NADH-dependent L-phosphinothricin dehydrogenase mutant, construction method and application thereof in enzymatic preparation of L-phosphinothricin

Abstract

The present application relates to a NADH-dependent L-phosphinothricin dehydrogenase mutant, a construction method and its application in the enzymatic preparation of L-phosphinothricin. The amino acid sequence of the NADH-dependent L-phosphinothricin dehydrogenase mutant is a replacement of the amino acid residues corresponding to the 143rd and / or 353rd positions of the wild-type sequence. The genetically engineered bacteria E. coli BL21 (DE3) / pET30a-PPTDH (A143S / M353V) constructed by the mutant has the property of high yield of L-phosphinothricin, which is used to catalyze the reductive amination reaction of L-phosphinothricin intermediate 2-carbonyl-4-[hydroxy (methyl) phosphono] butyric acid, and can reach a maximum conversion rate of 99.5% within 6 hours at a substrate concentration of 500mM, and the conversion efficiency is much higher than that of the wild-type PPTDH. At the same time, the mutant can efficiently utilize the cheap cofactor NADH for catalytic reaction, and can be applied to the efficient and green preparation of L-phosphinothricin by microbial enzyme method.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an NADH-dependent L-phosphinothricin ammonium dehydrogenase mutant, a genetic engineering bacteria construction method and an application of the mutant in the enzymatic preparation of L-phosphinothricin ammonium. Background Art

[0002] Glufosinate ammonium (PPT for short) is a broad-spectrum non-selective amino acid herbicide developed by the German company Hoechst in 1986. Its chemical formula is C5H 12 NO4P, chemical name is 2-amino-4-[hydroxy(methyl)phosphonobutyric acid. Glufosinate ammonium acts on many types of weeds, kills weeds quickly, has high herbicidal activity, has a small effective application amount, is easily degradable, and has little impact on the environment. It is currently the world's second largest genetically modified crop tolerance herbicide after glyphosate. At the same time, due to the drug resistance problem caused by the widespread use of glyphosate in recent years and the restrictions on the use of herbicides such as paraquat and diquat, the market size of glufosinate ammonium has continued to expand and has become the fastest growing non-selective herbicide in the world.

[0003] Currently, commercially used glufosinate herbicides are usually composed of a racemic mixture of D and L-glufosinate, of which only 50% of L-glufosinate has herbicidal activity. Therefore, by converting D-glufosinate in the glufosinate technical into L-glufosinate, its dosage can be reduced by half, which is of great significance for reducing costs, improving the economic efficiency of herbicides and alleviating environmental pressure.

[0004] At present, the preparation methods of L-glufosinate mainly include chemical method and biological method. The chemical method generally has the disadvantages of complicated steps, high cost, low optical purity of the product, and the use of a large number of organic reagents or highly toxic reagents, poor safety and serious pollution. The biocatalytic method for producing refined glufosinate has the advantages of simple steps, mild reaction conditions, high product stereoselectivity and high yield. It is an important trend in the industrial preparation of L-glufosinate and is strongly supported by various countries. The biotransformation method mainly includes two types: enzymatic synthesis and enzymatic resolution:

[0005] (1) The enzymatic synthesis method mainly uses L-phosphinothricin derivatives (such as N-phenylacetyl-D,L-phosphinothricin or glufosinate nitrile) as substrates and obtains L-phosphinothricin by enzymatic hydrolysis. The main advantages are high conversion rate and high product ee value, but it requires expensive and difficult to obtain chiral raw materials as precursors.

[0006] (2) Enzymatic resolution method: racemic D,L-glufosinate is used as a substrate and selectively resolved by a two-step enzymatic method. D-glufosinate is converted into 2-carbonyl-4-[hydroxy(methyl)phosphonyl]butyric acid (PPO) by D-amino acid oxidase (DAAO) or transaminase, and further reduced to L-glufosinate by glufosinate dehydrogenase (PPTDH), while retaining the original mass fraction of 40-60% of L-glufosinate. This method has the advantages of easy availability of raw materials, simple process, low cost and green environmental protection, and has high industrial application value. However, since PPO is not a natural substrate, the wild-type glufosinate dehydrogenase has low catalytic efficiency on it, and the wild-type PPTDH often uses the more expensive NADPH as a cofactor, which limits its industrial application. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a mutant of NADH-dependent L-phosphinothricin dehydrogenase, an expression vector, a genetically engineered bacterium, and a construction method and application thereof.

[0008] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0009] A NADH-dependent L-phosphinothricin dehydrogenase mutant, wherein at least one of A143G, A143S, M353V, A143G / M353V, and A143S / M353V mutations is performed on the wild-type L-phosphinothricin dehydrogenase having an amino acid sequence as shown in SEQ ID NO: 1. Preferably, at least one of A143S / M353V, A143G / M353V, and A143S mutations is performed; more preferably, A143S / M353V or A143G / M353V mutations are performed; and most preferably, A143S / M353V mutations are performed.

[0010] The A143G / M353V and A143S / M353V indicate that two sites are mutated simultaneously.

[0011] A gene encoding the NADH-dependent L-phosphinothricin dehydrogenase mutant.

[0012] An expression vector containing the above-mentioned NADH-dependent L-phosphinothricin dehydrogenase mutant encoding gene.

[0013] A genetically engineered bacterium containing the expression vector, wherein the genetically engineered bacterium is obtained by introducing the expression vector into a host cell through conventional transformation or transfection technology.

[0014] Further, the host cell includes a prokaryotic or eukaryotic cell; belonging to the genus Saccharomyces, Aspergillus, Pichia, Yarrowia, Actinomycetes, Streptomyces, Bacillus or Escherichia; preferably selected from at least one of Saccharomyces cerevisiae, Pichia pastoris, Streptomyces, Bacillus subtilis or Escherichia coli.

[0015] A construction method comprises the following steps:

[0016] (1) determining the mutation site of NADH-dependent L-phosphinothricin ammonium dehydrogenase, designing site-directed mutagenesis primers, using the wild-type L-phosphinothricin ammonium dehydrogenase nucleotide sequence shown in SEQ ID NO: 2 as a template, performing a whole plasmid PCR reaction, and obtaining a gene fragment having the amino acid mutation;

[0017] (2) treating the gene fragment product obtained by PCR with enzymes to remove the template DNA, and then transforming the product into competent cells, screening and obtaining competent cells having the NADH-dependent L-phosphinothricin dehydrogenase mutant encoding gene, culturing and extracting the recombinant expression vector;

[0018] (3) The recombinant expression vector is transformed into an expression host cell, and a genetically engineered bacterium is screened to obtain a NADH-dependent L-phosphinothricin dehydrogenase mutant.

[0019] Preferably, the PCR amplification in step (1) uses the following site-directed (saturation) mutagenesis primers:

[0020] 1) Primer sequence of A143X-f: 5′-gatattccgnnkccggatgttggtactaatgcacag-3′;

[0021] 2) Primer sequence of A143X-r: 5′-aacatccggmnncggaatatcaacaacatcaccaatcag-3′;

[0022] 3) Primer sequence of M353V-f: 5′-ggtgtgattgtttcttatctggaatgggttgaaaatctg-3′;

[0023] 4) Primer sequence of M353V-r: 5'-cagataagaaacaatcacaccacctgcatttgccag-3'.

[0024] The expression vector in step (2) can be any vector (e.g., plasmid or virus) that can be easily used for recombinant DNA procedures and can cause the expression of the polynucleotide of the NADH-dependent L-phosphinothricin dehydrogenase mutant. Preferably, the expression vector can be one of the pET28, pET29, and pET30 series vectors.

[0025] The A143X in step (3) refers to mutating the amino acid to other 20 common amino acids, i.e., site-directed saturation mutagenesis, and the nnk and mnn in the primer sequence refer to degenerate codons (m refers to a or c, k refers to g or t, and n refers to a, g, c or t).

[0026] A use of the NADH-dependent L-phosphinothricin dehydrogenase mutant in the enzymatic preparation of L-phosphinothricin.

[0027] The specific steps include:

[0028] Using 2-carbonyl-4-[hydroxy(methyl)phosphonyl]butyric acid (PPO) as a substrate, in the presence of an inorganic amino donor, a NADH-dependent L-phosphinothricin ammonium dehydrogenase mutant is used to catalyze the substrate reductive amination to prepare L-phosphinothricin ammonium;

[0029] The NADH-dependent L-phosphinothricin dehydrogenase mutant is the NADH-dependent L-phosphinothricin dehydrogenase mutant liquid enzyme, purified enzyme liquid or its immobilized enzyme, or the genetically engineered bacteria.

[0030] Furthermore, the form of each enzyme in the enzyme catalytic system is independently selected from: free enzyme and / or host cell with an enzyme expression vector introduced; wherein, based on the weight of wet bacteria, the ratio of the added amount of the host cell with the enzyme expression vector introduced to the total reaction liquid of the enzyme catalytic system is 1-200 g / L.

[0031] Further, the inorganic amino donor is ammonium sulfate or ammonium formate; the enzyme-catalyzed conversion reaction is carried out in a reaction liquid system with a pH of 7-10, a reaction temperature of 25-45° C., and a time of 1-6 h. The expression vector of the present application can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. When used herein, the terms "transformation" and "transfection" refer to a variety of art-recognized techniques for introducing foreign nucleic acids (e.g., DNA) into host cells known to those skilled in the art.

[0032] The "NADH-dependent L-phosphinothricin dehydrogenase mutant" described in the present application has L-amino acid dehydrogenase activity, that is, the activity of converting ketoacid intermediates (determined by the type of D-amino acid) into L-amino acids in the presence of an inorganic amino donor. In particular, the NADH-dependent L-phosphinothricin dehydrogenase mutant described in the present application has the activity of converting PPO into L-phosphinothricin.

[0033] The enzyme catalysis system also includes formate dehydrogenase. The formate dehydrogenase is used for the regeneration of the cofactor NADH. The formate dehydrogenase or glucose dehydrogenase can be any enzyme with formate dehydrogenase activity known in the art, such as NADH-dependent formate dehydrogenase (PseFDH) derived from Pseudomonas sp. 101.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The NADH-dependent L-phosphinothricin dehydrogenase mutant described in the present application has higher catalytic activity for PPO, and the enzyme activity is increased by 785% compared with the wild type, and has higher catalytic efficiency, and can be applied to the green and efficient preparation of L-phosphinothricin by bioenzymatic method. When PPO is used as a substrate for catalytic conversion reaction, the conversion rate is much higher than that of the wild type, and the conversion rate of the substrate PPO is greatly improved. 500mM 2-carbonyl-4-(hydroxymethylphosphinyl)-butyric acid can be completely catalyzed to generate L-phosphinothricin within 6 hours, which is much higher than the catalytic efficiency when using transaminase. At the same time, cheaper NADH is used as a cofactor, which greatly reduces the cost.

[0036] The term "catalytic efficiency" as used in this application refers to the property of L-phosphinothricin dehydrogenase that allows it to convert 2-carbonyl-4-[hydroxy(methyl)phosphinothricin]butyrate into L-phosphinothricin. In one embodiment, the catalytic efficiency of the NADH-type L-phosphinothricin dehydrogenase mutant of the present application is enhanced compared to the wild-type or reference L-phosphinothricin dehydrogenase.

[0037] (2) Using the NADH-type L-phosphinothricin dehydrogenase and its mutants described in the present application to catalyze the reduction of PPO, in the presence of an inorganic amino donor, a decrease in NADH can be observed at 340 nm (NADH has a characteristic peak at 340 nm), so that the enzyme activity of L-phosphinothricin dehydrogenase and its mutants can be quantitatively determined. The calculated enzyme activities of the NADH-type L-phosphinothricin dehydrogenase and its mutants are shown in Table 2. The obtained L-phosphinothricin dehydrogenase mutant (A143S / M353V) has a higher catalytic activity (>9.7 times) than the wild-type enzyme, indicating its excellent catalytic ability for the substrate PPO, and has the potential for industrial large-scale production of L-phosphinothricin.

[0038] (3) Using the NADH-type L-phosphinothricin dehydrogenase and its mutants described in the present application to catalyze the reductive amination of PPO in a multi-enzyme catalytic system, the amount of the product L-PPT generated was measured to calculate the substrate conversion rate as follows: Figure 1 As shown. The obtained L-phosphinothricin dehydrogenase mutant (A143S / M353V) can completely catalyze the conversion of PPO to L-phosphinothricin within 6 hours, and the substrate conversion rate is ≥99.5%. The enzymatic preparation of L-phosphinothricin using the NADH-type L-phosphinothricin dehydrogenase has the advantages of simple reaction steps, mild reaction conditions, low raw material prices, and simple product separation. It is a green, environmentally friendly, low-carbon process route suitable for large-scale industrial production applications.

[0039] The method described in the present application is used to be carried out in the same reaction vessel, and the yield of the product can be measured by any method known in the art, such as measuring the content of L-PPT in the obtained product by chiral high performance liquid chromatography (Chiral-HPLC). BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 The catalytic efficiency of NADH-type L-phosphinothricin dehydrogenase and its mutants was compared by measuring the amount of L-PPT produced in Example 1 and Comparative Example 1;

[0042] Figure 2 It is a schematic diagram of the mechanism of preparing L-phosphinothricin ammonium using NADH-type L-phosphinothricin dehydrogenase and its mutants in Example 1 and Comparative Example 1;

[0043] Figure 3 It is the SDS-PAGE electrophoresis diagram of the NADH-type L-phosphinothricin dehydrogenase and its mutants after His-tag nickel column purification in Example 1 and Comparative Example 1; wherein lanes 1 and 3 are electrophoresis diagrams of the crude enzyme solution and purified protein of the wild-type L-PPTDH, respectively, and lanes 2 and 4 are electrophoresis diagrams of the crude enzyme solution and purified protein of the NADH-type L-PPTDH mutant (specifically PPTDH (A143S / M353V)), respectively;

[0044] Figure 4 is a schematic diagram of the docking of NADH-type L-phosphinothricin dehydrogenase and substrate PPO in Example 1;

[0045] Figure 5It is a sequence comparison diagram of the NADH-type L-phosphinothricin dehydrogenase in Example 1 and other L-phosphinothricin dehydrogenases. DETAILED DESCRIPTION

[0046] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0047] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0048] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods. Among them, 2-carbonyl-4-(hydroxymethylphosphonyl)butyric acid (PPO for short) was purchased from Sigma-Aldrich, and NADH was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0049] Embodiment 1:

[0050] (1) Construction of genetically engineered bacteria.

[0051] The gene sequence of L-phosphinothricin dehydrogenase (L-PPTDH, GenBank No.: 4618137, amino acid sequence as shown in SEQ ID NO: 1, nucleotide sequence as shown in SEQ ID NO: 2) from Pyrobaculumislandicum was sent to Beijing Qingke Biotechnology Co., Ltd. for full gene synthesis, and then cloned into the expression plasmid pET-30a (+) to obtain pET-30a-PPTDH, and the restriction sites BamH I and Xho I were inserted. After sequencing verification, pET-30a-PPTDH was transferred into the cloning host E. coli DH5α and the expression host E. coli BL21 (DE3) for the subsequent construction of mutants and the expression of recombinant L-phosphinothricin dehydrogenase.

[0052] (2) Cultivation of engineered bacteria

[0053] LB liquid culture medium composition: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, dissolved in deionized water and fixed to volume, sterilized at 115℃ for 30min for use. LB liquid solid culture medium composition (plate): add agar powder 2% w / v to the LB liquid culture medium, sterilize at 115℃ for 30min, cool to 50-60℃, add 100mg / mL kanamycin (Kan) to make the final concentration reach 50μg / ml, pour into the culture dish, cool and solidify, seal in a 4℃ refrigerator for use. TB liquid culture medium composition: tryptone 12g / L, yeast powder 24g / L, glycerol 4g / L, KH2PO4 2.31g / L, K2HPO4 12.54g / L, dissolved in deionized water and fixed to volume, sterilized at 115℃ for 30min for use.

[0054] After the above recombinant genetic engineering bacteria E.coli BL21 (DE3) / pET-30a-PPTDH were activated by streaking on a plate, a single colony was picked and inoculated into 10 mL LB liquid medium containing 50 μg / ml kanamycin, and cultured at 37°C, 230 rpm overnight. A 2% inoculum was transferred to 10 mL TB liquid medium, and cultured at 37°C, 230 rpm until OD 600 When the concentration reaches about 0.8, add lactose with a final concentration of 1% w / v, and culture at 25°C for 12 hours. After the culture is completed, centrifuge the culture solution at 10,000 rpm for 10 minutes, discard the supernatant, collect the bacteria, and store them in a -80°C ultra-low temperature refrigerator for later use.

[0055] (3) Construction of NADH-type L-phosphinothricin dehydrogenase (L-PPTDH) mutant

[0056] The protein structure (PDBID: 1v9l) and substrate binding sites of wild-type PPTDH were analyzed, the binding process of substrate PPO was simulated by AutoDock software, and Pymol software was used to identify that positions 143 and 353 (specifically 143A and 353M) were involved in the formation of hydrophobic forces and hydrogen bonds during the binding process of substrate PPO. Therefore, changes in these two sites may have a significant effect on enzyme activity (such as attachment). Figure 4 Therefore, the 143rd and 353rd amino acids of the wild-type PPTDH were selected as site-directed (saturation) mutagenesis hotspots. The alanine at position 143 is a conserved site, while the amino acid at position 353 is methionine only in the L-PPTDH described in (1), while the amino acid residue at this position is valine in the other various PPTDHs (see attached). Figure 5Therefore, the alanine at position 143 was subjected to site-directed saturation mutagenesis to mutate it into 20 common amino acids (i.e., A143X), while the methionine at position 353 was subjected to site-directed mutagenesis to mutate it into valine (i.e., M353V), which has a smaller side residue, less steric hindrance, and greater hydrophobicity.

[0057] The wild-type PPTDH sequence described in (1) was mutated at positions 143 and 353 (specifically A143X and M353V). Site-directed mutagenesis primers were designed using the nucleotide sequence as a template, as shown in Table 1 below:

[0058] Table 1 Primers for site-directed mutagenesis of nucleotide sequences at positions 143 and 353

[0059] serial number Primer name Primer sequences Primer sequence list 1 A143X-f gatattccgnnkccggatgttggtactaatgcacag As shown in SEQ ID NO:3 2 A143X-r aacatccggmnncggaatatcaacaacatcaccaatcag As shown in SEQ ID NO:4 3 M353V-f ggtgtgattgtttcttatctggaatgggttgaaaatctg As shown in SEQ ID NO:5 4 M353V-r cagataagaaacaatcacaccacctgcatttgccag As shown in SEQ ID NO:6

[0060] The PCR amplification system (50 μL) is as follows:

[0061] 10×KOD-plus-neo buffer 5μL, dNTPs 5μL, MgSO4 3μL, upstream and downstream primers 1μL each, template DNA 1μL, KOD-plus-neo 1μL, add ddH2O to make the final system 50μL.

[0062] PCR amplification conditions (two-step method):

[0063] ① 94℃ pre-denaturation for 2 min, ② 98℃ denaturation for 10 sec, ③ 68℃ extension for 4 min, 30 cycles, ④

[0064] Extend at 72℃ for 7min, and store at 4℃.

[0065] After the PCR was completed, 5 μL of the product was taken for nucleic acid gel electrophoresis analysis. The target band obtained was clear. 1 μL Dpn I endonuclease was added to the remaining product, and the template DNA was digested at 37°C for 2h, and then inactivated at 80°C for 20min.

[0066] After the digestion, the product was transformed into E.coli DH5α competent cells, spread on LB solid medium containing 50μg / ml kanamycin, and cultured overnight at 37°C. A single colony was picked and placed in 10mL LB liquid medium containing 50μg / ml kanamycin, and cultured overnight at 37°C, 220rpm. After sequencing and identification, the plasmid was extracted and transformed into E.coli BL21(DE3) competent cells, spread on LB solid medium containing 50μg / ml kanamycin, and cultured overnight at 37°C. A single colony was picked and placed in 10mL LB liquid medium containing 50μg / ml kanamycin, and cultured overnight at 37°C, 220rpm to obtain mutant transformants. E.coli BL21(DE3) cells producing NADH-type L-phosphinothricin dehydrogenase mutants were obtained as described in (2).

[0067] (4) High-throughput screening of L-PPTDH mutants

[0068] For the L-PPTDH-A143X mutant described in (3), a beneficial mutant was obtained by high-throughput screening. The specific steps are as follows:

[0069] 300 μl of LB liquid medium containing 50 μg / ml kanamycin was added to a 96-well plate, and cultured at 37°C, 800 rpm for 8 h. 30 μl of bacterial solution was stored in a 4°C refrigerator, and then 30 μl of 20% (w / v) lactose solution was added for induction, and cultured overnight at 25°C, 800 rpm. 100 μl of bacterial solution was then added to an equal volume of cell lysis solution (pH 8.0, 0.05 M Tris-HCl buffer containing 2 mg / mL lysozyme, 4 mM EDTA, and 0.5% TritonX-100) and incubated at 40°C for 90 min. After centrifugation, the supernatant was taken and a sodium phosphate (PB) buffer (100 mM pH 8.0) containing 50 mM PPO, 200 mM ammonium sulfate and 10 mM NADH was added for reaction. The absorbance was measured at 340 nm at reaction times of 5, 10, 15 and 20 min, and the absorbance decrease value was calculated. The larger the value, the higher the activity of the mutant. The high-activity mutant screened was retested for enzyme activity according to the enzyme activity determination method described in step (6) of Example 1 and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to obtain an L-PPTDH mutant in which the amino acid residue at position 143 was mutated from alanine to glycine and serine (i.e., A143G and A143S). (5) For the L-PPTDH mutant described in (4), two point mutants were obtained by iterative site-directed mutagenesis, specifically A143G / M353V and A143S / M353V.

[0070] The PCR amplification system (50 μL) is as follows:

[0071] 10×KOD-plus-neo buffer 5μL, dNTPs 5μL, MgSO4 3μL, upstream and downstream primers 1μL each, template DNA 1μL, KOD-plus-neo 1μL, add ddH2O to make the final system 50μL.

[0072] PCR amplification conditions (two-step method):

[0073] ① Pre-denaturation at 94℃ for 2min, ② Denaturation at 98℃ for 10sec, ③ Extension at 68℃ for 4min, 30 cycles,

[0074] ④Extend at 72℃ for 7 min, ⑤Store at 4℃.

[0075] After the PCR was completed, 5 μL of the product was taken for nucleic acid gel electrophoresis analysis. The target band obtained was clear. 1 μL Dpn I endonuclease was added to the remaining product, and the template DNA was digested at 37°C for 2h, and then inactivated at 80°C for 20min.

[0076] After the digestion, the product was transformed into E.coli DH5α competent cells, spread on LB solid medium containing 50 μg / ml kanamycin, and cultured at 37°C overnight. A single colony was picked and placed in 10 mL LB liquid medium containing 50 μg / ml kanamycin, cultured overnight at 37°C, 230 rpm, and the plasmid was extracted after sequencing and identification, and transformed into E.coli BL21 (DE3), spread on LB solid medium containing 50 μg / ml kanamycin, cultured overnight at 37°C, and a single colony was picked and placed in 10 mL LB liquid medium containing 50 μg / ml kanamycin, cultured overnight at 37°C, 230 rpm to obtain mutant transformants. E.coli BL21 (DE3) cells producing NADH-type L-phosphinothricin dehydrogenase mutants were obtained as described in (2).

[0077] (6) Preparation and purification of crude NADH-type L-phosphinothricin dehydrogenase enzyme solution

[0078] The genetically engineered bacteria E. coli BL21 (DE3) / pET-30a-PPTDH-A143G, A143S, M353V, A143G / M353V and A143S / M353V obtained in (3) and (5) were activated by streaking on plates, and single colonies were inoculated into 10 mL LB liquid medium containing 50 μg / ml kanamycin and cultured at 37 ° C, 230 rpm overnight. 2% of the inoculum was transferred to 10 mL TB liquid medium and cultured at 37 ° C, 230 rpm until OD 600When the concentration reached about 0.8, lactose was added to a final concentration of 1% w / v, and the culture was shaken for 12 hours at 25° C. After the culture was completed, the culture solution was centrifuged at 10,000 rpm for 10 minutes, the supernatant was discarded, and the bacteria were collected.

[0079] The bacterial cells collected after the culture was completed were washed twice with 100 mM sodium phosphate (PB) buffer at pH 8.0 and then resuspended. The bacterial suspension was ultrasonically disrupted and centrifuged at 12000 rpm for 5 min to remove the precipitate. The supernatant was taken as the crude enzyme solution of the recombinant NADH-type L-phosphinothricin dehydrogenase.

[0080] The crude enzyme solution was bound to a Ni affinity chromatography resin equilibrated with a Binding / Wash buffer (containing 8 M urea, 500 mM NaCl, 5 mM imidazole, and 20 mM Tris-HCl buffer at pH 8.0), and then rinsed with a Wash buffer (containing 8 M urea, 500 mM NaCl, 5 mM imidazole, and 20 mM Tris-HCl buffer at pH 8.0) until the absorbance of the flow-through was close to the baseline at 280 nm. The target protein was then eluted with an Elution buffer (containing 8 M urea, 500 mM NaCl, 500 mM imidazole, and 20 mM Tris-HCl buffer at pH 8.0) and the target protein was collected. The retentate was taken and the protein content was determined to be 0.2274 mg / mL by the BCA method, and its molecular weight was identified to be 47.74 kDa by SDS-PAGE electrophoresis analysis. The purified enzyme solution was added with 60% (w / v) glycerol at a ratio of 1:1, and the solution was aliquoted and frozen at -80°C to obtain the pure enzyme solution of recombinant NADH-type L-phosphinothricin dehydrogenase.

[0081] (6) Determination of catalytic activity of NADH-type L-phosphinothricin dehydrogenase mutants

[0082] like Figure 2 As shown, in the presence of an inorganic amino donor, L-PPTDH is used to catalyze the conversion of PPO to generate L-PPT. The decrease in NADH can be monitored at 340 nm, so that the enzyme activity of NADH-type L-phosphinothricin dehydrogenase and its mutants on the substrate PPO can be quantitatively determined by spectrophotometry. The reaction system is: 100mM sodium phosphate (PB) buffer at pH 8.0, 100mMPO, 500mM ammonium sulfate and 10mMNADH. The above reaction solution is mixed evenly and kept warm at 25°C. After adding L-PPTDH, the reaction is started, the change in absorbance at 340nm is measured, and the enzyme activity of L-PPTDH is calculated, as shown in Table 2 below:

[0083] Table 2 Wild type / mutant L-PPTDH enzyme activity

[0084]

[0085] The enzyme activity in this application is defined as: the amount of enzyme required to convert 1 μmol PPO per minute under the above reaction conditions.

[0086] It can be seen from Table 2 that the obtained NADH-type L-phosphinothricin dehydrogenase mutants all have higher catalytic efficiency than wild-type PPTDH, and can catalyze the reductive amination reaction of PPO and generate L-PPT at low substrate concentrations (100mMPPO in this case). Among them, the mutation sites of the most active L-PPTDH mutant are the replacement of the 143rd amino acid residue A with S and the replacement of the 353rd amino acid residue M with V. The L-PPTDH mutant shows higher catalytic activity for the non-natural substrate PPO, and the enzyme activity is increased by more than 9.7 times compared with the wild-type L-PPTDH, and the cheap cofactor NADH can be used for the catalytic conversion of PPO, which is expected to be applied to the large-scale enzymatic production of L-phosphinothricin.

[0087] (7) Figure 2 The method shown in the figure is a green preparation of L-phosphinothricin ammonium by a multi-enzyme catalytic system.

[0088] According to the method in (2), the genetically engineered strains E. coli BL21 (DE3) / pET-30a-PPTDH-WT and E. coli BL21 (DE3) / pET-30a-PPTDH (A143S / M353V) capable of expressing L-phosphinothricin dehydrogenase were cultured, the bacterial cells were collected by centrifugation and freeze-dried, and stored at -20°C for subsequent reactions.

[0089] In a 3L reactor, 20 g / L E. coli BL21 (DE3) / pET-30a-PPTDH-WT and E. coli BL21 (DE3) / pET-30a-PPTDH (A143S / M353V) bacteria and 3000 U formate dehydrogenase (FDH) (purchased from Hunan Biolab Biotechnology Co., Ltd.) were added to 1600 mL of sodium phosphate buffer (pH 8.0, 100 mM) containing 300 mM, 400 mM and 500 mM PPO, 10 mM NADH, 500 mM ammonium formate, and 1% (v / v) defoamer. The pH was controlled at 7.5-8.5 by adding ammonia water, and the reaction was carried out at a temperature of 20-30 ° C for 1-6 hours. Samples were taken at regular intervals, and the content of L-PPT in the sample was determined by chiral high performance liquid chromatography, and the conversion rate was calculated. The results are as follows: Figure 1 shown.

[0090] Depend on Figure 1It can be seen that when the NADH type L-phosphinothricin dehydrogenase mutant described in Example 1 is used as a catalyst for catalytic reaction, over time, the concentration of PPO gradually decreases, and the concentration of L-PPT gradually increases. At a substrate concentration of 300mM, after the reaction is completed, the concentration of L-PPT detected by liquid phase is greater than 298mM, and the presence of D-PPT can hardly be detected. The conversion rate of the product PPO can reach up to 99.3%, and the reaction can be completed within 3h at the fastest. Under a higher substrate concentration (500mM), the mutant still shows excellent catalytic efficiency, and can catalytically convert and generate L-PPT greater than 496mM within 6h, with a conversion rate greater than 99.2%. It is shown that the mutant has the ability to efficiently catalyze L-phosphinothricin intermediate PPO to generate L-phosphinothricin at high substrate concentrations, and its conversion efficiency to substrate PPO is much higher than that of wild-type PPTDH, and it can use cheap cofactor NADH as a coenzyme to catalyze the reaction. The mutation sites of the NADH-type L-phosphinothricin dehydrogenase mutant are that the amino acid residue A at position 143 is replaced by S, and the amino acid residue M at position 353 is replaced by V.

[0091] Comparative Example 1:

[0092] The method of step (6) of Example 1 was used to calculate and compare the enzyme activity of the wild-type L-phosphinothricin dehydrogenase (E. coli BL21 (DE3) / pET-30a-PPTDH-WT) on the substrate PPO by monitoring the consumption of NADH. The results are shown in Table 2.

[0093] It can be seen that the enzyme activity of the wild-type L-phosphinothricin dehydrogenase is low, only 0.563 U / mg, indicating that its specific activity for the non-natural substrate PPO is low and it is difficult to be used for the enzymatic preparation of L-phosphinothricin.

[0094] Using the method of step (7) of Example 1, Figure 2 As shown, the catalytic efficiency of wild-type L-phosphinothricin dehydrogenase (E. coli BL21 (DE3) / pET-30a-PPTDH-WT) in catalyzing the reductive amination of high concentration (300 mM) PPO in the multi-enzyme catalytic system was compared by measuring the conversion rate of L-PPT. The results are shown in Figure 1 shown.

[0095] The conversion rate of L-PPT obtained by the wild-type L-phosphinothricin dehydrogenase after 6 hours of reaction was still less than 20%, indicating that it has a low catalytic conversion efficiency for the substrate PPO and cannot be applied to the large-scale green enzymatic preparation of L-phosphinothricin.

Claims

1. A NADH-dependent L-phosphinothricin dehydrogenase mutant, characterized in that: The wild-type L-phosphinothricin dehydrogenase having an amino acid sequence as shown in SEQ ID NO: 1 is subjected to A143G, A143S, M353V, A143G / M353V or A143S / M353V mutations.

2. A gene encoding the NADH-dependent L-phosphinothricin dehydrogenase mutant according to claim 1.

3. An expression vector containing the gene encoding the NADH-dependent L-phosphinothricin dehydrogenase mutant according to claim 2.

4. A genetically engineered bacterium containing the expression vector according to claim 3, characterized in that: The genetically engineered bacteria are obtained by introducing the expression vector as claimed in claim 3 into host cells through conventional transformation or transfection technology.

5. The genetically engineered bacterium according to claim 4, characterized in that: The host cell includes a prokaryotic or eukaryotic cell; belonging to the genus Saccharomyces, Aspergillus, Pichia, Yarrowia, Actinomycetes, Streptomyces, Bacillus or Escherichia.

6. The genetically engineered bacterium according to claim 5, characterized in that: The host cell is selected from Saccharomyces cerevisiae, Pichia pastoris, Streptomyces, Bacillus subtilis or Escherichia coli.

7. A method for constructing a genetically engineered bacterium according to claim 4, 5 or 6, characterized in that: The steps include: (1) determining the mutation site of NADH-dependent L-phosphinothricin ammonium dehydrogenase, designing site-directed mutagenesis primers, using the wild-type L-phosphinothricin ammonium dehydrogenase nucleotide sequence shown in SEQ ID NO: 2 as a template, performing a whole-plasmid PCR reaction, and obtaining a gene fragment having the amino acid mutation; (2) The gene fragment product obtained by PCR is subjected to enzyme digestion to remove the template DNA, and then the product is transformed into competent cells, and competent cells having the NADH-dependent L-phosphinothricin dehydrogenase mutant encoding gene are screened and obtained, and the recombinant expression vector is cultured and extracted; (3) The recombinant expression vector is transformed into an expression host cell to screen and obtain a genetically engineered bacterium that produces a NADH-dependent L-phosphinothricin dehydrogenase mutant.

8. Use of the NADH-dependent L-phosphinothricin dehydrogenase mutant according to claim 1 in the enzymatic preparation of L-phosphinothricin.

9. The use according to claim 8, characterized in that: Using 2-carbonyl-4-[hydroxy(methyl)phosphinoyl]butyric acid as a substrate, in the presence of an inorganic amino donor, using an NADH-dependent L-phosphinothricin ammonium dehydrogenase mutant to catalyze the substrate reductive amination to prepare L-phosphinothricin ammonium; the inorganic amino donor is ammonium sulfate or ammonium formate; The NADH-dependent L-phosphinothricin dehydrogenase mutant is the NADH-dependent L-phosphinothricin dehydrogenase mutant liquid enzyme, purified enzyme liquid or immobilized enzyme thereof as claimed in claim 1.

10. The use according to claim 8 or 9, characterized in that: The form of each enzyme in the enzyme catalytic system is independently selected from: free enzyme and / or host cell with enzyme expression vector introduced; wherein, based on the weight of wet bacteria, the ratio of the added amount of host cell with enzyme expression vector introduced to the total reaction liquid of the enzyme catalytic system is 1-200g / L.

11. The use according to claim 8 or 9, characterized in that: The inorganic amino donor is ammonium sulfate or ammonium formate; the enzyme-catalyzed conversion reaction is carried out in a reaction liquid system with a pH of 7-10, a reaction temperature of 25-45° C., and a reaction time of 1-6 hours.

Images