A nucleic acid construct and its use

Abstract

The present invention belongs to the field of plant genetic engineering. Specifically, the present invention provides a nucleic acid construct. The present invention adopts a nucleic acid construct with a specific structure to improve plant traits and enhance plant heat resistance, and has broad application prospects.

Description

[0001] This application claims priority to Chinese patent application CN 202310041727.3, filed on January 12, 2023. This application cites the entire text of the above Chinese patent application. Technical Field

[0002] The present invention relates to the field of plant genetic engineering, in particular to a nucleic acid construct for improving plant traits. Background Art

[0003] Due to the increase in greenhouse gas emissions and global warming, high temperatures directly affect the growth and development of plants, resulting in reduced yield and quality. Plants have multiple systems to protect themselves from heat stress, which interferes with the correct folding of proteins during synthesis, leading to the accumulation of misfolded proteins. The heat shock response (HSR) and unfolded protein response (UPR) can sense the accumulation of misfolded proteins, thereby reducing the damage caused by heat stress.

[0004] Plant bZIP transcription factors are a class of proteins that are widely distributed and relatively conservative in eukaryotes. Their alkaline regions are highly conserved and contain about 20 amino acid residues. According to the different structures of bZIP, they can be divided into 10 subfamilies. Transcription factors of different subfamilies perform different functions, mainly including the expression of plant seed storage genes, regulation of plant growth and development, light signal transduction, disease prevention, stress response, ABA sensitivity and other signal responses. Studies have shown that IRE1 (Inositol Requiring Enzyme1) is an endoplasmic reticulum (ER) stress sensor protein. After IRE1 is activated, it splices bZIP60 mRNA to produce truncated transcription factors, upregulates genes involved in UPR, and can reduce the impact of UPR response on growth and development. bZIP60 mRNA is a reliable biomarker of UPR.

[0005] As an important food crop, corn (Zea mays) is susceptible to adverse environmental conditions such as high temperature and waterlogging, which can lead to reduced yield and quality. Currently, there are few studies on the heat shock factors (HSF), heat shock proteins (HSP), catalase (CAT) and ascorbate peroxidase (APX) gene families under high temperature stress in corn. Therefore, there is an urgent need to develop a nucleic acid construct that can be used for transgenics to improve the heat tolerance of corn. Summary of the invention

[0006] The object of the present invention is to provide a nucleic acid construct that can improve plant traits. The nucleic acid construct of the present invention can improve the heat resistance of corn.

[0007] In one aspect, the present invention provides a nucleic acid construct having a 5'-3' (5' to 3') structure of formula I:

[0008] P1-S1(I)

[0009] In the formula,

[0010] P1, S1 are elements used to constitute the construct;

[0011] P1 is a promoter, the nucleotide sequence of which is shown in SEQ ID No. 1;

[0012] S1 is the coding sequence of the transcription factor, and the amino acid sequence of the transcription factor is shown in SEQ ID No.3;

[0013] And, each "-" is a bond or a nucleotide linking sequence;

[0014] The P1 and S1 are operatively connected.

[0015] In one embodiment, P1 and S1 are directly linked without any other nucleotide linking sequence in between.

[0016] In other embodiments, other nucleotide linking sequences may be included between P1 and S1, as long as P1 and S1 are operably linked, the expression of S1 can be initiated under the action of P1. The nucleotide linking sequence does not affect the normal transcription and translation of other elements.

[0017] As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0018] The term "promoter" has a meaning well known to those skilled in the art, and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. As shown herein, when a promoter and a target nucleic acid are operably linked, the promoter can initiate expression of the target nucleic acid.

[0019] In one embodiment, the nucleic acid construct further comprises an integration element, the integration element comprises a homology arm sequence, and the integration element is placed at the 5' end and / or the 3' end of Formula I.

[0020] In one embodiment, the first integration element and the second integration element are disposed at the 5' end and the 3' end of Formula I, respectively.

[0021] The integration elements in the nucleic acid constructs of the present invention can allow the sequences located in the integration elements to be integrated into the genome of the target host.

[0022] In one embodiment, the length of the nucleic acid construct is 1000-3000 bp, preferably, 1500-2200 bp.

[0023] In one embodiment, the promoter is derived from corn, rice, wheat, soybean, Arabidopsis, potato or tomato, etc. Preferably, the promoter is derived from corn.

[0024] In one embodiment, the nucleotide sequence of the promoter has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to the nucleotide sequence shown in SEQ ID No.1.

[0025] In one embodiment, the nucleotide sequence of the promoter is shown as SEQ ID No.1.

[0026] In one embodiment, the amino acid sequence of the transcription factor has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to the amino acid sequence shown in SEQ ID No.3.

[0027] In one embodiment, the amino acid sequence of the transcription factor is as shown in SEQ ID No. 3, which has an amino acid mutation compared to the wild-type transcription factor.

[0028] Compared with the wild-type transcription factor, the mutant transcription factor shown in SEQ ID No. 3 of the present application can improve the heat tolerance of corn.

[0029] In one embodiment, the nucleotide sequence of the transcription factor is shown as SEQ ID No.2.

[0030] In one embodiment, the 3' end of the nucleic acid construct further comprises a terminator, and the terminator includes a terminator suitable for plant transgenesis.

[0031] In one embodiment, the terminator is selected from the group consisting of NOS, Poly A, T-UBQ, rbcs or a combination thereof.

[0032] On the other hand, the present invention also provides a vector, which contains the above-mentioned nucleic acid construct.

[0033] In one embodiment, the vector is a plant expression vector.

[0034] In one embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0035] In one embodiment, the vector is an Agrobacterium Ti vector.

[0036] In one embodiment, the backbone of the vector is a pGWB series vector such as pGWB501, pGWB502, pGWB415, pGWB505, or a pCAMBIA series vector such as pCAMBIA1300, pCAMBIA1301, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, etc., or a pBI series vector such as pBI101, pBI121, pBI221, etc.

[0037] In one embodiment, the construct is integrated into the T-DNA region of the vector.

[0038] In one embodiment, the vector is circular or linear.

[0039] As used herein, the term "vector" refers to a nucleic acid construct designed for transfer between different host cells. An "expression vector" refers to a vector that has the ability to incorporate and express heterologous DNA fragments in exogenous cells. Many prokaryotic and eukaryotic expression vectors are commercially available. The selection of an appropriate expression vector is well known to those skilled in the art.

[0040] On the other hand, the present invention also provides an engineered host cell, wherein the host cell comprises the above nucleic acid construct or the above vector.

[0041] In one embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.

[0042] In one embodiment, the prokaryotic cell is derived from Escherichia coli, yeast or Agrobacterium.

[0043] In one embodiment, the cell is a plant cell.

[0044] In one embodiment, the plant is selected from the group consisting of monocots, dicots, gymnosperms, or a combination thereof.

[0045] In one embodiment, the plant includes: Arabidopsis, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Arabidopsis, potato, cabbage, rapeseed, lettuce, cucumber, chrysanthemum, water spinach, etc., or a combination thereof.

[0046] In one embodiment, the host cell is introduced with the nucleic acid construct by a method selected from the group consisting of Agrobacterium transformation, gene gun, microinjection, electric shock, ultrasound and polyethylene glycol (PEG)-mediated method.

[0047] In another aspect, the present invention provides use of the above nucleic acid construct, or the above vector, or the above host cell in preparing transgenic plants.

[0048] On the other hand, the present invention provides the use of the above-mentioned nucleic acid construct, or the above-mentioned vector, or the above-mentioned host cell in preparing a reagent or a kit, wherein the reagent or the kit is used to prepare a transgenic plant.

[0049] On the other hand, the present invention provides a method for preparing a plant with improved traits, the method comprising the step of overexpressing a transcription factor in a plant cell, a plant seed, a plant tissue, a plant part or a plant, wherein the amino acid sequence of the transcription factor is shown in SEQ ID No.3.

[0050] In one embodiment, the method comprises overexpressing the transcription factor using an expression vector, or integrating the transcription factor into the plant genome or overexpressing the transcription factor.

[0051] In one embodiment, the method comprises overexpressing the transcription factor using the promoter shown in SEQ ID No.1.

[0052] In one embodiment, the method comprises introducing the above-mentioned nucleic acid construct, or the vector, or the host cell into the plant cell, plant seed, plant tissue, plant part, or plant.

[0053] In one embodiment, the introduction is via Agrobacterium.

[0054] In one embodiment, the introduction is by gene gun.

[0055] In one embodiment, the plant is a plant obtained by regenerating a plant cell or callus with improved traits into a plant body, thereby obtaining a plant with improved traits.

[0056] In one embodiment, the trait improvement is to improve the heat tolerance of the plant, preferably, to improve the heat tolerance of the plant during the pollination period.

[0057] In one embodiment, the plant includes any higher plant type amenable to transformation techniques, including monocots, dicots, and gymnosperms.

[0058] In one embodiment, the plant is selected from the group consisting of Gramineae, Leguminosae, Cruciferae, Solanaceae, Apiaceae, or a combination thereof.

[0059] In one embodiment, the plant comprises: Arabidopsis, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Arabidopsis, potato, cabbage, rapeseed, spinach, lettuce, cucumber, chrysanthemum, water spinach, celery, lettuce, or a combination thereof.

[0060] In another aspect, the present invention provides use of the above nucleic acid construct, or the above vector, or the above host cell in preparing plants with improved traits.

[0061] On the other hand, the present invention provides the use of the above-mentioned nucleic acid construct, or the above-mentioned vector, or the above-mentioned host cell in the preparation of a reagent or a kit for improving plant traits.

[0062] In one embodiment, the trait improvement is to improve the heat tolerance of the plant, preferably, to improve the heat tolerance of the plant during the pollination period.

[0063] The heat resistance refers to the ability of the plant to tolerate high temperature stress, for example, the ability to tolerate temperatures above 30°C, preferably above 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C. Improving the heat resistance of plants in the present invention means that the tolerance of plants to high temperature stress can be improved when the ambient temperature is above 30°C (preferably, above 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C); compared with wild-type plants, plants overexpressing the above transcription factors can tolerate high temperature stress above 30°C (preferably, above 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C).

[0064] Taking corn as an example, improving the heat resistance of the plant during the pollination period means that under high temperature conditions (usually refers to an ambient temperature above 32°C, such as 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or above 40°C), the activity of corn pollen and silk is better than that of the control material, showing a higher pollination and fruiting rate, and reducing the proportion of deformed ears, thereby increasing corn yield.

[0065] In one embodiment, the heat tolerance is to increase the pollination rate of plants under high temperature stress, or to reduce the fruit deformity rate of plants under high temperature stress, or to increase the yield of plants under high temperature stress.

[0066] In one embodiment, the elevated temperature is above 32°C but not more than 41°C.

[0067] In the art, the pollen shedding period of corn refers to the flowering period. The most suitable average daily temperature for corn during the flowering period is 26-27°C. When the temperature is too high or too low, the growth and development will be affected. The present application improves the heat resistance of corn, so that the corn can withstand a temperature of at least 32°C during the flowering period, for example, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C or 41°C.

[0068] On the other hand, the present invention also provides a method for preparing a transgenic plant, wherein the transgenic plant is a plant obtained by hybridizing the plant prepared by the above method with other plants.

[0069] The present invention provides a nucleic acid construct, which increases the expression level of bZip60 in plants, can improve the traits of plants, and improves the heat resistance of corn, especially the heat resistance during the pollination period. It has important significance and broad application prospects for alleviating the poor pollination and yield reduction caused by high temperature during the pollination period.

[0070] Embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but it will be appreciated by those skilled in the art that the following drawings and examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. Various objects and advantages of the present invention will become apparent to those skilled in the art based on the following detailed description of the accompanying drawings and preferred embodiments.

[0071] The sequence information involved in this application is as follows:

[0072]

[0073] BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 . Schematic diagram of the recombinant expression vector.

[0075] Figure 2 . PCR detection of genetically modified crops; M: Maker, representing DNA fragments with different molecular weights, from bottom to top: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; +: positive control; -: negative control; ddH 2O: blank control; transgenic crops AC19:23AC19, AC3:23AC3, AC25:23AC25.

[0076] Figure 3 . Phenotypic identification of transgenic plants overexpressing bZip60 at the seedling stage after heat treatment; A represents the phenotype of Z58 wild-type control seedlings after heat treatment, and B represents the phenotype of the transgenic strain overexpressing bZip60 in the Z58 background after heat treatment.

[0077] Figure 4 . Analysis of relative expression of bZip60 in different strains after heat treatment; the ordinate is the relative expression level, and the abscissa is the different strains; transgenic heat-treated strains: 23AC19, 23AC3, 23AC25; wild-type heat-treated strain: Z58; wild-type control group without heat treatment: CK.

[0078] Figure 5 .Comparison of ear phenotypes of bZip60 transgenic materials after high temperature stress during the pollination period; wild-type control group: CK; bZIP60 transgenic materials: 23AC19, 23AC3, and 23AC25.

[0079] Figure 6 . Hundred-grain weight data of bZip60 transgenic materials under normal growth conditions; wild-type control material: PH4CV; bZIP60 transgenic materials: 23AC19, 23AC3, 23AC25.

[0080] Figure 7 . Ear weight data of bZip60 transgenic materials under normal growth conditions; wild-type control material: PH4CV; bZIP60 transgenic materials: 23AC19, 23AC3, 23AC25. DETAILED DESCRIPTION

[0081] The following examples are only used to describe the present invention, but not to limit the present invention. Unless otherwise specified, the experiment and method described in the embodiment are carried out basically according to the conventional methods well known in the art and described in various references. For example, the conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the present invention can be found in Sambrook, Fritsch and Maniatis, "Molecular cloning: laboratory manual" (MOLECULAR CLONING: A LABORATORY MANUAL), 2nd edition (1989); "Contemporary molecular biology experimental manual" (CURRENT PROTOCOLS IN MOLECULAR BIOLOGY) (FM Ausubel et al. edited, (1987)); "Enzymology" (METHODS IN ENZYMOLOGY) series (Academic Publishing Company): "PCR 2: Practical methods" (PCR 2: APRACTICAL APPROACH) (MJ MacPherson, BD Hames, and GR Taylor, eds. (1995)), ANTIBODIES, A LABORATORY MANUAL, eds. Harlow and Lane, eds. (1988), and ANIMAL CELL CULTURE (RI Freshney, ed. (1987)).

[0082] In addition, if the specific conditions are not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be obtained commercially. It is known to those skilled in the art that the embodiments describe the present invention by way of example and are not intended to limit the scope of the present invention. All public cases and other references mentioned herein are incorporated herein by reference in their entirety.

[0083] Example 1. Cultivation of transgenic plants

[0084] (1) Fusion of promoter and gene

[0085] Using the corn genome as a template, primers coreP893 bZip60 F and coreP893 bZip60 R were used for amplification to obtain the core promoter sequence, as shown in SEQ ID No.1. The bZip60 gene was amplified using corn B73 cDNA as a template. In view of the variable splicing sites in bZip60, the bZip60 sequence was optimized by amino acid mutation to improve the heat resistance of bZIP60 (compared with the unoptimized bZIP60, the bZIP60 after amino acid mutation optimization can significantly improve the heat resistance of corn); specifically, the bZip60 5' end sequence was amplified using the primer pair bZip60 F and split bZip60 R, and the bZip60 3' end sequence was amplified using the primer pair split bZip60 F and bZip60 R short. The full-length sequence of bZip60 after mutation optimization was obtained after amplification using the bZip60 F and bZip60 R primer pair. The amino acid sequence is shown in SEQ ID No.3, the nucleotide sequence is shown in SEQ ID No.2, and homology arms are added at both ends of the sequence. The primer information is shown in Table 1.

[0086] (2) Construction of plant expression vector

[0087] The Tnos terminator was amplified using primers Tnos P705 F and Tnos P705, and the bZip60 mutanted (shown in SEQ ID No. 2), the promoter (shown in SEQ ID No. 1), and the terminator were connected to the backbone vector by homologous recombination to obtain the final plant expression vector. Figure 1 The primer information is shown in Table 1.

[0088] Table 1. Primer information used in vector construction

[0089]

[0090] (2) Genetic transformation

[0091] The above-mentioned recombinant plant expression vector was introduced into the Agrobacterium EHA105 strain, activated and cultured in a YEP liquid medium containing kanamycin and rifampicin antibiotics, and the bacteria were collected. The bacteria were induced and cultured in an induction medium containing kanamycin, rifampicin antibiotics and acetosyringone until OD600 was around 1.0. The activated bacterial liquid was used to infect corn embryos at 10-12 days DAP, and after co-culture at 22°C for 24 hours, it was transferred to a recovery medium and cultured in the dark at 28°C for 7 days. Subculture was then carried out, and after buds appeared, they were transferred to a differentiation medium until seedlings emerged. The DNA of the above-mentioned T0 generation transgenic plants was extracted, and transgenic positive plants were screened using specific primers (Table 2). The results are as shown in the figure. Figure 2As shown, the target band can be detected in positive transgenic crops, and the target band cannot be detected in negative crops. Plants 23AC19, 23AC3, and 23AC25 can detect the target band and are transgenic positive crops. Positive plants are selected for transplanting and self-pollination for seed collection.

[0092] Table 2 Primer information for transgenic detection (438 bp)

[0093] name sequence bZip60T F cttgcattgtatgcaacagtag bZip60T R ccgtggcctggccaatag

[0094] (3) Heat treatment at seedling stage

[0095] Select T1 transgenic positive strains, retain positive seedlings after single plant identification, and retain at least 10 seedlings for each strain. Heat treat the materials 14 days after emergence: use an incubator at 38 degrees / 28 degrees and 14 hours / 10 hours of light conditions; control setting: retain 25-30 wild-type control seedlings, and place 3-5 seedlings at room temperature; the rest are heat treated together with the transgenic materials.

[0096] Phenotypic identification of transgenic materials and control materials after treatment Figure 3 As shown, A represents the phenotype of the wild-type control seedlings after heat treatment at the seedling stage; B represents the phenotype of the transgenic seedlings after heat treatment at the seedling stage. The difference between phenotypes A and B at the seedling stage is not significant.

[0097] The bZip60 gene of the heat-treated transgenic materials and the control materials was quantitatively analyzed. The primers for quantitative analysis are shown in Table 3. The results are shown in Figure 4 As shown, the heat-treated transgenic materials are 23AC19, 23AC3, and 23AC25, the heat-treated control material is Z58, and the unheat-treated control material is CK. The results showed that in the untreated CK, the expression level of bZip60 was low, and the expression level of bZip60 in the heat-treated transgenic materials 23AC19, 23AC3, 23AC25 strains and the wild-type material Z58 increased compared with the untreated materials. At the same time, the expression level of bZip60 in the transgenic strains 23AC19, 23AC3, and 23AC25 was significantly higher than that in the treated control material Z58.

[0098] This suggests that the transgenic expression cassette can respond to heat signals and increase the expression of the bZip60 gene.

[0099] Table 3 Primer information for quantitative analysis (229 bp)

[0100] name sequence bZip60qRT F ggatcgttgcacgggagtat bZip60qRT R aagcttcctcgttcctggca

[0101] (4) Phenotypic identification

[0102] The corn in the powder shedding stage was subjected to a high temperature treatment of 35°C, and after the powder shedding stage, the temperature was restored to a suitable temperature for corn growth, and the phenotype of the transgenic corn overexpressing bZip60 was identified. Figure 5 As shown, the pollination status of the control group material was poor and the rate of ear deformity was high. The pollination status of the three transgenic lines 23AC19, 23AC3, and 23AC25 were better than that of the control group, with high pollination rates and low ear deformity rates, and the yield was significantly higher than that of the control group.

[0103] The experimental results show that overexpression of bZip60 in corn can alleviate poor pollination caused by high temperature during the pollination period and promote corn yield to a certain extent.

[0104] (5) Field yield measurement

[0105] To test the field performance of the above transgenic corn under normal growth temperature, we conducted an intermediate yield test on the transgenic corn material overexpressing bZip60 in the field. Under normal growth temperature, the relevant yield data of transgenic corn 100-grain weight was as follows: Figure 6 As shown, ear weight Figure 7 As shown, PH4CV is the wild-type control group, i.e., wild-type corn without bZip60 overexpression; transgenic materials: 23AC19, 23AC3, 23AC25. According to the above yield data, under normal production and growth conditions, the 100-grain weight and ear weight of the transgenic materials did not change significantly compared with the wild type.

[0106] Combined with the results of the above high temperature tests, it can be confirmed that overexpressing the bZip60 gene in corn can not only help stabilize corn yield under high temperatures, but also has no adverse effects on corn yield under normal growth conditions.

[0107] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A nucleic acid construct, characterized in that The nucleic acid construct has a 5'-3' (5' to 3') structure of Formula I: P1-S1 (I) In Formula I, P1 is a promoter, the nucleotide sequence of which is shown in SEQ ID No. 1; S1 is the coding sequence of the transcription factor, and the amino acid sequence of the transcription factor is shown in SEQ ID No.3; And, each "-" is a bond or a nucleotide connection sequence; The P1 and S1 are operatively connected.

2. The nucleic acid construct according to claim 1, characterized in that The nucleotide sequence of the transcription factor is shown as SEQ ID No.

2.

3. The nucleic acid construct according to claim 1, characterized in that The 3' end of the nucleic acid construct also contains a terminator.

4. A carrier, characterized in that The vector contains the nucleic acid construct according to any one of claims 1 to 3.

5. An engineered host cell, characterized in that The cell contains the nucleic acid construct according to any one of claims 1 to 3, or the vector according to claim 4.

6. Use of the nucleic acid construct according to any one of claims 1 to 3, or the vector according to claim 4, or the host cell according to claim 5 in preparing a transgenic plant with improved heat resistance, wherein the plant is corn; or, use of the nucleic acid construct according to any one of claims 1 to 3, or the vector according to claim 4, or the host cell according to claim 5 in preparing a reagent or a kit for preparing a transgenic plant with improved heat resistance, wherein the plant is corn.

7. A method for preparing a plant with improved traits or for improving the traits of a plant, characterized in that: The method comprises the step of overexpressing a transcription factor in plant cells, plant seeds, plant tissues, plant parts or plants, wherein the amino acid sequence of the transcription factor is shown in SEQ ID No.3, the method comprises the step of overexpressing the transcription factor using the promoter shown in SEQ ID No.1, the trait improvement is to improve the heat resistance of the plant, and the plant is corn.

8. The method according to claim 7, characterized in that The trait improvement is to improve the heat resistance of plants during the pollination period.

9. The method according to claim 7 or 8, characterized in that: The method comprises the following steps: The nucleic acid construct according to any one of claims 1 to 3, or the vector according to claim 4, or the host cell according to claim 5 is introduced into the plant cell, plant seed, plant tissue, plant part or plant.

10. The method according to claim 7 or 8, characterized in that: The heat resistance is selected from any one or any several of the following i-iii: i. Improve the pollination rate of plants under high temperature stress, ii. Reduce the rate of fruit deformity in plants under high temperature stress, iii. Improve plant yield under high temperature stress.

11. Use of the nucleic acid construct according to any one of claims 1 to 3, or the vector according to claim 4, or the host cell according to claim 5 in preparing a plant with improved traits, wherein the improved traits are improving the heat tolerance of the plant, and the plant is corn; or, use of the nucleic acid construct according to any one of claims 1 to 3, or the vector according to claim 4, or the host cell according to claim 5 in preparing a reagent or a kit for improving the traits of a plant, wherein the improved traits are improving the heat tolerance of the plant, and the plant is corn.

12. The use according to claim 11, characterized in that: The trait improvement is to improve the heat resistance of plants during the pollination period.

13. The use according to claim 11, characterized in that: The heat resistance is selected from any one or any several of the following i-iii: i. Improve the pollination rate of plants under high temperature stress, ii. Reduce the rate of fruit deformity in plants under high temperature stress, iii. Improve plant yield under high temperature stress.

14. A method for preparing a transgenic plant with improved heat resistance, characterized in that: The transgenic plant is a plant obtained by hybridizing a plant prepared by any method of claims 7 to 13 with other plants, and the plant is corn.

Images