this invention

[0052] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single- or double-stranded form.

[0053] In the present invention, the term "identity" or "similarity" refers to sequence similarity to a natural nucleic acid sequence. Identity or similarity can be evaluated with the aid of computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0054] In the present invention, the term "expression" or "gene expression" means the transcription of a specific gene or multiple specific genes or a specific gene construct into structural RNA (rRNA, tRNA) or mRNA, and the RNA is subsequently translated or not translated into protein. This process includes the transcription of DNA and the processing of the resulting mRNA product.

[0055] In the present invention, the term "increased expression / overexpression" means any form of expression that is increased relative to the original wild-type expression level. Methods for increasing the expression of genes or gene products have been documented in the art and these methods include, for example, overexpression driven by a suitable promoter, the use of transcription enhancers or translation enhancers.

[0056] In the present invention, the terms "increase", "improve" or "enhance" are interchangeable and shall in the applied sense mean at least 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more yield and / or growth and / or changes compared to control plants as defined herein.

[0057] In the present invention, the term "transformation" refers to a process of introducing a heterologous DNA sequence or a vector containing a DNA sequence into a host cell or organism.

[0058] In the present invention, the term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art.

[0059] In the present invention, the term "host cell" or "recombinant host cell strain" means a cell comprising a polynucleotide of the present invention, regardless of the method used to insert the recombinant host cell. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0060] In the present invention, the term "complementation vector" means a "functional complementation vector", which is used in genetic engineering for functional complementation experiments of mutants to verify whether the mutant phenotype can be restored after complementation. The complementation vector usually contains the target gene, and a constitutively expressed strong promoter or the promoter of the target gene itself can be selected.

[0061] Some embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the absence of conflict, the following embodiments and features in the embodiments can be combined with each other.

[0062] Example 1. Cloning of the nucleotide sequence of the OsbHLH002 gene

[0063] RNA was extracted from rice using a plant extraction kit from Omega. Then, 1 μg of RNA was used as a template to synthesize the first-strand cDNA according to the cDNA synthesis kit (Yeasen) operating instructions. The complete ORF of OsbHLH002 was obtained from the website (http: / / rice.plantbiology.msu.edu / expression.shtml), and specific primers were designed: the 5' end primer was ATGCTGCCGCGGTTTCA (SEQ ID No. 3); the 3' end primer was CTAGATCATGGTATGGAAC (SEQ ID No. 4).

[0064] PCR reaction system: 2×PhantaMax MasterMix 25μL, forward / reverse primer 10μM 1μL each, template (cDNA) 5μL, sterile water to 50μL, reaction procedure is as follows: 95℃ pre-denaturation 3min, 95℃ denaturation 30s, Tm annealing 30s, 72℃ extension 2kb / min, 35-40 cycles, 72℃ extension 5min. . Finally, the full-length cDNA sequence of 1575bp (including the stop codon) of OsbHLH002 was amplified (as shown in SEQ ID No.1), encoding 524 amino acids (as shown in SEQ ID No.2).

[0065] Example 2. Construction of OsbHLH002 gene mutant and complementation strain vector

[0066] In this study, the CRISPR / Cas9 genome editing system was used to edit the OsbHLH002 gene in wild-type rice (Nipponbare) to obtain mutant plants. The exon sequence of the target gene OsbHLH002 was analyzed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ), and two specific target sequences were selected, named target site 2 (Cas9-2) GGCGACCAAGAACACGGGCAGG (SEQ ID No.5) and target site 3 (Cas9-3) CCATGTGGATGCAGGACGACGG (SEQ ID No.6). Synthesize sgRNA-2 (GGCGACCAAGAACACGGC, SEQ ID No.7) and sgRNA-3 (CCATGTGGATGCAGGACGA, SEQ ID No.8), cut the gene editing vector psgR-CAS9-Os with BsaI, and anneal the primers first: target site 2, 10μL F (5'-TGTGTGGGCGACCAAGAACACGGGC-3', SEQ ID No.9) + 10μL R (5'-AAACGCCCGTGTTCTTGGTCGCCCA-3', SEQ ID No.10) + 80μL ddH2O and mix well; target site 3, 10μL F (5'-TGTGTGCCATGTGGATGCAGGACGA-3', SEQ IDNo.11) + 10μL R (5'-AAACTCGTCCTGCATCCACATGGCA-3', SEQ IDNo.12) + 80μL ddH2O was mixed, annealed at 95℃ for 10min, and then connected with the vector psgR-CAS9-Os after enzyme digestion. The connection system is as follows: 2μL annealing product (containing sgRNA) + 2μL recovery enzyme digestion vector + 0.5μL 10×T4 buffer + 0.5μL T4 ligase was connected at room temperature for 15min to obtain the psgR-CAS9-OsbHLH002 vector containing the OsbHLH002 specific target, which was transformed into the competent E. coli DH5α. The transformation system is as follows: 5μL of the connection product was added to the competent E. coli, on ice for 30min, heat shock at 42℃ for 90s, on ice for 2min, add 400μL of antibody-free LB, recover at 37℃ for 1h, centrifuge at 5000rpm for 1min, aspirate most of the supernatant, keep 100μL of liquid and mix, spread on LB plate (50mg / LKan) for culture, and culture overnight at 37℃. After the plasmids were extracted from the positive clones, they were sent to the company for sequencing. The psgR-CAS9-OsbHLH002 plasmid with the correct result was selected and the mutant plants were obtained by infecting rice callus with Agrobacterium.

[0067] In order to construct gOsbHLH002-3FLAG, the amplified 4.94kb genomic sequence containing 2.12kb 5' upstream sequence and 2.82kb coding sequence was first purified according to the Omega gel recovery kit. The recovered product and the vector pENTR-3FLAG after ECORI digestion were connected by homologous recombination. The reaction system was as follows: 2μL of linearized vector, 3μL of insert fragment, 4μL of 5×Cell buffer, 2μL of Exnase II, and sterile water was made up to 20μL; reaction conditions: 37℃, 30min. The ligation product was transformed into DH5α competent cells and cultured overnight at 37℃ (kanamycin resistance). The positive monoclonal was picked and sent for testing the next day.

[0068] Example 3. Construction of OsbHLH002 gene mutants and complementary strains

[0069] 1. Obtaining OsbHLH002 gene mutant plants

[0070] Rice (Nipponbare) callus was used as the experimental material. The gene mutant vector of OsbHLH002 obtained in Example 2 was transformed into Agrobacterium EHA105 by freeze-thaw method. Pick a single clone of Agrobacterium (containing the gene mutant vector of OsbHLH002) and place it in 2mL Rif+Spe LB liquid culture medium at 28℃ and 200rpm for overnight shaking. Then take 1mL of bacterial solution and culture it in 10mL resistant LB for 5h, centrifuge it at 4000rpm at room temperature for 10min, discard the supernatant, and resuspend the bacteria with 50mL AAM-As resuspension solution; pick out rice callus of a certain size, put it in the Agrobacterium suspension for 30min, pre-pad a layer of sterile filter paper soaked in AAM on the culture medium, spread the callus on the culture medium with a spoon, and culture it in the dark at 28℃ for 2 days. After 2 days, wash the callus with sterile water until the washing solution is clear, then shake it with sterile water containing 500 mg / L Cef for 30 minutes, spread the washed callus on sterile filter paper and dry it for 2 hours, then transfer it to the screening medium for screening for about two weeks. The newly grown resistant callus is transferred to the differentiation medium containing 50 mg / L hygromycin for culture. After 2 to 3 weeks, the green rice callus is transferred to the rooting medium to induce rooting. For mutant-positive plants, gDNA of T0 generation plants needs to be extracted, PCR identified and sequenced.

[0071] Identification of Osbhlh002 mutants: Extract genomic DNA from leaves of T0 transgenic plants and use it as a template. According to the two target information of OsbHLH002, design specific primers F2 (AGGAAAAACGGCTTGTGGGA, SEQ ID No.13) and primer R2 (GGACGACAAACCCAGCATCA, SEQ ID No.14), specific primers F3 (GTAGAGTGCTCTCCCCTCCA, SEQID No.15) and primer R3 (GGACGACAAACCCAGCATCA, SEQ ID No.16) for PCR amplification, and recover the single and clear amplification products of the target band (the size of the PCR amplification products of positive plants is 477bp and 369bp), and send them to the company for sequencing to screen the mutant lines. The T0 generation was continuously self-pollinated to obtain the T2 generation. The T2 generation plants were screened with hygromycin and identified by PCR again to screen out independent lines that do not contain vectors and are homozygous for mutations, such as Figure 1 As shown, four mutant strains were finally obtained, named Osbhlh002-1, Osbhlh002-2, Osbhlh002-3 and Osbhlh002-4. Two mutations occurred in the target sequence 1, the strain with one base added (+T) was Osbhlh002-1, and the strain with one base missing (-G) was Osbhlh002-2; two mutations also occurred in the target sequence 2, the strain with one base added (+A) was Osbhlh002-3, and the strain with one base missing (-A) was Osbhlh002-4. The above four mutants all caused frameshift mutations in the encoded protein.

[0072] 2. Obtaining OsbHLH002 gene complementation strains

[0073] The rice genetic transformation method mediated by Agrobacterium was mainly based on the method reported by Hiei et al. (see Agrobacterium-mediated transformation of rice using immature embryos or calliinduce from mature seed, 2008, Nature protocol. Doi: 10.1038 / nprot.2008.46). The complementary vector gOsbHLH002 or gOsbHLH002-3FLAG was introduced into the callus tissue homozygous for the OsbhLh002-1 mutant, and germinated on a medium containing hygromycin to obtain homozygous transgenic plants. We randomly selected four strains #5, #6, #8, and #11 as examples, all of which were able to restore the phenotype of secondary wall development defects of Osbhlh2-1 (such as Figure 3 ).

[0074] Example 4. Phenotypic analysis of relevant genetic material

[0075] Rice (wild type, mutant and complementation lines) seeds were soaked and sown, and the phenotypes of plant materials were observed for about 2-3 weeks (e.g. Figure 2 , 3 The leaf sheaths were cross-sectioned at about 2-3 weeks old and the changes of thick wall cells were observed by methylene blue staining. The thickness of the secondary wall of the thick wall cells was measured by transmission electron microscopy (e.g. Figure 4 ); the content of cellulose in the secondary wall of the leaf sheath of relevant materials was determined using the Solarbio kit (such as Figure 5 ), determine the phenotype of related genetic material from multiple perspectives.

[0076] Although the disclosure is disclosed as above, the protection scope of the disclosure is not limited thereto. Those skilled in the art may make various changes and modifications without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the protection scope of the present invention.

Claims

1. Application of OsbHLH002 protein or its encoding gene in regulating rice cellulose synthesis or rice secondary wall development, characterized in that: The amino acid sequence of the OsbHLH002 protein is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the OsbHLH002 protein is shown in SEQ ID No.

1.

3. Use of a biomaterial comprising a gene encoding an OsbHLH002 protein in regulating rice cellulose synthesis or rice secondary wall development, characterized in that: The biological material comprises: (A) an expression cassette containing a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID No. 1; (B) a recombinant vector containing the expression cassette described in (A); (C) a recombinant microorganism containing the expression cassette described in (A) or the recombinant vector described in (B); (D) A recombinant cell containing the expression cassette described in (A) or containing the recombinant vector described in (B).

4. The use according to claim 3, characterized in that: The recombinant vector is OsbHLH002 Gene overexpression vector.

5. The use according to claim 4, characterized in that The overexpression vector contains Ubiquitin promoter or CaMV 35S promoter.

6. The use according to any one of claims 1 to 5, characterized in that: The regulation is to increase the OsbHLH002 The expression level of the gene or the activity of OsbHLH002 protein promotes the synthesis of secondary wall cellulose.

7. A method for cultivating lodging-resistant transgenic rice, characterized in that: Gene OsbHLH002 As the target gene, genetic engineering was used to improve the OsbHLH002 The expression level of the gene or the activity of the OsbHLH002 protein is measured to obtain transgenic rice, wherein the OsbHLH002 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

8. The method according to claim 7, characterized in that The genetic engineering method comprises introducing the OsbHLH002 Gene.

Images