A SNP molecular marker associated with yellowfin seabream's resistance to Streptococcus dolphinus and its application

Abstract

The invention discloses a SNP molecular marker related to yellowfin spurred seabream's resistance to dolphin streptococcus disease. The SNP molecular marker is located on chromosome 19 of the yellowfin spurred seabream. The sequence of the SNP molecular marker is shown in SEQ ID NO.1. The base N at the 201st position from the 5' end of the sequence shown in SEQ ID NO.1 is T or G. A primer for detecting the SNP molecular marker, a kit containing the primer, and a method for detecting the resistance trait of yellowfin spurred seabream to dolphin streptococcus by using the primer are also disclosed. Also disclosed are a reagent for detecting the SNP molecular marker, application of the primer, the kit or the method in identifying yellowfin spurred seabream with dolphin streptococcus resistance, application of the primer, the kit or the method in screening yellowfin spurred seabream with dolphin streptococcus resistance, and application of the reagent, the kit or the method in screening yellowfin spurred seabream with dolphin streptococcus resistance and early screening of excellent yellowfin spurred seabream resistant to dolphin streptococcus.

Description

Technical Field

[0001] The invention belongs to the technical field of screening of molecular markers of aquatic animals and genetic breeding, and specifically relates to a SNP molecular marker related to yellowfin thorny sea bream's resistance to dolphin streptococcus disease and an application thereof. Background Art

[0002] Yellowfin thornfish (scientific name: Sparus latus) belongs to the bony fish, Perciformes, Sparidae, Sparus genus. It is distributed in the Arabian Sea, the Red Sea to the southeast coast of Asia. It has an oblong body, flattened sides, a narrow back, and is blue-gray with yellow, with gray vertical stripes. The dorsal fin, anal fin and caudal fin are gray-black, and the pelvic fin and the lower part of the caudal fin are yellow. It likes warm shallow waters and adapts to a wide range of salinity. The suitable temperature range is 9.5-29.5℃ (juveniles) and 8-35℃ (adults). It does not migrate long distances.

[0003] Infection with Streptococcus iniae can cause epidemics in fish, leading to mass deaths, which poses a serious challenge to the aquaculture industry. According to previous studies, at least 44 species of fish, including members of the Sparidae family, such as yellowfin roughy, may be naturally infected with this bacterium. Infection with Streptococcus iniae in fish can lead to histopathological symptoms such as meningitis and sepsis. The infection forms are divided into acute and chronic, with different clinical manifestations. Acutely infected fish may die quickly and show no obvious symptoms; while chronic infection causes the fish to gradually weaken their vitality, lose appetite, become slow in movement, gradually become isolated from the group, pigmentation may appear on the body surface, and the spine may become deformed. Fish on the verge of becoming sick may lie on their side or roll on the water surface. Therefore, developing new varieties of yellowfin roughy that are resistant to Streptococcus iniae and using molecular marker-assisted breeding technology is an effective way to prevent and control the disease and reduce losses in the aquaculture industry.

[0004] Genome-wide association study (GWAS) is a comprehensive genomics approach used to explore the relationship between genetic variation and phenotypic traits in a population. This approach is particularly effective across the entire genome, and can accurately locate multiple traits at the same time, conduct in-depth studies on functional genes, and develop genetic markers associated with traits, which is very useful for breeding. GWAS has been applied in disease-resistant breeding of marine fish. For example, single nucleotide polymorphism (SNP) molecular markers significantly associated with resistance to Cryptocaryon irritans have been identified in oval pomfret, and SNP molecular markers significantly associated with resistance to visceral white spot disease (bacterial disease) have also been found in large yellow croaker. Similarly, in the study of growth traits, the successful identification of SNP molecular markers associated with the rapid growth trait of black sea porgy has improved the accuracy of breeding.

[0005] In yellowfin roughy, GWAS technology was successfully used to identify SNP molecular markers associated with the ability to resist iniae Streptococcus. Similarly, some SNP molecular markers have been discovered and applied in the analysis of morphological traits, such as the growth characteristics of yellowfin roughy. However, current research has not yet been able to identify a molecular marker that is associated with both disease resistance and morphological traits. Summary of the invention

[0006] The first object of the present invention is to provide a SNP molecular marker related to yellowfin thorny sea bream's resistance to dolphin streptococcus disease, and a primer and a kit for detecting the SNP molecular marker.

[0007] The present invention also aims to provide a method for detecting the resistance and susceptibility of yellowfin scorpionfish to iniae streptococcus.

[0008] The last object of the present invention is to provide a reagent for detecting the above-mentioned SNP molecular marker, and the use of the above-mentioned primers, kits or methods in identifying yellowfin roughy with resistance to iniae Streptococcus, in screening yellowfin roughy with resistance to iniae Streptococcus, and in early screening of excellent varieties of yellowfin roughy resistant to iniae Streptococcus.

[0009] The above-mentioned first purpose of the present invention can be achieved by the following technical scheme: a SNP molecular marker related to the resistance of yellowfin roughy to dolphin streptococcal disease, the SNP molecular marker is located on chromosome 19 of the yellowfin roughy, the sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the base N at the 201st position starting from the 5' end of the sequence shown in SEQ ID NO.1 is T or G.

[0010] Preferably, the screening method for the SNP molecular marker associated with the resistance of yellowfin seabream to Streptococcus iniae of the present invention comprises the following steps:

[0011] (1) 1000 yellowfin roughy were infected with Streptococcus iniae, the tail fins of the first 80 yellowfin roughy that died and the last 80 yellowfin roughy that died were cut, DNA was extracted and whole genome resequencing was performed;

[0012] (2) Compare the above sequencing results with the reference genome file of yellowfin thorny seabream to obtain SNPs in the whole genome;

[0013] (3) Through genome-wide association analysis (GWAS), the correlation between the resistance of yellowfin roughy to S. dolphinia and genes was analyzed, and the SNP molecular markers significantly associated with the resistance of yellowfin roughy to S. dolphinia were identified.

[0014] Specifically, the sequence of the SNP molecular marker associated with yellowfin porgy's resistance to dolphin streptococcal disease is as follows:

[0015] GAAGCTCCAAACCACCTGATAGTTTTAATTAGAAGTTGGGACATTTTCCAGCTGTGTTCATGGCGACAGAATCATGTAAGACAAAACAAGATGTCATGACTGGTAGTAACCCTGACTGCTGGAGCTGGAAAA CATCTATGAAGT TCCCTG TCAACTTTTGATTGTTGATTATCACGAAGATGAGAGGTTTTAAATTGGACN(T / G)TTTCCACAGAGCTGCTTCTCATACAGCTGATCTCACCAGCTGGGACTGTTAGGTTAAATACTGGAGTGATCAGGTATTTTAATGGAAACTGAG TCACAGCAGGTAAAGATT TGGATGATCGGTTGACAAAAAGTAAGTGAAGGAAAGTGTCCCAGTCAAACGATACATAGTCAATACATGGACAATGAACACAGCTGTGG (such as SEQ ID NO. 1).

[0016] Note: The underlined parts are upstream primer and downstream primer respectively.

[0017] The N at the 201st base of the above sequence is T or G, and this mutation causes polymorphism in the above sequence.

[0018] The genotype of this site was significantly correlated with the resistance of yellowfin sea bream to Streptococcus iniae.

[0019] When the genotype is TG or GG, the yellowfin sea bream has a strong ability to resist dolphin streptococcal disease, that is, the resistance of individuals with TG or GG genotype to dolphin streptococcal disease is higher than that of individuals with TT genotype.

[0020] The present invention also provides a primer for detecting the above SNP molecular marker, the primer comprises an upstream primer F and a downstream primer R, the sequence of the upstream primer F is shown in SEQ ID NO.2, and the sequence of the downstream primer R is shown in SEQ ID NO.3.

[0021] Specifically, the nucleotide sequence of the primer for detecting the above SNP molecular marker is as follows:

[0022] Upstream primer F: CATCTATGAAGTTCCCTG (SEQ ID NO. 2);

[0023] Downstream primer R: AATCTTTACCTGCTGTGA (SEQ ID NO. 3).

[0024] According to the nucleotide sequence shown in SEQ ID NO.1, specific primers for SNP molecular markers are designed, the SNP molecular markers are specifically amplified using the specific primers, the amplified products are sequenced, and the genotype of the SNP molecular marker of yellowfin roughy is determined according to the sequencing results.

[0025] The present invention further provides a kit for detecting the SNP molecular marker, comprising the primers.

[0026] The above second object of the present invention can be achieved by the following technical scheme: A method for detecting the resistance and susceptibility of yellowfin seabream to iniae Streptococcus, comprising the following steps:

[0027] (1) extracting the yellowfin bream genomic DNA to be tested;

[0028] (2) using the above primer pair to specifically amplify the obtained DNA to obtain an amplified product;

[0029] (3) Analyze the fluorescent signal of the amplified product to determine the genotype of the SNP molecular marker of the yellowfin seabream to be tested. The TG and GG genotype individuals in the SNP molecular marker have higher resistance to dolphin streptococcal disease than the TT genotype individuals.

[0030] Furthermore, the above method for detecting the resistance and susceptibility of yellowfin roughy to iniae Streptococcus dolphinii also includes step (4): correlating the genotype of the SNP molecular marker with the growth trait, and further determining whether the yellowfin roughy to be tested is resistant to iniae Streptococcus dolphinii based on the growth trait of the yellowfin roughy to be tested.

[0031] Preferably, the growth traits in step (4) include one or more of eye diameter, head height, body length, total length, body length / body height, body length / head length and body length / caudal peduncle length, wherein large yellowfin roughy individuals having one or more of eye diameter, head height, body length, total length, body length / body height, body length / head length and body length / caudal peduncle length are more resistant to iniam Streptococcus.

[0032] Furthermore, yellowfin roughy individuals with TG or GG genotypes that had enlarged eye diameter, head height, body length, total length, body length / body height, body length / head length, and body length / caudal peduncle were more resistant to S. iniae than those with TT genotypes.

[0033] The SNP marker developed by the present invention is not only related to resistance to dolphin streptococcal disease, but also related to morphological indicators. It is only necessary to simply measure a certain morphological indicator to accurately determine whether the individual is disease-resistant, which saves time and effort.

[0034] The last object of the present invention can be achieved by the following technical scheme: application of the reagent for detecting the SNP molecular marker, the primer, the kit and the method in identifying yellowfin roughy with resistance to inia Streptococcus dolphis.

[0035] The present invention also provides the use of the reagent for detecting the SNP molecular marker, the primer, the kit and the method in screening yellowfin spurred seabream with resistance to iniam streptococcus.

[0036] The present invention further provides the use of the reagent for detecting the SNP molecular marker, the primer, the kit and the method in the early screening of excellent varieties of yellowfin thorny sea bream resistant to iniae streptococcus.

[0037] The present invention also provides the use of the primers in preparing a kit for identifying yellowfin spurred seabream with resistance to iniae streptococcus, screening yellowfin spurred seabream with resistance to iniae streptococcus, and early screening of excellent yellowfin spurred seabream varieties with resistance to iniae streptococcus.

[0038] The present invention has the following advantages:

[0039] (1) The present invention firstly performs whole genome resequencing typing on yellowfin roughy after being infected with Streptococcus indoliens, and screens out a SNP molecular marker significantly associated with the resistance to Streptococcus indoliens of yellowfin roughy through whole genome association analysis. The sequence of the SNP molecular marker is shown in SEQ ID NO.1. The 201st base of the sequence shown in SEQ ID NO.1 starting from the 5' end is T or G. When the genotype of the 201st base on SEQ ID NO.1 is GG or TG, the yellowfin roughy has a strong ability to resist Streptococcus indoliens disease.

[0040] (2) The present invention also discloses a primer for detecting the SNP molecular marker and a kit comprising the primer, wherein the primer or the kit can amplify the yellowfin roughy DNA to be tested, analyze the fluorescent signal of the amplified product, and determine the genotype of the SNP molecular marker of the yellowfin roughy to be tested, wherein the TG and GG genotype individuals in the SNP molecular marker have a higher ability to resist dolphin streptococcal disease than the TT genotype individuals;

[0041] (3) The present invention further associates the genotype of the SNP molecular marker with the morphological data of the individuals in the resistant and susceptible groups. The results show that when the genotype of the 201st position on SEQ ID NO.1 is GG or TG, the growth rate (eye diameter, head height, body length, total length, body length / body height, body length / head length and body length / tail peduncle length) of the yellowfin thorny seabream is better than that of the TT genotype individual. Therefore, when selecting individuals of the yellowfin thorny seabream resistant to dolphin streptococcus disease, individuals with large head height, tail peduncle length and total length can be preferred. The present invention can select yellowfin thorny seabream breeding materials at an early stage, save evaluation time and cost, and effectively improve the efficiency and accuracy of breeding yellowfin thorny seabream varieties with resistance to dolphin streptococcus.

[0042] (4) The primers, kit and method of the present invention can effectively determine whether the yellowfin spurred seabream to be tested is susceptible to infection with Streptococcus iniae, and can also be used for the early screening of excellent varieties of yellowfin spurred seabream resistant to Streptococcus iniae, and can effectively improve the efficiency of yellowfin spurred seabream breeding and shorten the breeding period of yellowfin spurred seabream;

[0043] (5) Therefore, in general, the present invention discloses a SNP molecular marker related to the resistance of yellowfin roughy to Streptococcus ini, and also provides a method for screening the SNP molecular marker and a method for detecting the resistance trait of yellowfin roughy. By using the SNP molecular marker, primer, kit or method of the present invention, yellowfin roughy with resistance to Streptococcus ini can be selected and assisted breeding can be carried out, which can shorten the breeding period of excellent yellowfin roughy resistant to Streptococcus ini. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0045] Figure 1 This is a Manhattan plot of the SNP molecular markers related to the resistance to iniae Streptococcus aureus of yellowfin roughy in Example 1. The figure shows that the SNP molecular markers screened by the present invention are located on chromosome 19 of yellowfin roughy, and the circled points are the SNP molecular markers of the present invention. DETAILED DESCRIPTION

[0046] The technical solution of the present invention is described in detail below in conjunction with specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. The reagents or materials used in the embodiments, unless otherwise specified, are all from commercial channels.

[0047] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0048] Example 1 Screening of SNP Molecular Markers

[0049] 1) Infection of yellowfin seabream with Streptococcus dolphinus

[0050] 1000 healthy yellowfin seabream were selected and injected with 3×10 8 cfu / mL concentration of Streptococcus dolphinus liquid 0.1mL, record the death time of each fish, select the first 80 yellowfin snappers to die as susceptible individuals, and the individuals that did not die after 100 hours as resistant individuals, from which 80 yellowfin snappers were selected. Cut the tail fins of the above 80 susceptible groups and 80 resistant groups, store them in anhydrous ethanol, and replace the anhydrous ethanol once every 24 hours for testing.

[0051] 2) Extraction of genomic DNA of yellowfin bream

[0052] DNA was extracted using a magnetic bead DNA extraction kit, and the above-cut tail fin was used to add reagents in sequence according to the kit instructions to extract the DNA of yellowfin seabream.

[0053] 3) Whole genome sequencing (WAS)

[0054] The extracted DNA was quality tested, and DNA samples with a content of more than 1.5 μg were used to build the library; the genomic DNA was randomly broken into fragments of 350 bp in length. After end repair, phosphorylation and A-tailing, the two ends of the fragments were connected to adapters to prepare a DNA library, which was then sequenced by PE150 on the Illumina platform. After sequencing, the samples were tested for mutations, including SNPs, InDels, and annotations.

[0055] 4) Genome-wide association study (GWAS)

[0056] A mixed linear model was used for trait association analysis, with population genetic structure as a fixed effect and individual relatedness as a random effect to correct for the effects of population structure and individual relatedness: y = Xα + Zβ + Wμ + ey is the phenotypic trait, X is the indicator matrix of the fixed effect, and α is the estimated parameter of the fixed effect. Z is the SNP indicator matrix, β is the SNP effect; W is the random effect matrix, μ is the predicted random individual, and e is the random residual, which obeys e~(0,δe 2 ).

[0057] A SNP molecular marker associated with the resistance to S. iniae in yellowfin roughy was found through genome-wide association analysis (GWAS). The molecular marker is located on chromosome 19 of yellowfin roughy. Figure 1 As shown, that is, the 201st base of the nucleotide sequence shown in SEQ ID NO.1.

[0058] The nucleotide sequence of the SNP molecular marker associated with yellowfin porgy's resistance to dolphin streptococcus disease is as follows:

[0059] GAAGCTCCAAACCACCTGATAGTTTTAATTAGAAGTTGGGACATTTTCCAGCTGTGTTCATGGCGACAGAATCATGTAAGACAAAACAAGATGTCATGACTGGTAGTAACCCTGACTGCTGGAGCTGGAAAA CATCTATGAAGT TCCCTG TCAACTTTTGATTGTTGATTATCACGAAGATGAGAGGTTTTAAATTGGACN(T / G)TTTCCACAGAGCTGCTTCTCATACAGCTGATCTCACCAGCTGGGACTGTTAGGTTAAATACTGGAGTGATCAGGTATTTTAATGGAAACTGAG TCACAGCAGGTAAAGATT TGGATGATCGGTTGACAAAAAGTAAGTGAAGGAAAGTGTCCCAGTCAAACGATACATAGTCAATACATGGACAATGAACACAGCTGTGG (as shown in SEQ ID NO. 1).

[0060] The N at the 201st base of the above sequence is T or G, and this mutation causes the above sequence, namely the sequence shown in SEQ ID NO.1, to become polymorphic.

[0061] Example 2 SNP genotyping

[0062] 1) PCR amplification

[0063] The yellowfin sea bream genomic DNA to be tested was selected as a template, and PCR amplification was performed using the primers shown in the following SEQ ID NO.2-3.

[0064] Specifically, the nucleotide sequences of the primers are as follows:

[0065] Upstream primer F: CATCTATGAAGTTCCCTG (SEQ ID NO. 2);

[0066] Downstream primer R: AATCTTTACCTGCTGTGA (SEQ ID NO. 3).

[0067] PCR reaction conditions: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 40 s, 30 cycles (long fragments >3 kb: denaturation at 94°C for 40 s, annealing at 56°C for 40 s, extension at 72°C for 90 s, 30 cycles); extension at 72°C for 10 min, and storage at 10°C.

[0068] The PCR system was as follows: 0.15 μL of upstream and downstream primers, 10-100 ng of DNA template, 5 μL of 2×PARMS master mix, and ddH2O to make up to 10 μL.

[0069] 2) Analysis on the association between SNP molecular markers and resistance of yellowfin sea bream to Streptococcus dolphinus

[0070] After PCR is completed, the enzyme marker reads the fluorescence signal of the PCR product, and the online software snpdecoder analyzes the converted fluorescence signal and outputs the corresponding genotype according to each fluorescence color analysis. The genotypes in different samples of the SNP site of the present invention can be obtained. The genotype and allele of the SNP molecule and disease resistance were analyzed using the one-way analysis of variance of SPSS26.0, and the results are shown in Tables 1 and 2.

[0071] Table 1 Statistical table of the distribution differences of SNP molecular marker genotypes between susceptible group and resistant group

[0072]

[0073] Table 2 Statistical table of the distribution differences of SNP molecular marker alleles between susceptible group and resistant group

[0074]

[0075] Note: the site 9427980T / G means that the 201st base N starting from the 5' end on the SNP molecular marker of the present invention is T or G.

[0076] As can be seen from Table 1 and Table 2, among the previously screened SNP molecular markers, the genotype frequency and allele frequency were significantly different in the susceptible group and the resistant group (P < 0.001). The frequency of individuals with genotype GG or TG in the resistant group was significantly greater than that in the susceptible group, indicating that individuals with the 201st genotype GG or TG were more resistant to infection than those with the TT gene.

[0077] Furthermore, the genotype of the SNP molecular marker was associated with the growth trait, and based on the growth traits of the yellowfin roughy to be tested, it was further determined whether the yellowfin roughy to be tested was resistant to iniam Streptococcus. The results showed that it was only necessary to measure a specific growth trait to determine whether the yellowfin roughy to be tested was resistant to iniam Streptococcus.

[0078] Table 3 below shows the results of association analysis between the genotypes of SNP molecular markers and growth traits.

[0079] Table 3 Results of association analysis between genotypes of SNP molecular markers and growth traits

[0080] 9427980T / G TT TG GG p Kiss length (cm) 0.45±0.01 0.44±0.01 0.45±0.03 0.607 Eye diameter (cm) 0.89±0.01a 0.92±0.01ab 0.97±0.03b 0.0365 Interocular distance (cm) 0.86±0.01 0.86±0.01 0.84±0.02 0.524 Head length (cm) 2.54±0.02 2.56±0.02 2.55±0.06 0.816 Head height (cm) 3.25±0.03a 3.35±0.03b 3.47±0.08b 0.00645 Body height(cm) 4.05±0.04 4.13±0.04 4.23±0.12 0.168 Caudal peduncle length (cm) 1.87±0.02 1.93±0.02 1.96±0.05 0.0636 Caudal peduncle height (cm) 1.13±0.01 1.15±0.01 1.19±0.040 0.178 Body length (cm) 9.97±0.09a 10.20±0.08a 11.40±0.90b 0.00031 Total length (cm) 11.60±0.10a 11.90±0.09a 12.30±0.33b 0.0204 Body mass (g) 30.5±0.89 31.2±0.7 35.6±3.17 0.0915 Body length / height 2.47±0.01a 2.48±0.01a 2.67±0.18b 0.000863 Body length / head length 3.92±0.03a 4.00±0.02a 4.45±0.34b 0.0000846 Head length / snout length 5.80±0.13 6.00±0.10 5.84±0.30 0.462 Head length / eye diameter 2.97±0.03 2.98±0.02 3.06±0.06 0.394 Body length / tail peduncle length 5.35±0.04a 5.31±0.03a 5.79±0.45b 0.00838 Tail peduncle length / tail peduncle height 1.65±0.02 1.68±0.01 1.66±0.04 0.457

[0081] As can be seen from Table 3, from the 201st position from the 5' end, the eye diameter, head height, body length, total length, body length / body height, body length / head length and body length / tail peduncle length of individuals with genotype GG or TG were significantly greater than those of individuals with genotype TT (P<0.05).

[0082] Therefore, the present invention performed association analysis on the SNP site with the morphological data of individuals in the resistant and susceptible groups. The results showed that when the genotype at position 201 on SEQ ID NO.1 was TG or GG, the growth rate (one or more of eye diameter, head height, body length, total length, body length / body height, body length / head length and body length / tail peduncle length) of yellowfin roughy was better than that of individuals with the TT genotype.

[0083] Therefore, when selecting individuals of yellowfin thorny seabream resistant to dolphin streptococcus disease, the present invention can preferably select individuals with one or more of the same traits among eye diameter, head height, body length, total length, body length / body height, body length / head length, and body length / tail peduncle length. Furthermore, the present invention can perform early selection of yellowfin thorny seabream breeding materials, save evaluation time and cost, and effectively improve the efficiency and accuracy of breeding yellowfin thorny seabream varieties resistant to dolphin streptococcus.

[0084] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A SNP molecular marker associated with yellowfin seabream's resistance to dolphin streptococcus disease, characterized in that: The SNP molecular marker is located on chromosome 19 of yellowfin roughy, and the sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The base N at the 201st position starting from the 5' end of the sequence shown in SEQ ID NO.1 is T or G; the TG and GG genotype individuals in the SNP molecular marker have higher resistance to dolphin streptococcal disease than the TT genotype individuals.

2. A method for detecting the resistance of yellowfin seabream to iniae Streptococcus, characterized in that The following steps are involved: (1) Extracting genomic DNA of yellowfin bream to be tested; (2) using primers for detecting the SNP molecular marker described in claim 1 to specifically amplify the obtained DNA to obtain an amplified product; The primers include an upstream primer F and a downstream primer R, the sequence of the upstream primer F is shown in SEQ ID NO.2, and the sequence of the downstream primer R is shown in SEQ ID NO.3; (3) Analyze the fluorescence signal of the amplified product to determine the genotype of the SNP molecular marker of the yellowfin seabream to be tested. The TG and GG genotype individuals in the SNP molecular marker have higher resistance to dolphin streptococcal disease than the TT genotype individuals.

3. The method for detecting the resistance of yellowfin seabream to iniae Streptococcus according to claim 2, characterized in that The method further comprises step (4): analyzing the correlation between the genotype of the SNP molecular marker and the growth trait, and further determining whether the yellowfin roughy to be tested is resistant to iniam streptococcus according to the growth trait of the yellowfin roughy to be tested.

4. The method for detecting the resistance and susceptibility of yellowfin seabream to iniae Streptococcus according to claim 3, characterized in that: The growth traits in step (4) include one or more of eye diameter, head height, body length, total length, body length / body height, body length / head length and body length / caudal peduncle length, wherein large yellowfin bream individuals are more resistant to iniae Streptococcus.

5. Use of primers for detecting the SNP molecular markers according to claim 1 in preparing a kit for identifying yellowfin roughy with resistance to iniae Streptococcus dolphins, screening yellowfin roughy with resistance to iniae Streptococcus dolphins, and early screening of excellent yellowfin roughy resistant to iniae Streptococcus dolphins varieties; the TG and GG genotype individuals in the SNP molecular markers have higher resistance to iniae Streptococcus dolphins than the TT genotype individuals.

6. Use of a reagent for detecting the SNP molecular marker described in claim 1, a kit comprising primers for detecting the SNP molecular marker described in claim 1, and the method described in claim 2, 3 or 4 in identifying yellowfin roughy with resistance to inia streptococcus; the TG and GG genotype individuals in the SNP molecular marker have higher resistance to inia streptococcus disease than the TT genotype individuals.

7. Use of a reagent for detecting the SNP molecular marker described in claim 1, a kit comprising primers for detecting the SNP molecular marker described in claim 1, and the method described in claim 2, 3 or 4 in screening yellowfin roughy with resistance to inia streptococcus; the TG and GG genotype individuals in the SNP molecular marker have higher resistance to inia streptococcus disease than the TT genotype individuals.

8. Use of a reagent for detecting the SNP molecular marker described in claim 1, a kit comprising primers for detecting the SNP molecular marker described in claim 1, and the method described in claim 2, 3 or 4 in the early screening of superior varieties of yellowfin sea bream resistant to Streptococcus india; the TG and GG genotype individuals in the SNP molecular marker have higher resistance to Streptococcus india than the TT genotype individuals.

Images