A LCORL gene marker related to growth and slaughter performance of meat pigeons and its application

Abstract

The invention provides an LCORL gene marker related to the growth and slaughter performance of meat pigeons and an application thereof, belonging to the technical field of molecular markers. The LCORL gene SNP marker related to the growth and slaughter performance of meat pigeons provided by the invention is a single base insertion frameshift mutation on exon7 of the LCORL gene, and the insertion frameshift mutation is an insertion frameshift mutation ‑>C located at the physical position 15122265 on the pigeon reference genome Assembly Cliv_1.0NW_004973253.1Scaffold. This SNP marker can be used for molecular marker-assisted selection of meat pigeons, accelerate breeding genetic progress and improve the accuracy of selection.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, in particular to an LCORL gene marker related to the growth and slaughter performance of meat pigeons and an application thereof. Background Art

[0002] my country is one of the countries with the largest number of meat pigeons in the world. The main meat pigeon breeds raised in my country are all from foreign countries, such as European meat pigeons, king pigeons, and carnosine pigeons. Due to the lack of attention to breeding after introduction and hybridization between breeds, degeneration and loss of excellent traits have occurred. At the same time, the current commercial breeding of meat pigeons mainly relies on phenotypic breeding, with slow genetic progress and low selection accuracy. With the development of high-throughput sequencing typing technology, more and more molecular markers have been applied to animal breeding and have achieved remarkable results. However, compared with livestock and poultry such as chickens, pigs, cattle, and sheep, the research on molecular breeding of meat pigeons lags behind, especially the lack of effective molecular markers related to the growth and slaughter traits of meat pigeons. Therefore, using high-throughput sequencing technology to mine markers that affect the growth and slaughter traits of meat pigeons and perform phenotypic verification, the development of molecular markers used in meat pigeon breeding can improve the accuracy of meat pigeon breeding and accelerate genetic progress.

[0003] In the early stage, our team detected the selection signals of commercial meat pigeon breeds and local breeds and found that the LCORL gene is an important candidate gene affecting the body shape of pigeons. This gene has undergone strong artificial selection in the meat pigeon population and is highly correlated with weight, body length, keel length and tibia length. Many studies have reported that the LCORL gene is related to the height phenotype of humans. In the animal field, the LCORL gene has been determined to be related to the height or body shape of dogs, cattle, horses, donkeys, pigs, sheep and chickens.

[0004] According to our research, the NCAPG / LCORL locus has a high phenotypic explanation rate for pigeon growth and development traits, especially weight and body shape, which indicates that it plays an important role in the growth and development of bones and muscles in pigeons. Therefore, detecting molecular marker polymorphisms of the LCORL gene and developing molecular markers related to slaughter traits of meat pigeons will help accelerate breeding genetic progress and improve the accuracy of selection. Summary of the invention

[0005] The purpose of the present invention is to provide an LCORL gene marker related to the growth and slaughter performance of meat pigeons and its application, which can be used for molecular marker-assisted selection of meat pigeons, accelerate breeding genetic progress and improve the accuracy of selection.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a LCORL gene SNP marker associated with the growth and slaughter performance of meat pigeons. The SNP marker is an insertion frameshift mutation on exon7 of the LCORL gene. The insertion frameshift mutation is an insertion frameshift mutation -> C located at a physical position 15122265 on the pigeon reference genome Assembly Cliv_1.0NW_004973253.1Scaffold.

[0008] Preferably, the DNA sequences of the two PCR primers and one UEP primer for the SNP marker are shown as SEQ ID No. 1-3.

[0009] The present invention also provides application of the LCORL gene SNP marker in meat pigeon breeding.

[0010] The present invention also provides the homozygous genotype of the LCORL gene SNP marker for improving the growth and slaughter performance of meat pigeons.

[0011] The invention provides an LCORL gene marker related to the growth and slaughter performance of meat pigeons and an application thereof, which can be used for molecular marker-assisted selection of meat pigeons, accelerate breeding genetic progress and improve selection accuracy. DETAILED DESCRIPTION

[0012] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0013] Example 1

[0014] Primer design

[0015] SNP sequence arrangement: According to the sequence information of the pigeon reference genome (Cliv_1.0), a gDNA sequence fragment of 402 bp including the SNP site to be detected was obtained as shown in SEQ ID No. 4, which is as follows:

[0016] TGCAAAGAAATCTACAAAAAAAAATTGATAAAATATATCCAAATAAAAACCACAGTTTTACTGTGATAGAAGATGAGGCTTTGCAACATCTTGAGAGTAATCCGTGCACGAATTGCCAGACCAAACCAATGTGCTTTCCAGTACACCAAACAGAGTCTTTCAAACTACCTCTTACTAATTTTCAAACCAGCTCCAGCTTTCT[ / C]ATTTTTTCAGAAAACAGTGCTATTGCCACCAGCCAG CCAGACCTCGCAAAAACACAAGGAGATTGTGCAACCTTAAAAGAGATTGATCATATTCCTCTACAGGATGAGAGTATTGGAATCCTGGGCAGAACTAAACGTAACGTTGTGCCTCCTGGATGGTACTCTGTGTATGTAACGAACA ATATTGTGTTTAGTAAGTC

[0017] The primers for the SNP sites to be tested were designed using Agena's Assay Designer 4.0 software. Three primers corresponding to the SNP sites to be tested were synthesized using the PAGE primer purification method, which were two primers and one UEP primer. The sequences were shown in SEQ ID No. 1-3. The specific PCR primer sequences are as follows:

[0018] 1st-PCRP:ACGTTGGATGGTGGCAATAGCACTGTTTTC (forward primer 5'->3') (SEQ ID No.1)

[0019] 2nd-PCRP:ACGTTGGATGCCAGTACACCAAACAGAGTC (reverse primer 5'->3') (SEQ ID No. 2)

[0020] During the design, in order to ensure that the molecular weight of the primers is similar and the Tm value and CG% content are within the optimal range, an ACGTTGGATG sequence tag is added to the 5' end of the primer.

[0021] Single base extension primer sequence

[0022] UEP_SEQ ID No.3:ACCAGCTCCAGCTTTCT

[0023] Example 2

[0024] 2.1 Main reagents and instruments

[0025] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; Eppendorf, German low-speed centrifuge; 0.1-2.5μl, 0.5-50μl, 50-200μl, 200-1000μl pipettes; blood genome extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dye were all purchased from Beijing Solebow Technology Co., Ltd.; Gold Medal Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad.

[0026] Sample collection

[0027] 2.2 Sample collection

[0028] Shanghai Jinhuang Pigeon Industry Co., Ltd. collected blood samples from 136 28-day-old European meat pigeons. 1 mL of blood was collected from the wing vein of each squab and placed in an EDTA-K2 anticoagulant blood collection tube for subsequent DNA extraction.

[0029] 2.3 Extraction of genomic DNA from blood

[0030] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The NanoDrop2000 instrument was used to detect the OD value of all DNA samples, and the DNA quality was detected by 1.25% agarose gel electrophoresis. The DNA concentration was required to be 20ng / μL, the OD260 / OD280 value was between 1.6-2.2, the OD260 / 230 value was >0.6, there was no absorption peak at OD230nm, the DNA electrophoresis results had clear bands, and the gDNA was intact without severe degradation (as the template DNA for the subsequent PCR amplification reaction).

[0031] 2.4 PCR amplification reaction

[0032] The gene fragment containing the SNP site in the gDNA genome obtained in 2.3 above was amplified.

[0033] 1) Prepare PCR mixture in a 1.5 ml EP tube and centrifuge at low speed with shaking. The reaction components are shown in Table 1.

[0034] Table 1 Components of each reagent in the PCR mixture

[0035] PCR master mix reaction components content volume Water,HPLC grade NA 1.850μl <![CDATA[PCR Buffer with 15mM MgCl2]]> 1.25x 0.625μl <![CDATA[MgCl2(25mM)]]> 1.625mM 0.325μl dNTP Mix (25 mM each) 500μM 0.100μl Primer Mix (500nM each) 100μM 1.000μl HotStar Taq (5U / μl) 0.5U / rxn 0.100μl Total - 4.000μl

[0036] 2) Use an 8- or 12-channel pipette to add 4 μl of PCR mastermix to each well of a 384-well plate. Finally, add 1 μl of template DNA (20 ng / μl) and mix well, for a total of 5 μl. Carefully cover the plate with a sealing film and press each well firmly to prevent evaporation during the PCR process. Centrifuge at 1000 rpm for 1 min.

[0037] 3) According to the PCR amplification reaction program in Table 2, the 384-well reaction plate in step 2) is placed on a PCR instrument, and the program is started. The length of the obtained product is between 100-200 bp.

[0038] Table 2 PCR amplification reaction program

[0039]

[0040] 4) Alkaline phosphatase (SAP) reaction

[0041] SAP mix was prepared according to the SAP reaction components in Table 3, and the SAP mix was added to the 384-well reaction plate after amplification in step 3). The total reaction volume of each reaction well was 7 μl, including 5 μl of the PCR reaction product in step 3) and 2 μl of SAP mix.

[0042] Set the SAP reaction program: 37°C for 20 min; 85°C for 5 min; 4°C∞. Place the 384-well reaction plate on the PCR instrument and start the program.

[0043] Table 3 SAP reaction components

[0044] SAP reaction components content volume Water(HPLC grade) NA 1.53μl SAP Buffer 10x 0.17μl SAP Enzyme 1U / μl 0.30μl Total volume - 2.00μl

[0045] 5) Single base extension reaction: The single base extension reaction system includes 2 μl of EXTEND Mix in Table 4 and 7 μl of SAP+PCR reaction after the alkaline phosphatase (SAP) reaction in step 4), for a total of 9 μl. The extension reaction procedure is shown in Table 5.

[0046] Table 4 Extension reaction system

[0047] Extension Reaction Components content volume Water(HPLC grade) NA 0.619μl iPLEX Buffer Plus 0.222x 0.200μl iPLEX Termination mix 1x 0.200μl Primer Mix (7μM:14μM) 0.625μM:1.25μM 0.940μl iPLEX Enzyme 1x 0.041μl Volume - 2μl

[0048] Table 5 Extension reaction program

[0049]

[0050]

[0051] The product sequence of the single base extension reaction is shown in SEQ ID No.5-6, which is as follows:

[0052] EXT1_SEQ ID No.5:ACCAGCTCCAGCTTTCTC (the product sequence after the single base extension mutation base 1, which is the LCORL gene mutation)

[0053] EXT2_SEQ ID No.6:ACCAGCTCCAGCTTTCTA (the product sequence after the single base extension mutation base 2, which is the wild type)

[0054] 2.5 Resin purification

[0055] 1) Fill the 384 / 6MG Dimple plate with resin evenly and leave it for 10 minutes to dry.

[0056] 2) Add 16 μL of water to each well of the 384-sample plate.

[0057] 3) Gently turn the 384 sample plate over and place it on the Dimple plate, turn the Dimple and 384 sample plates over, and then tap them gently to allow the resin to fall into each well of the sample plate.

[0058] 4) Place the 384 sample plate in a flip centrifuge and rotate to mix at room temperature for 30 minutes.

[0059] The MassARRAY Nanodispenser RS1000 was started to transfer the 18pb extension product after resin purification to the 384-well SpectroCHIP bioarray. The spotted SpectroCHIP chip was analyzed using a MALDI-TOF mass spectrometer, and the detection results were used to obtain the original genotyping data using TYPER4.0 software.

[0060] 2.6 Data collation and analysis

[0061] According to the genotyping results, the number of individuals with different genotypes at each site was counted. The allele frequency and genotype frequency of the LCORL gene SNP (p.L640fs) were calculated using excel software, and the results are shown in Table 6.

[0062] Table 6 Allele frequency and genotype frequency of SNP (p.L640fs) in LCORL gene of meat pigeon

[0063]

[0064] As shown in Table 6, at the (p.L640fs) SNP locus, the C.DEL genotype frequency is the highest, which is the dominant genotype, and the DEL allele frequency is 0.647, which is a dominant allele. The χ2 fitness test shows that the SNP locus is in Hardy-Weinberg equilibrium (P>0.05). The expected heterozygosity of this locus is 0.457, the PIC is 0.457, 0.25<PIC<0.50, and it is moderately polymorphic.

[0065] The general linear model in IBM SPSS Statistics 25 software was used to analyze the association between different genotypes of European meat pigeons and growth and slaughter traits. The results are expressed as "mean ± standard error".

[0066] Table 7 Association analysis between LCORL gene mutation (p.L640fs) and growth traits in meat pigeons

[0067] DEL C.DEL CC Significance p.L640fs 55 66 15 Live weight <![CDATA[532.49±71.13 a ]]> <![CDATA[529.67±52.86 a ]]> <![CDATA[566.93±78.35 b ]]> 0.112485 Body obliquely long 14.39±1.29 14.29±1.17 14.37±1.26 0.958285 Keel length 8±0.53 8.1±0.47 8.19±0.59 0.262996 Deep chest 71.44±3.12 72.25±3.29 72.59±3.23 0.178753 Chest width <![CDATA[66.39±6.13 a ]]> <![CDATA[66.57±4.61 a ]]> <![CDATA[69.69±5.32 b ]]> 0.091347 Shin length <![CDATA[40.91±1.52 A ]]> <![CDATA[41.13±1.87 AB ]]> <![CDATA[42.15±2.26 B ]]> 0.026657 Shin circumference <![CDATA[2.23±0.15 a ]]> <![CDATA[2.2±0.13 ab ]]> <![CDATA[2.29±0.21 b ]]> 0.11036 Chest muscle thickness <![CDATA[15.25±2 a ]]> <![CDATA[15.59±1.89 a ]]> <![CDATA[16.6±1.92 b ]]> 0.073924 Carcass weight 463.2±65.7 463.88±50.97 494.33±67.32 0.160905 Heavy feet <![CDATA[9.08±1.18 a ]]> <![CDATA[9.15±1.21 a ]]> <![CDATA[9.83±1.53 b ]]> 0.068969 Wings weight <![CDATA[64.19±8.43 A ]]> <![CDATA[64.16±7.87 A ]]> <![CDATA[70.53±9.53 B ]]> 0.019494 Chest muscle weight 96.77±21.8 97.89±17.11 104.76±20.02 0.388772 Leg muscle weight 26.49±4.9 26.52±4.39 28.07±4.3 0.462958 Half eviscerated weight <![CDATA[422.87±62.56 a ]]> <![CDATA[424.92±48.24 a ]]> <![CDATA[458.33±62.57 b ]]> 0.081187 Full eviscerated weight <![CDATA[352.22±55.12 a ]]> <![CDATA[352.92±42.92 a ]]> <![CDATA[380±53.36 b ]]> 0.1279 Slaughter rate 0.87±0.02 0.88±0.02 0.87±0.03 0.490383 Half-eviscerated rate <![CDATA[0.79±0.03 a ]]> <![CDATA[0.8±0.03 ab ]]> <![CDATA[0.81±0.03 b ]]> 0.169551 Full Eviscerated Rate 0.66±0.03 0.67±0.03 0.67±0.03 0.520042

[0068] As shown in Table 7, the live weight, chest width, chest muscle thickness, half-eviscerated weight and full-eviscerated weight of the CC genotype of the European meat pigeon LCORL gene mutation (p.L640fs) were significantly higher than those of the DEL homozygous and C.DEL heterozygous genotypes (P<0.05), the shank circumference and half-eviscerated rate of the CC genotype were significantly higher than those of the DEL homozygous genotype (P<0.05), the wing weight of the CC genotype was significantly higher than that of the DEL homozygous and C.DEL heterozygous genotypes (P<0.01), and the shank length of the CC genotype was significantly higher than that of the DEL homozygous genotypes (P<0.01). This shows that the growth and slaughter performance of the CC genotype are better than those of the DEL homozygous and C.DEL heterozygous genotypes. In summary, the LCORL gene mutation (p.L640fs) will affect the growth and slaughter traits of meat pigeons. Genotyping can be used to determine whether the site is CC, C.DEL heterozygous and DEL homozygous genotypes. The CC genotype has better growth and slaughter performance and can be used as a molecular marker for auxiliary selection breeding of meat pigeons.

[0069] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of a LCORL gene SNP marker related to the growth and slaughter performance of meat pigeons in meat pigeon breeding, characterized in that: The SNP marker is a single base insertion frameshift mutation on exon7 of the LCORL gene, and the insertion frameshift mutation is an insertion frameshift mutation -> C located at the physical position 15122265 on the pigeon reference genome Assembly Cliv_1.0NW_004973253.1Scaffold. The gDNA sequence fragment of the SNP marker is shown in SEQ ID No.

4.

2. The use according to claim 1, characterized in that: The DNA sequences of the two PCR primers and one UEP primer of the SNP marker are shown in SEQ ID No. 1-3.

3. The use according to claim 2, characterized in that The homozygous genotype of the LCORL gene SNP marker is used to improve the growth and slaughter performance of meat pigeons.

Images