A blood sample DNA extraction kit and nucleic acid extraction method

Abstract

The present invention discloses a blood sample DNA extraction kit and a nucleic acid extraction method. The blood sample DNA extraction kit comprises: a nucleic acid treatment solution, a nucleic acid rinse solution and an elution buffer; wherein the nucleic acid treatment solution comprises a lysate, a proteinase K solution and a magnetic bead suspension, and the lysate comprises: a guanidine compound, bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, ethoxylated sclerol, dextran-70, sodium chloride, polyvinylpyrrolidone and water. The blood sample DNA extraction kit of the present invention is carefully designed and optimized, showing significant advantages, especially being able to achieve high-purity and high-concentration DNA extraction. Through the optimized lysate formula and highly adapted design, the kit not only has outstanding extraction efficiency, is easy to operate, and has strong versatility and flexibility, can be widely applied to different experimental conditions and equipment, meets diverse experimental needs, and provides valuable support for subsequent molecular biology research.

Description

Technical Field

[0001] The invention relates to a blood sample DNA extraction kit and a nucleic acid extraction method. Background Art

[0002] DNA is the basic unit of genetic information. It stores an individual's genetic information, including gene sequences and other genetic variations. It is the main object of molecular biology research. The premise of conducting gene-related research is to obtain high-quality DNA, so DNA extraction is a basic and key technology. The most commonly used sample in clinical diagnosis is blood sample. By extracting blood DNA, the genetic information of an individual can be obtained for use in genetic testing, disease diagnosis and research.

[0003] The current extraction methods include salting out, adsorption column, magnetic bead, etc. Existing kits basically use adsorption column and magnetic bead methods. Among them, the centrifugal column method has better extraction purity, but this method requires multiple centrifugation, which is not suitable for automated operation. The extraction of a large number of samples takes a long time. The magnetic bead method has the advantages of simple operation, high yield and high purity. It is suitable for large-scale DNA extraction, high-throughput automated processing and clinical diagnosis.

[0004] Blood DNA extraction reagents are mainly used to extract DNA from blood samples and are widely used in genomics research, clinical diagnosis and other fields. This technology mainly includes the following aspects:

[0005] Lysis: Lysis is one of the key steps in blood DNA extraction. This step uses a lysis solution to destroy the cell membrane and nuclear membrane, releasing DNA into the solution.

[0006] Protease treatment: During the blood DNA extraction process, protease needs to be added to digest proteins on the cell membrane, such as nuclear proteins and membrane proteins. This step helps to improve the purity and quality of DNA.

[0007] Alcohol precipitation: To further purify the DNA, it is often precipitated using alcohol such as ethanol or isopropanol.

[0008] Washing: Washing is to remove impurities and residual reagents from the precipitate. Ethanol or isopropanol is usually used for washing to remove undissolved salts and other contaminants. In addition, a series of washing steps can be performed using buffers to ensure the purity and quality of the extracted DNA.

[0009] At present, blood DNA extraction kits have developed into an efficient, fast, convenient and reliable technology. Kits produced by different manufacturers may use different principles and improved methods, but the quality of extracted DNA still has room for improvement. Summary of the invention

[0010] The blood sample DNA extraction kit and nucleic acid extraction method of the present invention mainly obtain DNA with higher purity and higher concentration by improving the lysis solution, and are simple to operate and suitable for large-scale sample processing.

[0011] To achieve the above objectives, the present invention provides a blood sample DNA extraction kit, comprising: a nucleic acid treatment solution, a nucleic acid rinse solution and an elution buffer; wherein the nucleic acid treatment solution comprises a lysis solution, a proteinase K solution and a magnetic bead suspension, and the lysis solution comprises: a guanidine compound, bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, ethoxylated sclerosant, dextran-70, sodium chloride, polyvinyl pyrrolidone and water.

[0012] Preferably, the lysis solution comprises: 3-4 M / L guanidine compound, 10-20 mM / L bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 10-15 wt% ethoxylated alcohol, 0.1-0.3 wt% dextran-70, 1-3 M / L sodium chloride, 5-10 wt% polyvinylpyrrolidone and water.

[0013] Preferably, the guanidine compound is at least one of guanidine isothiocyanate, guanidine hydrochloride, guanidine sulfamate and guanidine thiocyanate.

[0014] Preferably, the proteinase K solution comprises: 10-30 mM / mL Tris, 0.005-0.02 wt % calcium chloride, 10-30 mg / mL proteinase K, 40-60 wt % glycerol and water.

[0015] As a preference, the magnetic bead suspension is: 1-2wt% hydroxyl magnetic bead suspension.

[0016] Preferably, the nucleic acid washing solution comprises 300-600 volume units of a first washing solution and 700-1400 volume units of a second washing solution;

[0017] As a preferred embodiment, the first rinsing solution is: 30-70 mM / L Tris, 500-1000 mM / L sodium chloride, 50-70 wt% ethanol and water, with a pH of 7-8;

[0018] Preferably, the second rinsing solution comprises: 30-70 mM / L Tris, 50-150 mM / L sodium chloride, 50-70 wt % ethanol and water, with a pH of 7-8.

[0019] Preferably, the elution buffer comprises 5-15 mM / L Tris, 0.5-1.5 mM / L EDTA and water, and the pH is 7.5-8.5.

[0020] Preferably, the blood sample is a human blood sample, a rabbit blood sample, a rabbit blood sample, a dog blood sample, a monkey blood sample, a sheep blood sample, a cow blood sample, a fish blood sample, a chicken blood sample, a duck blood sample or a pig blood sample.

[0021] The present invention also discloses a method for extracting DNA from blood, which uses the above-mentioned blood sample DNA extraction kit and comprises the following steps:

[0022] S1, add lysis solution, proteinase K solution and magnetic bead suspension to the blood sample and shake to mix;

[0023] S2, magnetic absorption, discarding waste liquid;

[0024] S3, adding the first rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution;

[0025] S4, adding the second rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution;

[0026] S5, adding the remaining second rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution;

[0027] S6, let stand and dry; add elution buffer, absorb magnetically, and aspirate the supernatant.

[0028] Preferably, the blood sample is 150-250 volume units.

[0029] As a preferred embodiment, a method for extracting DNA from blood comprises the following steps:

[0030] S1, add lysis buffer, proteinase K solution and magnetic bead suspension to a centrifuge tube containing 150-250 volume units of blood sample, shake to mix, and heat at 50-70°C for 5-15 minutes;

[0031] S2, place the centrifuge tube on a magnetic stand to absorb the magnet and discard the waste liquid;

[0032] S3, remove the centrifuge tube from the magnetic rack, add the first rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0033] S4, removing the centrifuge tube from the magnetic rack, adding 40-60 wt% of the second rinse solution, oscillating and mixing, placing the centrifuge tube on the magnetic rack to attract the magnet, and discarding the waste liquid;

[0034] S5, remove the centrifuge tube from the magnetic rack, add the remaining second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0035] S6, remove the centrifuge tube from the magnetic rack, leave it uncapped at room temperature to dry; add elution buffer, heat at 70-90℃ for 2-8min, place the centrifuge tube on the magnetic rack to attract the magnet, aspirate the supernatant into a new centrifuge tube, and store at -15 to -25℃.

[0036] The reagents used in the above technical scheme, such as guanidine isothiocyanate, bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, ethoxylated hardener, dextran-70, sodium chloride, polyvinyl pyrrolidone, Tris, calcium chloride, proteinase K, glycerol, EDTA, and magnetic beads, can be selected in various models according to needs and product performance.

[0037] The kit of the present invention can be operated manually, or can be prepared into an automatic operation form using techniques known in the art to further improve efficiency.

[0038] The blood sample DNA extraction kit of the present invention has been carefully designed and optimized, showing significant advantages, especially being able to achieve high-purity and high-concentration DNA extraction. Through the optimized lysis solution formula and highly adaptive design, the kit not only has outstanding extraction efficiency and is easy to operate, but also has strong versatility and flexibility, can be widely applied to different experimental conditions and equipment, meet diverse experimental needs, and provide valuable support for subsequent molecular biology research. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0040] Figure 1 The figure is a comparison chart of the fluorescent quantitative PCR results of DNA extracted in Example 1 and Comparative Example 2. DETAILED DESCRIPTION

[0041] The content of the present invention can be more easily understood by selecting the following detailed description of the preferred implementation method of the present invention and the embodiments included. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the present invention belongs. When there is a conflict, the definition in this specification shall prevail.

[0042] The invention discloses a blood sample DNA extraction kit, comprising: 415-645 volume units of nucleic acid treatment solution, 1000-2000 volume units of nucleic acid rinsing solution and 50-150 volume units of elution buffer solution.

[0043] Wherein, the nucleic acid treatment solution comprises 400-600 volume units of lysis solution, 10-30 volume units of proteinase K solution and 5-15 volume units of magnetic bead suspension;

[0044] Lysis solution: 3-4 M / L guanidine compound, 10-20 mM / L bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 10-15 wt% ethoxylated alcohol, 0.1-0.3 wt% dextran-70, 1-3 M / L sodium chloride, 5-10 wt% polyvinylpyrrolidone and water;

[0045] The guanidine compound is at least one of guanidine isothiocyanate, guanidine hydrochloride, guanidine sulfamate and guanidine thiocyanate. Preferably, the guanidine compound is composed of guanidine isothiocyanate and guanidine sulfamate in a molar ratio of (1-2): (1-2).

[0046] The main functions of guanidine compounds are cell dissolution and protein removal. Guanidine compounds have strong cell membrane destruction ability, which can quickly dissolve cells and release internal nucleic acid molecules. At the same time, it can react with proteins to denature and precipitate them, thereby helping to remove proteins from cells.

[0047] Bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, referred to as bis-tris, is used to maintain a suitable pH value. Bis-tris can adjust the acidity and alkalinity of the solution, so it is often used as a buffer in nucleic acid extraction. It has good buffering capacity and can stably maintain the pH value of the solution within a certain range, so that nucleic acid molecules can be extracted in a suitable environment. Because bis-tris has buffering capacity and neutrality, it can stabilize the structure of DNA. In the process of nucleic acid extraction, especially in DNA purification and storage, the use of Tris buffer can protect DNA molecules from enzymatic degradation and other damage.

[0048] The role of sodium chloride is to destroy the stability of proteins. DNA is dissolved in the liquid phase, and high concentrations of salt are added to precipitate DNA. The purpose of adding sodium chloride is to destroy the stability of proteins, separate proteins and DNA and precipitate them. At this time, the cations of the salt will combine with DNA to form DNA-cation salts dissolved in the solution.

[0049] Ethoxylated alcohols are used for precipitation and purification. Ethoxylated alcohols are nonionic surfactants that are often used to precipitate and purify nucleic acids. They help remove proteins that bind to nucleic acids. This helps purify nucleic acids and improve their purity.

[0050] Dextran-70 can disaggregate aggregated red blood cells and platelets and reduce blood viscosity.

[0051] The role of polyvinylpyrrolidone (PVP) is to remove polyamines and polyphenols. PVP can combine with interfering substances such as polyamines and polyphenols to form complexes and remove them from nucleic acid samples. This helps to reduce the impact of these interfering substances on the nucleic acid extraction and purification process and improve the purity and quality of nucleic acids.

[0052] Proteinase K solution: 10-30 mM / mL Tris, 0.005-0.02 wt% calcium chloride, 10-30 mg / mL proteinase K, 40-60 wt% glycerol and water;

[0053] Proteinase K can degrade many types of proteins. During nucleic acid extraction, the addition of proteinase K can help digest proteins in cell or tissue samples, allowing nucleic acids to be released and extracted.

[0054] Magnetic bead suspension: 1-2wt% hydroxyl magnetic bead suspension. Add hydroxyl magnetic beads into water and stir to mix evenly to obtain the magnetic bead suspension solution;

[0055] Hydroxyl magnetic beads, with a large number of silanol groups (hydroxyl groups) modified on the surface, can specifically bind to nucleic acids in the solution through hydrophobic interactions, hydrogen bonding, and electrostatic interactions, but not to other impurities (such as proteins). After the nucleic acid enrichment step, the use of appropriate washing buffer can help remove non-specific contaminants such as salts, proteins, and other impurities. At the same time, the binding of the target nucleic acid to the magnetic beads is retained. Then, by removing the external magnetic field or changing the buffer conditions, the pure target nucleic acid can be dissociated from the magnetic beads.

[0056] Wherein, the nucleic acid rinse solution comprises 300-600 volume units of a first rinse solution and 700-1400 volume units of a second rinse solution;

[0057] First rinse solution: 30-70 mM / L Tris, 500-1000 mM / L sodium chloride, 50-70 wt% ethanol and water, pH 7-8;

[0058] Second rinse solution: 30-70 mM / L Tris, 50-150 mM / L sodium chloride, 50-70 wt% ethanol and water, pH 7-8;

[0059] To further purify the DNA, ethanol was used to precipitate the DNA.

[0060] Wherein, the elution buffer comprises 5-15 mM / L Tris, 0.5-1.5 mM / L EDTA and water, and the pH is 7.5-8.5.

[0061] The volume units are all μL.

[0062] A method for extracting DNA from blood comprises the following steps:

[0063] S1, add lysis solution, proteinase K solution and magnetic bead suspension to the blood sample and shake to mix;

[0064] S2, magnetic absorption, discarding waste liquid;

[0065] S3, adding the first rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution;

[0066] S4, adding the second rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution;

[0067] S5, adding the remaining second rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution;

[0068] S6, let stand and dry; add elution buffer, absorb magnetically, and aspirate the supernatant.

[0069] Preferably, the blood sample is 150-250 volume units.

[0070] Preferably, a method for extracting DNA from blood comprises the following steps:

[0071] S1, add lysis buffer, proteinase K solution and magnetic bead suspension to a centrifuge tube containing 150-250 volume units of blood sample, shake to mix, and heat at 50-70°C for 5-15 minutes;

[0072] S2, place the centrifuge tube on a magnetic stand to absorb the magnet and discard the waste liquid;

[0073] S3, remove the centrifuge tube from the magnetic rack, add the first rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0074] S4, removing the centrifuge tube from the magnetic rack, adding 40-60 wt% of the second rinse solution, oscillating and mixing, placing the centrifuge tube on the magnetic rack to attract the magnet, and discarding the waste liquid;

[0075] S5, remove the centrifuge tube from the magnetic rack, add the remaining second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0076] S6, remove the centrifuge tube from the magnetic rack, leave it uncapped at room temperature to dry; add elution buffer, heat at 70-90℃ for 2-8min, place the centrifuge tube on the magnetic rack to attract the magnet, aspirate the supernatant into a new centrifuge tube, and store at -15 to -25℃.

[0077] In the embodiments and comparative examples:

[0078] Guanidinethiocyanate, English name Guanidinethiocyanate, CAS number: 593-84-0.

[0079] Bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, CAS number: 6976-37-0. English name: bis-tris.

[0080] Dextran-70, CAS number: 9004-54-0, English name Dextran-70, also known as dextran-70.

[0081] Ethoxylated hardened alcohol, using lauromacrogol 400, English name Polidocanol, CAS number: 9043-30-5.

[0082] Polyvinyl pyrrolidone, CAS number: 9003-39-8. Specifically used is P434443 polyvinyl pyrrolidone, molar weight 360000, provided by Shanghai Aladdin Biochemical Technology Co., Ltd.

[0083] Tris, tris(hydroxymethyl)aminomethane, CAS number: 77-86-1.

[0084] Proteinase K, CAS No.: 39450-01-6, Product No. Proteinase K.

[0085] Hydroxyl magnetic beads, MA200H silicon hydroxy magnetic microspheres provided by Suzhou Weidu Biotechnology Co., Ltd., with a solid content of 2.5wt%.

[0086] The blood sample refers to a blood sample of human origin.

[0087] Example 1

[0088] A blood sample DNA extraction kit,

[0089] Includes: 530 μL nucleic acid treatment solution, 1500 μL nucleic acid rinse solution and 100 μL elution buffer.

[0090] Wherein, the nucleic acid treatment solution includes 500 μL lysis solution, 20 μL proteinase K solution and 10 μL magnetic bead suspension;

[0091] Lysis solution: 3.5M / L guanidine compound, 15mM / L bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 12wt% ethoxylated alcohol, 0.2wt% dextran-70, 2M / L sodium chloride, 8wt% polyvinylpyrrolidone and water; the guanidine compound is guanidine isothiocyanate;

[0092] Proteinase K solution: 20 mM / mL Tris, 0.01 wt% calcium chloride, 20 mg / mL proteinase K, 50 wt% glycerol and water;

[0093] Magnetic bead suspension: 1.25wt% hydroxyl magnetic beads and water. Add commercially available MA200H silicon hydroxyl magnetic microspheres to an equal weight of water and stir to mix well to prepare the magnetic bead suspension;

[0094] Wherein, the nucleic acid rinse solution includes 500 μL of a first rinse solution and 1000 μL of a second rinse solution;

[0095] First rinse solution: 50 mM / L Tris, 750 mM / L sodium chloride, 60 wt% ethanol and water, pH 7.5;

[0096] Second rinse solution: 50 mM / L Tris, 100 mM / L sodium chloride, 60 wt% ethanol and water, pH 7.5;

[0097] Wherein, the elution buffer comprises: 10 mM / L Tris, 1 mM / L EDTA and water, and the pH is 8.0.

[0098] A method for extracting DNA from blood comprises the following steps:

[0099] (1) Take 200 μL of blood sample and add it to a centrifuge tube. Add 500 μL of lysis buffer, 20 μL of proteinase K solution and 10 μL of magnetic bead suspension, shake to mix, and heat at 60°C for 10 min.

[0100] (2) Place the centrifuge tube on a magnetic stand to absorb the magnet and discard the waste liquid;

[0101] (3) Remove the centrifuge tube from the magnetic rack, add 500 μL of the first rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0102] (4) Remove the centrifuge tube from the magnetic rack, add 500 μL of the second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0103] (5) Repeat step (4) once, that is, remove the centrifuge tube from the magnetic rack again, add the remaining 500 μL of the second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0104] (6) After instant centrifugation, transfer to a magnetic rack, fully aspirate all the solution, and leave the tube open at room temperature for 3 min to dry;

[0105] (7) Add 100 μL of elution buffer, heat at 80°C for 4 min, place the centrifuge tube on a magnetic rack to attract the magnet, carefully pipette the supernatant into a new centrifuge tube, and store at -20°C to obtain the extracted blood DNA sample.

[0106] Example 2

[0107] The only difference between Example 2 and Example 1 is that the guanidine compound is guanidine hydrochloride.

[0108] Example 3

[0109] The only difference between Example 3 and Example 1 is that the guanidine compound is guanidine sulfamate.

[0110] Example 4

[0111] The only difference between Example 4 and Example 1 is that the guanidine compound is guanidine sulfamate and guanidine isothiocyanate in a molar ratio of 1:1.

[0112] Example 5

[0113] The only difference between Example 5 and Example 1 is that the guanidine compound is guanidine hydrochloride and guanidine isothiocyanate in a molar ratio of 1:1.

[0114] Comparative Example 1

[0115] The blood DNA extraction kit of Comparative Example 1 is the blood sample DNA extraction kit of Example 1;

[0116] The difference between Comparative Example 1 and Example 1 is that Comparative Example 1 reduces the step of repeating the second rinsing liquid washing, and the steps are as follows:

[0117] (1) Take 200 μL of blood sample and add it to a centrifuge tube. Add 500 μL of lysis buffer, 20 μL of proteinase K solution and 10 μL of magnetic bead suspension, shake to mix, and heat at 60°C for 10 min.

[0118] (2) Place the centrifuge tube on a magnetic stand to absorb the magnet and discard the waste liquid;

[0119] (3) Remove the centrifuge tube from the magnetic rack, add 500 μL of the first rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0120] (4) Remove the centrifuge tube from the magnetic rack, add 500 μL of the second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid;

[0121] (5) After instant centrifugation, transfer to a magnetic rack, fully aspirate all the solution, and leave the tube open at room temperature for 3 min to dry;

[0122] (6) Add 100 μL of elution buffer, heat at 80°C for 4 min, place the centrifuge tube on a magnetic rack to attract the magnet, carefully pipette the supernatant into a new centrifuge tube, and store at -20°C to obtain the extracted blood DNA sample.

[0123] Comparative Example 2

[0124] The blood DNA extraction kit of comparative example 2 is a product currently available on the market (Guangzhou Bay Area Biotechnology Co., Ltd.; trade name: magnetic bead method whole blood genomic DNA extraction kit; item number BLDM-48), and the steps are as follows:

[0125] (1) Take 200ul of whole blood sample and add it to a 1.5mL centrifuge tube. Add 20μL proteinase K and 300μL lysis buffer. Vortex at high speed for 30 seconds and incubate at 50℃ for 10 minutes.

[0126] (2) Remove the centrifuge tube, wait for it to cool to room temperature, add 20 μL of magnetic beads, and shake for 5 minutes.

[0127] (3) Place the centrifuge tube on a magnetic rack to absorb the magnet and discard the waste liquid.

[0128] (4) Add 700 μL of the first rinse solution, vortex to mix, place the centrifuge tube on a magnetic rack to attract the magnet, and discard the waste liquid.

[0129] (5) Add 500 μL of the second rinse solution, vortex to mix, place the centrifuge tube on a magnetic rack to attract the magnet, and discard the waste liquid.

[0130] (6) Add 700 μL of the third rinse solution, vortex to mix, place the centrifuge tube on a magnetic rack to attract the magnet, and discard the waste liquid.

[0131] (7) After instant centrifugation, transfer to a magnetic rack for magnetic separation, fully aspirate and discard all the solution, and leave the tube with the lid open at room temperature for 3 min to dry.

[0132] (7) Add 100 μL of elution buffer and heat at 60°C for 10 min. Place the centrifuge tube on a magnetic rack and carefully pipette the supernatant into a new centrifuge tube and store at -20°C.

[0133] Comparative Example 3

[0134] The only difference between Comparative Example 3 and Example 1 is that the formula of the lysing solution is different. Comparative Example 3 adopts the lysing solution formula disclosed in Example 1 of CN113913421A.

[0135] The specific lysis solution formula is: pH value is 8.5, containing 7M / L guanidine hydrochloride, 50mM / L tris(hydroxymethylaminomethane), 50mM / L EDTA, and 10% Tween-20.

[0136] Comparative Example 4

[0137] The only difference between Comparative Example 4 and Example 1 is that tris(hydroxymethyl)aminomethane (Tris) replaces bis(2-hydroxyethyl)amino(trihydroxymethyl)methane in the lysis solution formula.

[0138] Lysis solution formula: 3.5M / L guanidine thiocyanate, 15mM / L tris(hydroxymethyl)aminomethane, 12wt% ethoxylated alcohol, 0.2wt% dextran-70, 2M / L sodium chloride, 8wt% polyvinylpyrrolidone and water.

[0139] Comparative Example 5

[0140] The only difference between Comparative Example 5 and Example 1 is that Tween-20 replaces ethoxylated hardener in the lysis solution formula.

[0141] Lysis solution formula: 3.5M / L guanidine thiocyanate, 15mM / L bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 12wt% Tween-20, 0.2wt% dextran-70, 2M / L sodium chloride, 8wt% polyvinylpyrrolidone and water.

[0142] Comparative Example 6

[0143] The only difference between Comparative Example 6 and Example 1 is that the lysis solution formula does not contain dextran-70.

[0144] Lysis solution formula: 3.5M / L guanidine isothiocyanate, 15mM / L bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 12wt% ethoxylated alcohol, 2M / L sodium chloride, 8wt% polyvinylpyrrolidone and water; Comparative Example 7:

[0145] The only difference between Comparative Example 7 and Example 1 is that the lysate formula does not contain sodium chloride.

[0146] Lysis solution formula: 3.5M / L guanidine thiocyanate, 15mM / L bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 12wt% ethoxylated alcohol, 0.2wt% dextran-70, 8wt% polyvinylpyrrolidone and water.

[0147] Comparative Example 8:

[0148] The only difference between Comparative Example 8 and Example 1 is that the lysis solution formula is different.

[0149] Lysis solution formula: 3.5M / L guanidine thiocyanate, 15mM / L tris(hydroxymethyl)aminomethane, 12wt% Tween-20, 8wt% polyvinylpyrrolidone and water.

[0150] Example 6

[0151] The difference between Example 6 and Example 1 is that Example 6 is operated using an automated extraction instrument, and the blood DNA extraction kit of Example 6 is the blood sample DNA extraction kit of Example 1;

[0152] Nucleic acid extraction instrument: ZK-01 fully automatic nucleic acid extraction and purification instrument from Nanjing Zhongke Baier Medical Technology Co., Ltd.;

[0153] Nucleic acid treatment solution and nucleic acid rinse solution packaging: Each component is packaged into a deep well plate in the order shown in Table 1.

[0154] Table 1 Order of adding nucleic acid extraction solution and nucleic acid rinse solution

[0155] Hole Position name Volume (μL) 1 / 7 Lysis buffer 500 2 / 8 First rinse solution 500 3 / 9 Second rinse solution 500 4 / 10 Second rinse solution 500 5 / 11 Elution buffer 100 6 / 12 Magnetic bead suspension 10

[0156] Add 200 μL of blood sample and 20 μL of proteinase K solution to well 1;

[0157] Add another 190 μL of water to 6 / 12.

[0158] Place the deep well plate into the extractor and run the program set up as shown in Table 2.

[0159] Table 2 Nucleic acid extraction procedure

[0160]

[0161] The specific operation steps are as follows:

[0162] (1) Place the magnetic rod in well 6 / 12 to mix the magnetic beads, then transfer the beads to well 1 / 7;

[0163] (2) Heat and mix the magnetic beads, lysate, and blood at 60°C for 10 min, then transfer the magnetic beads to well 2 / 8;

[0164] (3) Mix the magnetic beads with the first rinse solution for 30 seconds, then transfer the magnetic beads to well 3 / 9;

[0165] (4) Mix the magnetic beads and the second rinse solution for 30 seconds, then transfer the magnetic beads to well 4 / 10;

[0166] (5) Mix the magnetic beads and the second rinse solution for 30 seconds, then transfer the magnetic beads to well 5 / 11;

[0167] (6) Heat and mix the magnetic beads and elution buffer at 80°C for 4 min, then transfer the magnetic beads to well 6 / 12;

[0168] (7) Mix the magnetic beads and solution for 10 seconds, discard the magnetic beads and end the run.

[0169] Example 7

[0170] The blood DNA extraction kits of Example 1 and Comparative Example 2 were used to extract DNA from the same clinical blood sample, respectively. The nucleic acid sample extracted in Example 7 was subjected to a real-time fluorescence quantitative PCR detection step to verify the nucleic acid extraction effect.

[0171] Real-time fluorescence quantitative PCR:

[0172] Target gene: MTHFR

[0173] Primers: MTHFR-F: CCTGAAGCACTTGAAGGAGAA; MTHFR-R: GGAAAGAATGTGTCAGCCTCAA;

[0174] Probe: MTHFR-P: TCTGCGGGAGCCGATTTCATCATCA, the fluorescent group labeled at the 5' end is VIC, and the quencher group labeled at the 3' end is BHQ1.

[0175] Select the 20 μL PCR system, add 0.4 μL forward primer, 0.4 μL reverse primer, 0.2 μL probe, 10 μL PCR reaction solution, 4 μL water and 5 μL DNA template into the PCR tube, cover the lid tightly, shake to mix, and centrifuge in a low-speed centrifuge for 1 minute.

[0176] Place the PCR tube in the PCR instrument and run the program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s; annealing at 60°C for 30 s; perform 40 cycles. The results are as follows: Figure 1 shown.

[0177] Figure 1 Comparison of the fluorescent quantitative PCR results of DNA extracted in Example 1 and Comparative Example 2.

[0178] Through fluorescent quantitative PCR detection, it was found that the amplification effect of Example 1 was significantly better than that of Comparative Example 2, indicating that the nucleic acid extracted by the blood DNA extraction kit of the present invention had higher purity, concentration and efficiency.

[0179] Compared with the existing technology, this case improves the bottleneck problem in the blood extraction process. By optimizing the ratio of each component in the kit and the steps of the extraction process, the efficiency of blood extraction is effectively improved, and the extracted DNA concentration and purity are higher.

[0180] Improve extraction efficiency: By optimizing the ratio and extraction steps of the kit, this technology can significantly improve the efficiency of blood extraction. Compared with traditional methods, the kit using this patented technology can complete blood extraction more quickly and obtain high-purity DNA, saving time and cost.

[0181] Good automation adaptability: Patented technology has improved the design of the test kit, making it compatible with most automated instruments and improving user convenience.

[0182] Test Example 1:

[0183] GB / T37874-2019 General rules for evaluation of nucleic acid extraction and purification methods

[0184] The extracted blood DNA samples were tested for DNA concentration and purity using an ultra-micro spectrophotometer.

[0185] Nucleic acid purity refers to the purity of the target nucleic acid in the nucleic acid extract. This indicator is used to characterize the relative content of the target nucleic acid and residual impurities in the nucleic acid extract, and has an important impact on subsequent molecular biology experiments. The absorbance value of nucleic acid at a specific wavelength and the ratio of its absorbance values ​​at different wavelengths have corresponding characteristic values ​​for nucleic acids of different properties, which are used to characterize the nucleic acid purity of the extract. Use an ultraviolet spectrophotometer to measure the absorbance OD260, OD280, and OD230 of the extract at 260nm, 280nm, and 230nm, and calculate OD260 / OD280 and OD260 / OD230 to characterize the purity of the nucleic acid. When measuring the absorbance, the nucleic acid concentration needs to be adjusted to ensure that the nucleic acid absorbance value OD260 is between 0.1-1.5.

[0186] The OD260 / OD280 of pure DNA is 1.8. In the product obtained by DNA extraction, OD260 / OD280 of 1.7-1.9 indicates that the purity of DNA meets the needs of subsequent general molecular biology experiments. When OD260 / OD280>1.9, it indicates RNA contamination; when OD260 / OD280<1.7, it indicates protein, polyphenol and other contamination. The OD260 / OD230 of pure DNA is>2.0. OD260 / OD230<2.0 indicates residual salt or other small molecule impurities.

[0187] Table 3: Test data table

[0188]

[0189]

[0190]

[0191] From the comparison between Example 1 and Comparative Example 1, it can be seen that DNA with higher concentration and purity can be obtained after washing once with the second rinsing solution, and the concentration and purity of the extracted DNA can be further improved after washing twice with the second rinsing solution.

[0192] From the comparison between Example 1 and Comparative Example 2, it can be seen that by comparing the nucleic acid extraction concentrations of different nucleic acid extraction kits for the same sample, it can be concluded that the nucleic acid extracted by the blood DNA extraction kit of the present invention has a higher concentration and nucleic acid than the traditional extraction reagent, indicating that the nucleic acid extraction efficiency of the present invention is higher.

[0193] From the comparison between Example 1 and Comparative Example 3, it can be seen that the only difference between Comparative Example 3 and Example 1 is that the formula of the lysate is different. The effect of Example 1 is much better than that of Comparative Example 3.

[0194] From the comparison between Example 1 and Comparative Examples 4-7, it can be seen that the only difference between Comparative Example 4 and Example 1 is that tris(hydroxymethyl)aminomethane (Tris) replaces bis(2-hydroxyethyl)amino(trihydroxymethyl)methane in the lysate formula. The only difference between Comparative Example 5 and Example 1 is that Tween-20 replaces ethoxylated hardened alcohol in the lysate formula. The only difference between Comparative Example 6 and Example 1 is that the lysate formula does not contain dextran-70. The only difference between Comparative Example 7 and Example 1 is that the lysate formula does not contain sodium chloride. The effect of Example 1 is obviously better than that of Comparative Examples 4-7.

[0195] From the comparison of Examples 1-3, it can be seen that different guanidine compounds (guanidine isothiocyanate, guanidine hydrochloride, guanidine sulfamate) have different effects, and guanidine sulfamate has a better effect. The use of guanidine sulfamate and guanidine isothiocyanate has synergistic effect, but not all guanidine compounds have synergistic effect.

[0196] In conclusion, these comparisons indicate that the choice of lysis buffer components is crucial in DNA extraction, and different components may have a significant impact on the extraction effect. In addition, different guanidine compounds may also have significant differences in extraction effects.

[0197] From the comparison between Example 1 and Example 6, it can be seen that by extracting the same sample manually and by an automated instrument, it can be concluded that the blood DNA extraction kit of the present invention is suitable for an automated extraction instrument and that there is no significant difference in the concentration of the extracted DNA and nucleic acid.

[0198] The blood sample DNA extraction kit of the present invention shows excellent performance and many advantages after careful consideration and thoughtful design. Its primary advantage is that it can extract high-purity and high-concentration DNA, ensuring the accuracy and reliability of the experiment. This kit significantly improves the extraction efficiency of DNA through optimized lysate formula and precise supporting design, allowing users to operate conveniently and efficiently. Its design takes into account the various needs and conditions that users may encounter during the experiment, showing strong versatility and adaptability. Whether it is different experimental conditions or different experimental equipment, this kit can be perfectly applied to meet the diversity and variability of experiments. In addition, the wide applicability of the kit provides strong and reliable support for subsequent molecular biology research, which will greatly promote the in-depth development of scientific research. The kit not only has a high degree of practicality, but also further optimizes the experimental process, realizes the precise satisfaction of different experimental needs, ensures the smooth progress of scientific research, and provides a key scientific tool for scientific research in biology, medicine and related fields, which helps to promote the continuous progress and development of these fields.

[0199] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that are not conceived through creative work should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope defined in the claims.

Claims

1. A blood sample DNA extraction kit, comprising: Nucleic acid treatment solution, nucleic acid rinse solution and elution buffer; wherein the nucleic acid treatment solution includes a lysis solution, a proteinase K solution and a magnetic bead suspension, characterized in that: The lysate comprises: 3-4 M / L of guanidine compound, 10-20 mM / L of bis(2-hydroxyethyl)amino(trihydroxymethyl)methane, 10-15 wt% of ethoxylated hardened alcohol, 0.1-0.3 wt% of dextran-70, 1-3 M / L of sodium chloride, 5-10 wt% of polyvinylpyrrolidone and water; The guanidine compound is composed of guanidine isothiocyanate and guanidine sulfamate in a molar ratio of 1:1; The proteinase K solution comprises: 10-30 mM / mL Tris, 0.005-0.02 wt% calcium chloride, 10-30 mg / mL proteinase K, 40-60 wt% glycerol and water; The magnetic bead suspension is: 1-2wt% hydroxyl magnetic bead suspension; The nucleic acid rinse solution includes 300-600 volume units of a first rinse solution and 700-1400 volume units of a second rinse solution; The first rinse solution is: 30-70 mM / L Tris, 500-1000 mM / L sodium chloride, 50-70 wt% ethanol and water, with a pH of 7-8; The second rinse solution is: 30-70 mM / L Tris, 50-150 mM / L sodium chloride, 50-70 wt% ethanol and water, with a pH of 7-8; The elution buffer comprises: 5-15 mM / L Tris, 0.5-1.5 mM / L EDTA and water, and the pH is 7.5-8.

5.

2. A method for extracting DNA from blood, characterized in that: The blood sample DNA extraction kit according to claim 1 comprises the following steps: S1, add lysis solution, proteinase K solution and magnetic bead suspension to the blood sample and shake to mix; S2, magnetic absorption, discarding waste liquid; S3, adding the first rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution; S4, adding the second rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution; S5, adding the remaining second rinse solution, oscillating and mixing, magnetically attracting, and discarding the waste solution; S6, let stand and dry; add elution buffer, absorb magnetically, and aspirate the supernatant.

3. The method for extracting DNA from blood according to claim 2, characterized in that: The blood sample is 150-250 volume units.

4. The method for extracting DNA from blood according to claim 3, characterized in that: The steps include: S1, add lysis buffer, proteinase K solution and magnetic bead suspension to a centrifuge tube containing 150-250 volume units of blood sample, shake to mix, and heat at 50-70°C for 5-15 minutes; S2, place the centrifuge tube on a magnetic stand to absorb the magnet and discard the waste liquid; S3, remove the centrifuge tube from the magnetic rack, add the first rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid; S4, remove the centrifuge tube from the magnetic rack, add 40-60wt% of the second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid; S5, remove the centrifuge tube from the magnetic rack, add the remaining second rinse solution, shake and mix, place the centrifuge tube on the magnetic rack to attract the magnet, and discard the waste liquid; S6, remove the centrifuge tube from the magnetic rack, leave it uncapped at room temperature to dry; add elution buffer, heat at 70-90℃ for 2-8min, place the centrifuge tube on the magnetic rack to attract the magnet, aspirate the supernatant into a new centrifuge tube, and store at -15 to -25℃.

Images