CNV marker of wnt2b gene in intersex pig and application

By detecting CNV markers in the WNT2B gene of intersex pigs and combining various technical methods, the problem of unclear pathogenic mechanisms of abnormal sex development in intersex pigs has been solved, enabling accurate disease detection and sex control, and promoting the advancement of livestock and poultry sex control technology.

CN116987784BActive Publication Date: 2026-04-14FOSHAN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311201360.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-18
Publication Date
2026-04-14
Estimated Expiration
2043-09-18

AI Technical Summary

Technical Problem

Current technologies provide limited understanding of the pathogenic mechanisms of sex development abnormalities in intersex pigs, especially the genetic variation of the WNT2B gene, which has not been studied in depth, and there is a lack of effective CNV markers for disease detection and sex control.

Method used

CNV markers of the intersex porcine WNT2B gene were detected using 10×Genomics de novo sequencing technology. Specific primers were designed for qPCR amplification using ATAC-seq and RNA-seq technologies. CNV distribution was detected using a CNVplex detection kit, and chromatin accessibility and transcript expression were analyzed using IGV software to screen for CNV markers associated with abnormal sex development.

Benefits of technology

It enables accurate detection of sex developmental abnormalities in intersex pigs and identification of pathogenic genes, providing effective means of disease detection and sex control, and promoting the development of livestock and poultry sex control technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116987784B_ABST
    Figure CN116987784B_ABST
Patent Text Reader

Abstract

The application discloses a CNV marker of WNT2B gene of intersex pigs and application, the marker is located in the WNT2B gene, and the gene candidate region is chr-4:107914901-107923000, and the application is used for pig breeding through the CNV marker of WNT2B gene.The 10xGenomics de novo sequencing technology is adopted in the application, and the sequencing depth reaches 60x, so that more than 99% of genome coverage is realized;the pathogenic gene causing 38, XX-DSD pig gender development abnormalities can be more accurately found.The distribution of the CNV in a pig population is detected in the application, and the ATAC-seq and RNA-seq sequencing technologies are also adopted, so that the reliability of the WNT2B gene CNV marker is verified from the chromatin accessibility and the expression amount of transcripts.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular genetic breeding technology and molecular diagnostics, specifically the CNV marker and application of the WNT2B gene in intersex pigs. Background Technology

[0002] 38,XX-DSD, SRY-negative pigs (38,XX disorder of sex development, SRY-) are pigs with a 38,XX karyotype that exhibit abnormalities during sex development, resulting in inconsistencies in gonadal phenotype and external genitalia. Specifically, 38,XX-DSD pigs can develop testes or ovotestes even without a Y chromosome. Research on this sex developmental abnormality is of significant scientific and practical importance for exploring the mechanisms of sex determination and differentiation in pigs, as well as for conducting genetic diagnosis. Under normal circumstances, sex determination in boars and sows is heterozygous, determined by sex-determining genes on the Y chromosome (such as the SRY gene). However, the existence of 38,XX-DSD pigs suggests that other genes on autosomes may partially substitute for the function of the SRY gene or influence the regulation of sex-related genes. In-depth exploration of these potential genes and regulatory networks, as well as their roles in sex development, can further reveal the genes related to pig sex development and their regulatory elements, providing valuable information for pig genetic improvement and gene diagnosis. Furthermore, pigs serve as an animal model for abnormal sex development in humans. Comparing the mechanisms of abnormal sex development in pigs and humans can help understand and address human sex development disorders, thereby improving gene diagnosis and gene therapy. However, intersexuality is a complex disease with multiple causes, including genetic mutations, chromosomal abnormalities, and hormonal signaling pathway disorders. Due to its multifactorial nature, our understanding of the pathogenic mechanisms of sex development disorders is still limited and requires further research.

[0003] Copy number variation (CNV) is the phenomenon of variation in the copy number of a specific region of the genome among individuals or populations. Compared to single nucleotide polymorphisms (SNPs), CNVs involve larger genomic segments and can involve one or more genes. CNVs are common in humans and other species. They can be naturally occurring genetic variations or generated through mechanisms such as mutation, gene rearrangement, or chromosomal recombination. CNVs play a crucial role in human genetics and disease research, and are often associated with the risk of developing hereditary diseases and various complex diseases. Copy number variations can affect gene expression levels and regulatory functions, thus significantly impacting an individual's physiology, development, and disease susceptibility. In-depth research on CNVs is essential for understanding the role of genetic variation and the mechanisms of disease development.

[0004] The WNT2B gene (Wingless-type MMTV integration site family member 2B) is a member of the WNT family and a ligand and activator of the classic WNT / β-catenin pathway. Studies have shown that the WNT2B gene is involved in the formation of the urogenital system. Furthermore, the WNT4 gene also plays a role in both pathways, acting as an important agent in mammalian embryonic development and ovarian development. Notably, WNT / β-catenin signaling is also involved in the expansion of undifferentiated spermatogonia before testicular meiosis. However, to date, no studies have been reported on the correlation between WNT2B gene genetic variations and intersex pigs. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art, provide a CNV marker for the WNT2B gene in intersex pigs and its application, screen CNV molecular markers related to abnormal pig sex development traits, and provide a CNV marker related to a key pathogenic gene in 38,XX-DSD pigs.

[0006] The objective of this invention is achieved through the following technical solution: a CNV marker for the intersex porcine WNT2B gene, the marker being located at chr-4:107914901-107923000 of the WNT2B gene reference genome sequence NC_010454.4.

[0007] This invention classifies pathogenic factors in intersex pigs by detecting CNV markers, and has broad application prospects, particularly in further validating the function of the WNT2B gene CNV. It also holds promise for applications in disease detection, livestock sex control technology, and disease treatment. To achieve highly accurate genomic mutation detection, this invention employs 10× Genomics de novo sequencing technology with a sequencing depth of 60×, achieving over 99% genome coverage. This deep sequencing enables more accurate identification of pathogenic genes causing sex development abnormalities in 38,XX-DSD pigs. This invention also utilizes ATAC-seq and RNA-seq technologies to verify the reliability of the WNT2B gene CNV from the perspectives of chromatin accessibility and transcript expression levels.

[0008] Furthermore, the internal reference genes for CNVs were two copies of the β-actin gene (ACTB), two copies of the collagen type X alpha 1 chain gene (COL10A1), and two copies of the glucagon gene (GCG). The distribution of candidate CNVs in the 38,XX-DSD population was detected using a CNVplex detection kit, and validation primers for CNVs were designed.

[0009] Furthermore, the primers for the CNV marker are:

[0010] WNT2B_1-F:AGGGGAAAGGTTTGGCATTCAG;

[0011] WNT2B_1-R:ACCTTGGAGAGGTTCCTTTCCCT;

[0012] WNT2B_2-F:AAGTAGGGGTTGGACTGGAGCTG;

[0013] WNT2B_2-R:ATGGGAATGAACAAGGGGTGAAT;

[0014] The primers for the internal reference gene are:

[0015] ACTB-F:CGGTTTCAGCGCCTTGAGAA;

[0016] ACTB-R:GTGGCCCTCAGGTGATCAGAGT;

[0017] COL10A1-F:GGAATCCTGAGAAAGAGGAGTGGA;

[0018] COL10A1-R:CGTACTCAGAGGAGTACAGCCCGT;

[0019] GCG-F:GCCTGGAGTCCAGATACTTGCTGT;

[0020] GCG-R:AGTCACTGGTAAACGTGCCCTGT.

[0021] Furthermore, we simultaneously selected 1-month-old normal sows (38,XX) and 38,XX-DSD, SRY-negative sows, all 1 month old. We used ATAC-seq and RNA-seq bw files from gonadal tissues to perform association analysis on the two using IGV (Integrative GenomicsViewer) software to examine the chromatin accessibility and transcript expression level of the WNT2B gene.

[0022] The application of CNV markers for the WNT2B gene in intersex pigs: The CNV markers for the WNT2B gene in intersex pigs are used for breeding pig selection, effectively screening out harmful individuals and controlling sex, and play an important role in the study of sex development abnormalities in 38,XX-DSD pigs.

[0023] The beneficial effects of this invention are as follows: This invention uses the chr-4:107914901-107923000 of the pig WNT2B gene reference genome sequence as a CNV marker. Using specific primer pairs, qPCR technology is employed to amplify the CNV region and the internal reference gene, detecting copy number variations of this marker in a pig population. The operation is simple, and the results are accurate and reliable. Furthermore, combining ATAC-seq and RNA-seq technologies provides a more comprehensive analysis of the WNT2B gene, revealing its chromatin accessibility status and transcript expression, further promoting the understanding of the gene's function and regulatory mechanisms. This facilitates its application in livestock and poultry sex control technology and promotes the selection of breeding pigs. Attached Figure Description

[0024] Figure 1 This is the copy number distribution of CNV in the group verification of this invention;

[0025] Figure 2 IGV visualization of WNT2B gene expression in ATAC-seq and RNA-seq data of gonadal tissues from 38,XX-DSD pigs and normal sows of this invention. Detailed Implementation

[0026] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings, but the scope of protection of the present invention is not limited to the following description.

[0027] The specific process for identifying CNV markers related to abnormal sex development in pigs is as follows:

[0028] 1. 10×Genomics de novo sequencing:

[0029] One normal sow (38,XX) and two 38,XX-DSD sows underwent 10× Genomics sequencing at a depth of 60×, followed by de novo genome assembly and variant analysis. Trimmomatic v0.38 software was used to filter the sequencing data, SOAP-de novo was used for assembly, and BUSCO software, based on the OrthoDB database, was used to compare the assembly results with single-copy orthologous gene sets to assess the integrity of the genome assembly relative to conserved genomes, thereby inferring genome integrity. Potential deletions and duplications were identified by varying read coverage depths across the genome. In the 38,XX-DSD sows, a copy number duplication was found in the WNT2B gene reference genome sequence at chr-4:107914901-107923000, indicating the presence of a CNV in this gene region.

[0030] 2. CNV verification:

[0031] The distribution of CNVs in 10 38,XX-DSD pigs and 10 normal sows (38,XX) was detected using the CNVplex detection kit. The specific procedures are as follows:

[0032] (1) Primer design: The β-actin gene (ACTB), the collagen type X alpha 1 chain gene (COL10A1), and the glucagon gene (GCG), all known to have two copies, were used as reference genes. Based on the type or size of the structural variation, a pair of probe primers were designed at both ends of the site. The upstream probe consisted of a 5' universal primer sequence, a site-identifying ligation sequence, and a 5' side-specific sequence. The downstream probe sequence consisted of a 3' side-specific sequence, a site-identifying ligation sequence, a 3' universal primer sequence, or a ligation-specific probe sequence.

[0033] The primers for the CNV marker are:

[0034] WNT2B_1-F:AGGGGAAAGGTTTGGCATTCAG (SEQ ID NO.1);

[0035] WNT2B_1-R:ACCTTGGAGAGGTTCCTTTCCCT(SEQ ID NO.2);

[0036] WNT2B_2-F:AAGTAGGGGTTGGACTGGAGCTG (SEQ ID NO.3);

[0037] WNT2B_2-R:ATGGGAATGAACAAGGGGTGAAT (SEQ ID NO.4);

[0038] The primers for the internal reference gene are:

[0039] ACTB-F:CGGTTTCAGCGCCTTGAGAA (SEQ ID NO.5);

[0040] ACTB-R:GTGGCCCTCAGGTGATCAGAGT (SEQ ID NO. 6);

[0041] COL10A1-F: GGAATCCTGAGAAAGAGGAGTGGA (SEQ ID NO.7);

[0042] COL10A1-R:CGTACTCAGAGGAGTACAGCCCGT (SEQ ID NO.8);

[0043] GCG-F:GCCTGGAGTCCAGATACTTGCTGT (SEQ ID NO.9);

[0044] GCG-R: AGTCACTGGTAAACGTGCCCTGT (SEQ ID NO. 10);

[0045] (2) Sample lysis: Add 4 μL of DNA sample to a 96-well plate, then add 2.5 μL of 4×DNAlysis buffer, add sterile water to make up to 10 μL, cover with sealing film, mix with a 96-well plate centrifuge, react at 98°C for 5 minutes on a PCR instrument, and then place on ice.

[0046] (3) Ligation reaction: Prepare a 20 μL premixed solution, which contains 2 μL 10×Ligase Buffer, 0.5 μL Ligase, 10 μL Probe Mix, and 7.5 μL ddH2O;

[0047] The reaction conditions were as follows: 4 cycles of reaction at 94℃ for 1 min, 60℃ for 4 h; 94℃ for 2 min; 70℃ for 1 min. After the reaction was complete, 20 μL of 20 mM EDTA was added.

[0048] (4) Multiplex fluorescent PCR reaction: Prepare a 20 μL premixed solution, which includes 10 μL 2×PCR Master Mix, 1 μL Limer Mix, 1 μL Ligation Prduct, and 8 μL ddH2O;

[0049] The reaction process is as follows: (1) denaturation at 95℃ for 2 min; (2) 30 cycles, each cycle including denaturation at 94℃ for 20 s, annealing at 57℃ for 40 s, and extension at 72℃ for 15 min; (3) 60℃ for 1 min. Store at 4℃.

[0050] (5) Fluorescent capillary electrophoresis: After the PCR amplification product was sequenced and diluted 15 times, 1 μL, 0.5 μL Liz500 SIZESTANDARD and 8.5 μL Hi-Di were mixed and denatured at 95℃ for 5 minutes. Then, fluorescent capillary electrophoresis was performed on an ABI3730XL sequencer.

[0051] (6) Data Analysis: The collected raw data was analyzed using GeneMapper 5.0 (Applied Biosystems, USA). The absolute copy number was calculated as follows:

[0052] ① Calculate the ratio (R value) of the peak relative to the reference peak in each detection site region using the peak height value (H value): e.g., R (detection gene) = H (detection gene) / H (reference gene);

[0053] ② Divide the R value of each detection gene in 38,XX-DSD by the corresponding R value of the normal sow, and then multiply by the copy number of the target region in the normal sow to obtain the copy number of each target region in 38,XX-DSD. For example: if the RR (detection gene) of 38,XX-DSD pigs is 0.5, the RR (reference gene) of normal sows is 1, and the copy number of the target gene in the control sample is 2, then the copy number of 38,XX-DSD pigs is 0.5 / 1×2=1.

[0054] The results are as follows Figure 1 As shown, an increase in the copy number of the WNT2B gene was observed in one 38,XX-DSD pig, consistent with the results in Example 1. The copy number of normal sows was 2, indicating no deletions or duplications. This suggests a correlation between the CNV of the WNT2B gene and 38,XX-DSD pigs, and that WNT2B can be accurately detected as one of the pathogenic factors in 38,XX-DSD pigs, allowing for further subdivision of the pathogenic type in diseased pigs.

[0055] [Note]: Figure 1 The "copy number 2" indicates that the gene or region has two copies, which is the copy number under normal conditions.

[0056] "Copy number 3" means that the gene or region has three copies, which is 3 / 2 of the normal copy number.

[0057] 3. ATAC-seq and RNA-seq data of gonadal tissues from one-month-old 38,XX-DSD pigs and normal sows (38,XX) were visualized and analyzed using IGV (Integrative Genomics Viewer) software:

[0058] Chromatin accessibility information was examined using the bw files of gonadal ATAC-seq and RNA-seq sequencing data from three 38,XX-DSD and three normal (38,XX) one-month-old sows with differential WNT2B gene expression levels:

[0059] (1) Obtain pig genome data: It is necessary to obtain the bw file of the pig genome sequence and the corresponding annotation file in order to load and view the pig genes in IGV;

[0060] (2) Open the IGV software: Double-click to open the installed IGV software and start the application;

[0061] (3) Load pig genome data: In the top menu of IGV, select "File", then select "LoadGenome from File", navigate to the stored pig WNT2B genome sequence file and load it;

[0062] (4) Load pig gene annotation data: In the top menu of IGV, select "File", then select "Load Annotations", then navigate to the stored pig gene annotation file and load it;

[0063] (5) Navigate to the WNT2B gene location: In the search box of the top toolbar of IGV, enter "WNT2B" to search for and locate the WNT2B gene;

[0064] (6) View the WNT2B gene: The WNT2B gene is visualized in the main window of IGV. You can zoom in or out and use the mouse to navigate and browse.

[0065] The test results are as follows: Figure 2 As shown, from Figure 2It can be seen that the chromatin accessibility of the promoter region upstream of the WNT2B gene differed significantly between 38,XX-DSD pigs and normal sows (38,XX) (boxed area). The chromatin accessibility of the WNT2B gene promoter region was higher in 38,XX-DSD pigs than in normal sows. Correspondingly, the transcript expression level of the WNT2B gene was higher in 38,XX-DSD pigs than in normal sows. The average expression level of the WNT2B gene in normal sows was 5.38 times that in 38,XX-DSD pigs, according to RNA-seq results. The results indicate that the chromatin accessibility and transcript expression level of the gonadal WNT2B gene promoter were altered in both diseased and normal sows, suggesting that the WNT2B gene plays a regulatory role in gonadal development.

[0066] This invention selects a CNV located in the candidate region of the WNT2B gene, which plays an important role in regulating the expression and function of the WNT2B gene. This enables the invention to accurately detect whether the pathogenic gene in 38,XX-DSD pigs is a CNV in the candidate region of the WNT2B gene, and it can also serve as one of the molecular markers for detecting 38,XX-DSD pigs. This provides strong support for research on the regulatory mechanism of the WNT2B gene, disease detection, livestock sex control technology, and disease treatment.

[0067] The above description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or related technologies or knowledge. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.

Claims

1. The application of CNV markers for the intersex porcine WNT2B gene, characterized by: The CNV marker of the intersex pig WNT2B gene was used for breeding pig selection. The CNV marker is located at chr-4:107914901-107923000 of the WNT2B gene reference genome sequence NC_010454.

4. The internal reference genes of the CNV are two copies of the β actin gene, two copies of the X-type collagen α1 chain gene, and two copies of the glucagon gene. The primers for the CNV tag are: WNT2B_1-F:AGGGGAAAGGTTTGGCATTCAG; WNT2B_1-R:ACCTTGGAGAGGTTCCTTTCCCT; WNT2B_2-F:AAGTAGGGGTTGGACTGGAGCTG; WNT2B_2-R:ATGGGAATGAACAAGGGGTGAAT; The primers for the internal reference gene are: ACTB-F:CGGTTTCAGCGCCTTGAGAA; ACTB-R:GTGGCCCTCAGGTGATCAGAGT; COL10A1-F:GGAATCCTGAGAAAGAGGAGTGGA; COL10A1-R:CGTACTCAGAGGAGTACAGCCCGT; GCG-F:GCCTGGAGTCCAGATACTTGCTGT; GCG-R:AGTCACTGGTAAACGTGCCCTGT; The marked pigs were 38,XX-DSD,SRY-negative pigs among intersex pigs.

Citation Information

Patent Citations

  • WWOX gene molecular marker related to porcine intervenereal disease and application of WWOX gene molecular marker

    CN116463413A

  • Markers using variation in hair color gene in white haired swine and method for fixation and selection of white hair color using the same

    KR1020120109069A